Comprehensive model for X-ray-induced damage in protein crystallography.

Acquisition of X-ray crystallographic data is always accompanied by structural degradation owing to the absorption of energy. The application of high-fluency X-ray sources to large biomolecules has increased the importance of finding ways to curtail the onset of X-ray-induced damage. A significant effort has been under way with the aim of identifying strategies for protecting protein structure. A comprehensive model is presented that has the potential to explain, both qualitatively and quantitatively, the structural changes induced in crystalline protein at ∼100 K. The first step is to consider the qualitative question: what are the radiation-induced intermediates and expected end products? The aim of this paper is to assist in optimizing these strategies through a fundamental understanding of radiation physics and chemistry, with additional insight provided by theoretical calculations performed on the many schemes presented.

Yields of damage to C4' deoxyribose and to pyrimidines in pUC18 by the direct effect of ionizing radiation.

Our mechanistic understanding of damage formation in DNA by the direct effect relies heavily on what is known of free radical intermediates studied by EPR spectroscopy. Bridging this information to stable product formation requires methods with comparable sensitivities, a criterion met by the (32)P-post-labeling assay developed by Weinfeld and Soderlind, [Weinfeld,M. and Soderlind,K.-J.M. (1991) (32)P-Postlabeling detection of radiation-induced DNA damage: identification and estimation of thymine glycols and phosphoglycolate termini. Biochemistry, 30, 1091-1097] which when applied to the indirect effect, detected phosphoglycolate (pg) and thymine glycol (Tg). Here we applied this assay to the direct effect, measuring product yields in pUC18 films with hydration levels (Γ) of 2.5, 16 or 23 waters per nucleotide and X-irradiated at either 4 K or room temperature (RT). The yields of pg [G(pg)] for Γ ≈ 2.5 were 2.8 ± 0.2 nmol/J (RT) and 0.2 ± 0.3 nmol/J (4 K), which is evidence that the C4' radical contributes little to the total deoxyribose damage via the direct effect. The yield of detectable base damage [G(B*)] at Γ ≈ 2.5 was found to be 30.2 ± 1.0 nmol/J (RT) and 12.9 ± 0.7 nmol/J (4 K). While the base damage called B*, could be due to either oxidation or reduction, we argue that two reduction products, 5,6-dihydrouracil and 5,6-dihydrothymine, are the most likely candidates.

Insights into the mechanism of X-ray-induced disulfide-bond cleavage in lysozyme crystals based on EPR, optical absorption and X-ray diffraction studies.

Electron paramagnetic resonance (EPR) and online UV-visible absorption microspectrophotometry with X-ray crystallography have been used in a complementary manner to follow X-ray-induced disulfide-bond cleavage. Online UV-visible spectroscopy showed that upon X-irradiation, disulfide radicalization appeared to saturate at an absorbed dose of approximately 0.5-0.8 MGy, in contrast to the saturating dose of ∼0.2 MGy observed using EPR at much lower dose rates. The observations suggest that a multi-track model involving product formation owing to the interaction of two separate tracks is a valid model for radiation damage in protein crystals. The saturation levels are remarkably consistent given the widely different experimental parameters and the range of total absorbed doses studied. The results indicate that even at the lowest doses used for structural investigations disulfide bonds are already radicalized. Multi-track considerations offer the first step in a comprehensive model of radiation damage that could potentially lead to a combined computational and experimental approach to identifying when damage is likely to be present, to quantitate it and to provide the ability to recover the native unperturbed structure.

DNA damage by the direct effect of ionizing radiation: products produced by two sequential one-electron oxidations.

It has long been assumed that the population of radicals trapped in irradiated DNA (that is, the radicals escaping recombination) would quantitatively account for the lesions observed in DNA. Recent results indicate that this is not the case. The yield of DNA lesions exceed the yield of trappable radicals. To account for a portion of this shortfall, it is thought that some of the initially formed 2'-deoxyribose radicals undergo a second oxidation by nearby base cation radicals to form 2'-carbocations. The carbocations react to give strand breaks and free base release. Schemes are presented to account for the major oxidation products observed including 8-oxoGua, 8-oxoAde, 5-OHMeUra, and free base release. Theoretical calculations were performed to ascertain the likelihood of the second oxidation step in these reaction pathways actually occurring, and to account for base sequence dependence and various levels of hydration.

Direct damage to the backbone of DNA oligomers is influenced by the OH moiety at strand ends, by the type of base, and by context.

Previous studies on high molecular weight DNA found that backbone damage, as monitored by free base release, is relatively independent of the type of base; i.e., the yields of all four bases were nearly equal. This could be due to a lack of influence of any given base over damage to its own deoxyribose or it could be a consequence of averaging out disparities due to each base sampling a wide range of base contexts. This study is aimed at distinguishing between these two possibilities. Transparent films, prepared from palindromic oligodeoxynucleotides of d(CTCTCGAGAG), d(CTCTCGAGAGp), d(pCTCTCGAGAGp), d(GAGAGCTCTC), d(ACGCGCGCGT), d(AACGCGCGCGTT), d(CTCTCTTAATAATTATAATTATTAAGAGAG), and d(CTCTCTTAATATTAAGAGAG), were used for this investigation. The DNA films, hydrated to approximately 2.5 waters per nucleotide, were irradiated at RT under air using X-rays generated by a tungsten tube, immediately dissolved in nuclease-free water, and stored at 277 K for 24 h, and then unaltered free base release was measured using HPLC. Yields of free base release were based on a target mass consisting of the DNA and one counterion+2.5 H2O/nucleotide. The yields of each base, G(C), G(G), G(T), and G(A) were determined for each of the above sequences. The observed yields lead to the following conclusions: (i) base release at the oligomer ends is favored over release at internal positions (called the end effect), (ii) phosphorylation of the OH moiety at the oligomer ends quenches the end effect, (iii) the magnitude of the end effect is influenced by the base at the end and the bases proximal to it, and (iv) the release of base is influenced by the base and its context.

Mechanisms of strand break formation in DNA due to the direct effect of ionizing radiation: the dependency of free base release on the length of alternating CG oligodeoxynucleotides.

The question of how NA base sequence influences the yield of DNA strand breaks produced by the direct effect of ionizing radiation was investigated in a series of oligodeoxynucleotides of the form (d(CG)(n))(2) and (d(GC)(n))(2). The yields of free base release from X-irradiated DNA films containing 2.5 waters/nucleotide were measured by HPLC as a function of oligomer length. For (d(CG)(n))(2), the ratio of the Gua yield to Cyt yield, R, was relatively constant at 2.4-2.5 for n = 2-4 and it decreased to 1.2 as n increased from 5 to 10. When Gua was moved to the 5' end, for example going from d(CG)(5) to d(GC)(5), R dropped from 1.9 +/- 0.1 to 1.1 +/- 0.1. These effects are poorly described if the chemistry at the oligomer ends is assumed to be independent of the remainder of the oligomer. A mathematical model incorporating charge transfer through the base stack was derived to explain these effects. In addition, EPR was used to measure the yield of trapped-deoxyribose radicals at 4 K following X-irradiation at 4 K. The yield of free base release was substantially greater, by 50-100 nmol/J, than the yield of trapped-deoxyribose radicals. Therefore, a large fraction of free base release stems from a nonradical intermediate. For this intermediate, a deoxyribose carbocation formed by two one-electron oxidations is proposed. This reaction pathway requires that the hole (electron loss site) transfers through the base stack and, upon encountering a deoxyribose hole, oxidizes that site to form a deoxyribose carbocation. This reaction mechanism provides a consistent way of explaining both the absence of trapped radical intermediates and the unusual dependence of free base release on oligomer length.

Multiplicity of DNA single-strand breaks produced in pUC18 exposed to the direct effects of ionizing radiation.

The transition of plasmid DNA from a supercoiled to an open circle conformation, as detected by gel electrophoresis, affords an extraordinarily sensitive method for detecting single-strand breaks (SSBs), one measure of deoxyribose damage. To determine the yield of SSBs, G(ssb), by this method, it is commonly assumed that Poisson statistics apply such that, on average, one SSB occurs per supercoiled plasmid lost. For the direct effect, at a large enough plasmid size, this assumption may be invalid. In this report, the assumption that one SSB occurs per pUC18 plasmid (2686 bp) is tested by measuring free base release (fbr), which is also a measure of deoxyribose damage in films prepared under controlled relative humidity so as to produce known levels of DNA hydration. The level of DNA hydration, Gamma, is expressed in mol water/mol nucleotide. The yield of free base release, G(fbr), was measured by HPLC after exposure of the films to 70 kV X rays and subsequent dissolution in water. It is well known that damage in deoxyribose leads to SSBs and free base release. Based on known mechanisms, there exists a close correspondence between free base release and SSBs, i.e., G(fbr) congruent with G(ssb). Following this assumption, the SSB multiplicity, m(ssb), was determined, where m(ssb) was defined as the mean number of SSBs per supercoiled plasmid lost. The yield of lost supercoil was determined previously (S. Purkayastha et al., J. Phys. Chem. B 110, 26286-26291, 2006). We found that m(ssb) = 1.4 +/- 0.2 at Gamma = 2.5 and m(ssb) = 2.8 +/- 0.5 to 3.1 +/- 0.5 at Gamma = 22.5, indicating that the assumption of one SSB per lost supercoil is not likely to hold for a 2686-bp plasmid exposed to the direct effect. In addition, an increase in G(fbr), upon stepping from Gamma = 2.5 to Gamma = 22.5, was paralleled by an increase in the yield of trapped deoxyribose radicals, G(dRib)(fr), also measured previously. As a consequence, the shortfall between SSBs and trapped radicals, G(diff) = G(ssb) - G(dRib)(fr), remained relatively constant at 90-110 nmol/J. The lack of change between the two extremes of hydration is in keeping with the suggestion that non-radical species, such as doubly oxidized deoxyribose, are responsible for the shortfall.

On the chemical yield of base lesions, strand breaks, and clustered damage generated in plasmid DNA by the direct effect of X rays.

The purpose of this study was to determine the yield of DNA base damages, deoxyribose damage, and clustered lesions due to the direct effects of ionizing radiation and to compare these with the yield of DNA trapped radicals measured previously in the same pUC18 plasmid. The plasmids were prepared as films hydrated in the range 2.5 < Gamma < 22.5 mol water/mol nucleotide. Single-strand breaks (SSBs) and double-strand breaks (DSBs) were detected by agarose gel electrophoresis. Specific types of base lesions were converted into SSBs and DSBs using the base-excision repair enzymes endonuclease III (Nth) and formamidopyrimidine-DNA glycosylase (Fpg). The yield of base damage detected by this method displayed a strikingly different dependence on the level of hydration (Gamma) compared with that for the yield of DNA trapped radicals; the former decreased by 3.2 times as Gamma was varied from 2.5 to 22.5 and the later increased by 2.4 times over the same range. To explain this divergence, we propose that SSB yields produced in plasmid DNA by the direct effect cannot be analyzed properly with a Poisson process that assumes an average of one strand break per plasmid and neglects the possibility of a single track producing multiple SSBs within a plasmid. The yields of DSBs, on the other hand, are consistent with changes in free radical trapping as a function of hydration. Consequently, the composition of these clusters could be quantified. Deoxyribose damage on each of the two opposing strands occurs with a yield of 3.5 +/- 0.5 nmol/J for fully hydrated pUC18, comparable to the yield of 4.1 +/- 0.9 nmol/J for DSBs derived from opposed damages in which at least one of the sites is a damaged base.

Unaltered free base release from d(CGCGCG)2 produced by the direct effect of ionizing radiation at 4 K and room temperature.

Unaltered free base release in d(CGCGCG)2 exposed to X rays at 4 K or room temperature was measured by HPLC. Samples were prepared either as films hydrated to a level of Gamma = 2.5 mol water/mol nucleotide or as polycrystalline with Gamma approximately 7.5 mol water/mol nucleotide. X irradiation of films at 4 K, followed by annealing to room temperature, resulted in yields for cytosine and guanine of G(Cyt) = 0.036 +/- 0.001 micromol/J and G(Gua) = 0.090 +/- 0.002 micromol/J. Irradiation of films at room temperature gave similar yields. The yields for polycrystalline d(CGCGCG)2 X-irradiated at room temperature were G(Cyt) = 0.035 +/- 0.005 micromol/J and G(Gua) = 0.077 +/- 0.023 micromol/J. The total free base release yield, G(fbr), was 0.124 +/- 0.008 micromol/J for films and 0.112 +/- 0.028 micromol/J for polycrystalline samples. G(fbr) is believed to be a good estimate of total strand break yield. The yields of total free radicals trapped [G(Sigmafr)] by the d(CGCGCG)2 films at 4 K were measured by EPR. The measured value, G(Sigmafr) = 0.450 +/- 0.005 micromol/J, was used to calculate the yield of trappable sugar radicals, giving G(sugar)(fr) = 0.04-0.07 micromol/J. We found that (1) guanine release exceeded cytosine release by more than twofold, (2) G(sugar)(fr) cannot account for more than half of the free base release, and (3) G(fbr), G(Cyt) and G(Gua) were independent of the sample temperature during irradiation. Finding (1) suggests that base and or sequence influences sugar damage, and finding (2) is consistent with our working hypothesis that an important pathway to strand break formation entails two one-electron oxidations at the same sugar site.

Mechanisms of direct radiation damage in DNA, based on a study of the yields of base damage, deoxyribose damage, and trapped radicals in d(GCACGCGTGC)(2).

Dose-response curves were measured for the formation of direct-type DNA products in X-irradiated d(GCACGCGTGC)(2)prepared as dry films and as crystalline powders. Damage to deoxyribose (dRib) was assessed by HPLC measurements of strand break products containing 3' or 5' terminal phosphate and free base release. Base damage was measured using GC/ MS after acid hydrolysis and trimethylsilylation. The yield of trappable radicals was measured at 4 K by EPR of films X-irradiated at 4 K. With exception of those used for EPR, all samples were X-irradiated at room temperature. There was no measurable difference between working under oxygen or under nitrogen. The chemical yields (in units of nmol/J) for trapped radicals, free base release, 8-oxoGua, 8-oxoAde, diHUra and diHThy were G(total)(fr) = 618 +/- 60, G(fbr) = 93 +/- 8, G(8-oxoGua) = 111 +/- 62, G(8-oxoAde) = 4 +/- 3, G(diHUra) = 127 +/- 160, and G(diHThy) = 39 +/- 60, respectively. The yields were determined and the dose-response curves explained by a mechanistic model consisting of three reaction pathways: (1) trappable-radical single-track, (2) trappable-radical multiple-track, and (3) molecular. If the base content is projected from the decamer's GC:AT ratio of 4:1 to a ratio of 1:1, the percentage of the total measured damage (349 nmol/J) would partition as follows: 20 +/- 16% 8-oxoGua, 3 +/- 3% 8-oxoAde, 28 +/- 46% diHThy, 23 +/- 32% diHUra, and 27 +/- 17% dRib damage. With a cautionary note regarding large standard deviations, the projected yield of total damage is higher in CG-rich DNA because C combined with G is more prone to damage than A combined with T, the ratio of base damage to deoxyribose damage is approximately 3:1, the yield of diHUra is comparable to the yield of diHThy, and the yield of 8-oxoAde is not negligible. While the quantity and quality of the data fall short of proving the hypothesized model, the model provides an explanation for the dose-response curves of the more prevalent end products and provides a means of measuring their chemical yields, i.e., their rate of formation at zero dose. Therefore, we believe that this comprehensive analytical approach, combined with the mechanistic model, will prove important in predicting risk due to exposure to low doses and low dose rates of ionizing radiation.

Protection of DNA against direct radiation damage by complex formation with positively charged polypeptides.

Radioprotection of DNA from direct-type radiation damage by histones has been studied in model systems using complexes of positively charged polypeptides (PCPs) with DNA. PCPs bind to DNA via ionic interactions mimicking the mode of DNA-histone binding. Direct radiation damage to DNA in films of DNA-PCP complexes was quantified as unaltered base release, which correlates closely with DNA strand breaks. All types of PCPs tested protected DNA from radiation, with the maximum radioprotection being approximately 2.5-fold compared with non-complexed DNA. Conformational changes of the DNA induced by PCPs or repair of free radical damage on the DNA sugar moiety by PCPs are considered the most feasible mechanisms of radioprotection of DNA. The degree of radioprotection of DNA by polylysine (PL) increased dramatically on going from pure DNA to a molar ratio of PL monomer:DNA nucleotide approximately 1:2, while a further increase in the PL:DNA ratio did not offer more radioprotection. This concentration dependence is in agreement with the model of PCP binding to DNA that assumes preferential binding of positively charged side groups to DNA phosphates in the minor groove, so that the maximum occupancy of all minor-groove PCP binding sites is at a molar ratio of PCP:DNA = 1:2.

The role of hydration in the distribution of free radical trapping in directly ionized DNA.

The purpose of this study was to elucidate the role of hydration (Gamma) in the distribution of free radical trapping in directly ionized DNA. Solid-state films of pUC18 (2686 bp) plasmids were hydrated to Gamma in the range 2.5 < or = Gamma < or = 22.5 mol water/mol nucleotide. Free radical yields, G(Sigmafr), measured by EPR at 4 K are seen to increase from 0.28 +/- 0.01 micromol/J at Gamma = 2.5 to 0.63 +/- 0.01 micromol/J at Gamma= 22.5, respectively. Based on a semi-empirical model of the free radical trapping events that follow the initial ionizations of the DNA components, we conclude that two-thirds of the holes formed on the inner solvation shell (Gamma < 10) transfer to the sugar-phosphate backbone. Likewise, of the holes produced by direct ionization of the sugar-phosphate, about one-third are trapped by deprotonation as neutral sugar-phosphate radical species, while the remaining two-thirds are found to transfer to the bases. This analysis provides the best measure to date for the probability of hole transfer (approximately 67%) into the base stack. It can thus be predicted that the distribution of holes formed in fully hydrated DNA at 4 K will be 78% on the bases and 22% on the sugar-phosphate. Adding the radicals due to electron attachment (confined to the pyrimidine bases), the distribution of all trapped radicals will be 89% on the bases and 11% on the sugar-phosphate backbone. This prediction is supported by partitioning results obtained from the high dose-response curves fitted to the two-component model. These results not only add to our understanding of how the holes redistribute after ionization but are also central to predicting the yield and location of strand breaks in DNA exposed to the direct effects of ionizing radiation.

An investigation into the mechanisms of DNA strand breakage by direct ionization of variably hydrated plasmid DNA.

The mechanisms by which ionizing radiation directly causes strand breaks in DNA were investigated by comparing the chemical yield of DNA-trapped free radicals to the chemical yield of DNA single strand break (ssb) and double strand break (dsb), as a function of hydration (Gamma). Solid-state films of plasmid pUC18, hydrated to 2.5 < Gamma < 22.5 mol, were X-irradiated at 4 K, warmed to room temperature, and dissolved in water. Free radical yields were determined by EPR at 4 K. With use of the same samples, Gel electrophoresis was used to measure the chemical yield of total strand breaks, which includes prompt plus heat labile ssb; G'total(ssb) decreased from 0.092 +/- 0.016 micromol/J at Gamma= 2.5 to 0.066 +/- 0.008 micromol/J at Gamma= 22.5. Most provocative is that at Gamma= 2.5 the yield of total ssb exceeds the yield of trapped deoxyribose radicals: G'total(ssb) - G'sugar(fr) = 0.06 +/- 0.02 micromol/J. Nearly 2/3 of the strand breaks are derived from precursors other than radicals trapped on the deoxyribose moiety. To account for these nonradical precursors, we hypothesize that strand breaks are produced by two one-electron oxidations at a single deoxyribose residue within an ionization cluster.

The release of 5-methylene-2-furanone from irradiated DNA catalyzed by cationic polyamines and divalent metal cations.

Release of 5-methylene-2-furanone (5-MF), a characteristic marker of DNA deoxyribose oxidative damage at the C1' position, was observed in significant quantities from X-irradiated DNA. This observation, which held for DNA irradiated either in aqueous solution or as a film, requires postirradiation treatment at 90 degrees C in the presence of polyamines and divalent metal cations at biological pH. The 5-MF product was quantified by using reverse-phase HPLC. The radiation chemical yield of 5-MF comprised more than 30% of the yield of total unaltered base release. Polylysine, spermine and Be(II) showed the strongest catalytic effect on 5-MF release, while Zn(II), Cu(II), Ni(II), putrescine and Mg(II) were substantially less efficient. We have hypothesized that the 5-MF release from irradiated DNA occurs through catalytic decomposition of the 2'-deoxyribonolactone (dL) precursor through two consecutive beta- and delta-phosphate elimination reactions. A stepwise character of the process was indicated by the S-shaped time course of 5-MF accumulation. If dL proves to be the precursor to 5-MF formation, it would then follow that dL is a very important lesion generated in DNA by ionizing radiation.

Correlation of free radical yields with strand break yields produced in plasmid DNA by the direct effect of ionizing radiation.

The purpose of this study was to determine how free radical formation (fr) correlates with single strand break (ssb) and double strand break (dsb) formation in DNA exposed to the direct effects of ionizing radiation. Chemical yields have been determined of (i) total radicals trapped on DNA at 4 K, G(Sigmafr), (ii) radicals trapped on the DNA sugar, Gsugar(fr), (iii) prompt single strand breaks, Gprompt(ssb), (iv) total single strand breaks, Gtotal(ssb), and (v) double strand breaks, G(dsb). These measurements make it possible, for the first time, to quantitatively test the premise that free radicals are the primary precursors to strand breaks. G(fr) were measured by EPR applied to films of pEC (10,810 bp) and pUC18 (2686 bp) plasmids hydrated to Gamma = 22 mol of water/nucleotide and X-irradiated at 4 K. Using these same samples warmed to room temperature, strand breaks were measured by gel electrophoresis. The respective values for pEC and pUC18 were G(fr) = 0.71 +/- 0.02 and 0.61 +/- 0.01 micromol/J, Gtotal(ssb) = 0.09 +/- 0.01 and 0.14 +/- 0.01 micromol/J, G(dsb) = 0.010 +/- 0.001 and 0.006 +/- 0.001 micromol/J, and Gtota)(ssb)/G(dsb) approximately 9 and approximately 20. Surprisingly, Gsugar(fr) approximately 0.06 mumol/J for pUC18 films, less than half of Gtotal(ssb). This indicates that a significant fraction of strand breaks are derived from precursors other than trapped DNA radicals. To explain this disparity, various mechanisms were considered, including one that entails two one-electron oxidations of a single deoxyribose carbon.

Strand breaks produced in X-írradiated crystalline DNA: influence of base sequence.

This study reports the radiation-chemical yields for DNA single-strand breaks (SSBs) in crystals of CGCACG:CGTGCG (I) and CACGCG:CGCGTG (II) duplexes induced by direct ionization using X rays. The DNA fragmentation products, consisting of 3'- and 5'-phosphate-terminated fragments, were quantified by ion-exchange chromatography using a set of reference compounds. The yields of single-strand breaks in I and II are 0.16 +/- 0.03 micro mol/J and 0.07 +/- 0.02 micro mol/J, respectively. The probability of cleavage at a given site is relatively independent of which of the four bases is at that site. For the very small sample of base sequences studied to date, there is no obvious dependence on base sequence. However, there appears to be an increased frequency of strand breaks at the non-phosphorylated termini of the oligodeoxynucleotides. These results show that direct ionization is efficient at producing single-strand breaks in DNA and that its action is relatively indiscriminate with respect to base sequence.

Reductive damage in directly ionized DNA: saturation of the C5=C6 bond of cytosine in d(CGCG)(2) crystals.

Electron paramagnetic resonance (EPR) was used to study an oligodeoxynucleotide duplex of d(CGCG)(2) that is known to crystallize in Z-form. After X irradiation at 4 K, EPR data were collected on single crystals and polycrystalline samples as a function of annealing temperature and dose. A radical produced by the net gain of a hydrogen atom at C6 and a proton at N3, Cyt(C6+H, N3+H(+))(+*), is identified. This radical had not been positively identified in polymeric DNA previously. The Cyt(C6+H, N3+H(+))(+*) makes up about 4% of the total radical population at 4 K, increasing to about 10-15% after the DNA is annealed to 240 K. There appears to be neither an increase nor a decrease in the absolute concentration of Cyt(C6+H, N3+H(+))(+*) upon annealing from 4 K to 240 K. Additionally, the presence of another radical, one due to the net gain of hydrogen at C5 of cytosine, the Cyt(C5+H)(*), is implicated. Together, these two radicals appear to account for 60-80% of the reduced species in DNA that has been irradiated at 4 K and annealed to 240 K.

Strand breaks in X-irradiated crystalline DNA: alternating CG oligomers.

Direct ionization of crystalline d(CGCGCGCG) and d(CGCGCGCGCG) oligomers produces 3'- and 5'-phosphate-terminated fragments as the main strand breakage products detectable by ion-exchange chromatography. The nature of the base has no effect on the probability of strand breakage at the given site. The yields of 3'-phosphates are systematically lower than the yields of the 5'-phosphates originating from the same cleavage site, pointing to the possible presence of unidentified products with sugar remnants attached to the 3'-end. These results show that direct ionization is efficient at producing single-strand breaks in DNA and its action is relatively indiscriminate with respect to base sequence.

What is the initial chemical precursor of DNA strand breaks generated by direct-type effects?

The present study tests the hypothesis that the majority of DNA strand breaks produced by direct-type effects are due to sugar free radical precursors and that these radicals are produced by direct ionization of the sugar-phosphate backbone or by hole transfer to the sugar from tightly bound water. Well-defined crystalline DNA samples of d(CGCG)(2), d(CGCACG:GCGTGC), d(GTGCGCAC)(2), and d((GCACGCGTGC)(2) were irradiated at 4 K, and their free radical dose response determined from 0 to 1800 kGy. A model is proposed that effectively describes the dose response curves. It includes the following parameters: the free radical concentration at saturation C(max), the free radical yields G(b) and G(s), and the destruction constants k(b) and k(s). The subscripts b and s refer to base-centered and sugar-centered radicals, respectively. In each of these systems, the free radical concentration exhibits a remarkable resistance to dose saturation up to at least 1500 kGy. As predicted, G(b) > G(s), the G(b)/G(s) ratio varying between 4 and 12. Likewise, k(b) > k(s), the k(b)/k(s) ratio varying between 28 and 81. The lower cross-section for destruction of the sugar-centered radicals is consistent with the expectation that they are relatively radiation resistant. G(b)/G is between 0.81 and 0.92, indicating that at low doses the bases trap out 80-90% of the total free radical population. The remaining 10-20% are located on the sugar. At high dose, a larger fraction of the radicals are trapped on the backbone as seen from the ratio C(mxS)/C(mxB), which ranges from 3.5 to 8. This unusually late onset of dose saturation closely parallels that observed for strand break products in earlier studies. There is, therefore, a good correlation between the dose response profiles of sugar-trapped radicals and strand breaks. These observations strongly support the hypothesis that sugar radicals are precursors to the majority of strand breaks produced by the direct-type effect in DNA.

Diffusion Approach to Long Distance Charge Migration in DNA: Time-Dependent and Steady-State Analytical Solutions for the Product Yields.

In this study we report analytical solutions for both time-dependent and steady-state problems of unbiased charge transfer through a regular DNA sequence via a hopping mechanism. The phenomenon is treated as a diffusion of charge in a one-dimensional array of equally spaced and energetically equivalent temporary trapping sites. The solutions take into account the rates of charge hopping (k), side reactions (k(r)), and charge transfer to a terminal charge acceptor (k(t)). A detailed analysis of the time-dependent problem is performed for the diffusion-controlled regime, i.e., under the assumption that k(t) >> k, which is also equivalent to the fast relaxation limit of charge trapping. The analysis shows that the kinetics of charge hopping through DNA is always multiexponential, but under certain circumstances it can be asymptotically approximated by a single-exponential term. In that case, the efficiency of charge transfer can be characterized by a single rate constant k(CT) = 1.23kN(-2) + k(r), where N is the DNA length expressed in terms of the number of equidistant trapping sites and k(r) is the rate of competing chemical processes. The absolute yield of charge transfer under steady-state conditions in general is obtained as Y(infinity) = omega [alpha sinh(alphaN) + omega cosh(alphaN)](-1), where alpha = (2k(r)/k)(1/2) and omega = 2k(t)/k. For the diffusion-controlled regime and small N, in particular, it turns into the known "algebraic" dependence Y(infinity) = [1 + (k(r)/k)N(2)](-1). At large N the solution is asymptotically exponential with the parameter alpha mimicking the tunneling parameter beta in agreement with earlier predictions. Similar equations and distance dependencies have also been obtained for the damage ratios at the intermediate and terminal trapping sites in DNA. The nonlinear least-squares fit of one of these equations to experimental yields of guanine oxidation available from the literature returns kinetic parameters that are in reasonable agreement with those obtained by Bixon et al. [Proc. Natl. Acad. Sci. U.S.A.1999, 96, 11713-11716] by numerical simulations, suggesting that these two approaches are physically equivalent.