Nasal eosinophilic angiocentric fibrosis with IgG4-positive plasma cell infiltration.

INTRODUCTION: Eosinophilic angiocentric fibrosis (EAF) is a rare lesion that predominantly affects the upper respiratory tract. Its etiology is unknown and it has been recently associated with the IgG4- related disease (IgG4-RD) spectrum. To the author's knowledge, this is the sixth case report of the relationship between EAF and IgG4-RD. CASE REPORT: We report the case of a 37-year-old woman with nasal deformity and facial pain. The lesion was surgically excised. Histological examination revealed features of EAF with an IgG4/IgG plasma cell ratio ≷73% and 31 IgG4 stained cells per high power field. No clinical or radiological recurrence was detected during follow-up. Serum IgG4 quantification one year after surgery was within normal limits. DISCUSSION: The relationship between both entities may have therapeutic impact because IgG4-RD of the head and neck has a high remission rate with corticosteroids and immunosuppressive therapy. Additional reports of this infrequent disease are necessary to elucidate appropriate treatment and prognosis.

5' and 3' ß-globin haplotypes in purepechas and Tarahumaras, two Mexican indigenous groups.

OBJECTIVE: The purpose of this study was to determine the ß-globin cluster haplotype variability of two Mexican indigenous groups-Purepechas (PUR) and Tarahumaras (TAR)-and their relationship with other world populations. METHODS: The 5' and 3' haplotypes (Hp) of the ß globin cluster in 71 PUR and 53 TAR individuals were analyzed. Five polymorphisms in the 5'Hp (ε, (G) γ, (A) γ, 5'ψß and 3'ψß) and five in the 3'Hp (IVS2: 16, 46, 74, 81 and 3' end +339) were identified by restriction enzymes and direct DNA sequencing. 5'Hp and 3'Hp frequencies in PUR and TAR were compared with reported frequencies from 47 and 10 worldwide populations, respectively. RESULTS: Sixteen different 5'Hps were observed in the indigenous Mexican groups, 11 in each population, with the most common being 5'Hp 1. Eight 3'Hps were detected, seven in PUR and six in TAR, the most frequent being 3'Hp C. Three new 3'Hps were found, A8 (CTGCT) in both populations, C9 (GTGCA) in TAR and E1 (GTTCT) in PUR. The comparative analysis showed that 5'Hp frequencies in PUR were significantly different than those in all populations except the Brazilian-Guarani, while TAR were significantly similar to Aché and North Han Chinese. 3'Hp frequencies were similar between PUR and TAR, as well as with Nuu-Chah-Nulth, Mongolian and Sumatran populations. CONCLUSIONS: The 5'Hp analysis showed great variability in worldwide populations, including PUR and TAR, while 3'Hp frequencies were similar among indigenous Mexican and other populations with Asiatic origins. This suggests that 5'Hp exposes the microevolutionary process of each population and the 3'Hp establishes genetic relationships among populations.

EGFR gene polymorphisms -216G>T and -191C>A are risk markers for gastric cancer in Mexican population.

Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein with tyrosine-kinase activity that plays an important role in multiple cellular functions. EGFR overexpression has been observed in several types of tumors and it is significantly associated with disease stage, survival, prognosis, and progression of cancer. The polymorphisms -216G>T, -191C>A, and (CA)n first intervening sequence (IVS1) have been related to EGFR overexpression and have been studied in several types of cancer, but not in gastric cancer (GC). The aim of this study was to determine the association of these 3 polymorphisms and GC. Genomic DNA from 68 GC patients and 102 healthy blood donors were analyzed. Polymorphisms were identified by DNA-sequencing (-216G>T and -191C>A) and GeneScan (CA)n IVS1. The results showed that the distribution of the -216G>T and -191C>A genotypes differed between groups (P < 0.05). The odds ratio for the -216TT genotype was 4.59 (95% confidence interval = 1.55-13.54, P < 0.05) and 10.71 (95% confidence interval = 2.31-49.59, P < 0.05) for the -191AA genotype, both in a recessive model. The genotype and allele distributions of the (CA)n IVS1 repeat was similar in both groups. In conclusion, the -216TT and -191AA genotypes and GA haplotype of the EGFR gene were found to be associated with an increased risk of gastric cancer in a Mexican population.

Impact of blood pressure changes and course on hematoma growth in acute intracerebral hemorrhage.

BACKGROUND AND PURPOSE: An association between high blood pressure (BP) in acute intracerebral hemorrhage (ICH) and hematoma growth (HG) has not been clearly demonstrated. Therefore, the impact of BP changes and course on HG and clinical outcome in patients with acute ICH was determined. METHODS: In total, 117 consecutive patients with acute (<6 h) supratentorial ICH underwent baseline and 24-h CT scans, CT angiography for the detection of the spot sign and non-invasive BP monitoring at 15-min intervals over the first 24 h. Maximum and minimum BP, maximum BP increase and drop from baseline, and BP variability values from systolic BP (SBP), diastolic BP and mean arterial pressure (MAP) were calculated. SBP and MAP loads were defined as the proportion of readings >180 and >130 mmHg, respectively. HG (>33% or >6 ml), early neurological deterioration (END) and 3-month mortality were recorded. RESULTS: Baseline BP variables were unrelated to either HG or clinical outcome. Conversely, SBP 180-load independently predicted HG (odds ratio 1.05, 95% CI 1.010-1.097, P = 0.016), whilst both SBP 180-load (odds ratio 1.04, 95% CI 1.001-1.076, P = 0.042) and SBP variability (odds ratio 1.2, 95% CI 1.047-1.380, P = 0.009) independently predicted END. Although none of the BP monitoring variables was associated with HG in the spot-sign-positive group, higher maximum BP increases from baseline and higher SBP and MAP loads were significantly related to HG in the spot-sign-negative group. CONCLUSIONS: In patients with acute supratentorial ICH, SBP 180-load independently predicts HG, whilst both SBP 180-load and SBP variability predict END.

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

We investigated associations between vitamin D receptor (VDR) gene polymorphisms, FokI T>C (rs2228570), BsmI G>A (rs1544410), ApaI G>T (rs7975232), and TaqI T>C (rs731236), with bone mineral density (BMD) in postmenopausal Mexican-Mestizo women. Three hundred and twenty postmenopausal women participated, who were classified according to World Health Organization criteria as non-osteoporotic (Non-OP; N = 88), osteopenic (Opn; N = 144), and osteoporotic (OP; N = 88). BMD measurements at the lumbar (L1-L4) spine and at the left and right femoral neck were obtained by dual-energy X-ray absorptiometry. Single nucleotide polymorphisms (SNPs) were genotyped using real-time polymerase chain reaction and TaqMan probes. Genotype and allelic frequencies of the 4 VDR SNPs were similar among the 3 groups. Polymorphic allele frequencies were as follows: FokI (C) 0.53, 0.49, 0.56; BsmI (A) 0.26, 0.22, 0.23; ApaI (T) 0.43, 0.39, 0.44; TaqI (C) 0.27, 0.22, 0.23 for the Non-OP, Opn, and OP groups, respectively. Although no associations were found between the SNPs and BMD, based on the putative function of the FokI SNP, we constructed, for the first time, the haplotype with the 4 VDR SNPs, and found that the CGGT haplotype differed between the Non- OP and OP groups (21.8 vs 31.8%, P < 0.05). The risk analysis for this haplotype was nearly significant under the dominant model (OR = 1.783, 95%CI = 0.98-3.25, P = 0.058). This result suggests a possible susceptibility effect of the C allele of the FokI SNP for the development of osteoporosis in postmenopausal Mexican-Mestizo women.

[Risk factors associated with adherence to medical oncology treatment in pediatrics]. / Factores de riesgos asociados a la adherencia al tratamiento médico oncológico en pediatría.

In Chile, between 450 and 500 cases of cancer are diagnosed annually in children and adolescents. Treatment is financed by the state, but there are non-financial elements that could condition adherence to treatment. OBJECTIVE: to explore family, socioeconomic, housing, and support network risk factors that could affect adherence to medical treatment in children and adolescents diagnosed with cancer. PATIENTS AND METHOD: Descriptive observational study in pediatric oncology hospitals of a national cancer program. Through a "Social Care Form" applied to 104 caregivers of children and adolescents, between August 2019 and March 2020, socioeconomic data of children diagnosed with cancer were recorded in four dimensions: i) Individual/family/health; ii) Work/education/socioeconomic; iii) Housing/environment; and iv) Participation/support networks. RESULTS: 99% of the children and adolescents were registered in the public health system; 69% belonged to the lowest income brackets. Care for children and adolescents was mainly provided by the mother (91%). 79% reported living in a house; 48% owned or were paying for their home. Housing quality was described as good (70%), with low levels of overcrowding. 56% of households had access to Wi-Fi internet connection, while 27% reported no access. The main support network reported was the family (84%). CONCLUSIONS: Family, socioeconomic, housing, and support network risk factors were observed in children and adolescents diagnosed with cancer; socioeconomic and gender aspects highlight the social inequalities in these families. Descriptive baseline results were obtained, so it is suggested to re-observe its evolution and thus measure its impact on adherence to treatment.

Involvement of thermophilic archaea in the biocorrosion of oil pipelines.

Two thermophilic archaea, strain PK and strain MG, were isolated from a culture enriched at 80°C from the inner surface material of a hot oil pipeline. Strain PK could ferment complex organic nitrogen sources (e.g. yeast extract, peptone, tryptone) and was able to reduce elemental sulfur (S°), Fe(3+) and Mn(4+) . Phylogenetic analysis revealed that the organism belonged to the order Thermococcales. Incubations of this strain with elemental iron (Fe°) resulted in the abiotic formation of ferrous iron and the accumulation of volatile fatty acids during yeast extract fermentation. The other isolate, strain MG, was a H(2) :CO(2) -utilizing methanogen, phylogenetically affiliated with the genus Methanothermobacter family. Co-cultures of the strains grew as aggregates that produced CH(4) without exogenous H(2) amendment. The co-culture produced the same suite but greater concentrations of fatty acids from yeast extract than did strain PK alone. Thus, the physiological characteristics of organisms both alone and in combination could conceivably contribute to pipeline corrosion. The Thermococcus strain PK could reduce elemental sulfur to sulfide, produce fatty acids and reduce ferric iron. The hydrogenotrophic methanogen strain MG enhanced fatty acid production by fermentative organisms but could not couple the dissolution Fe° with the consumption of water-derived H(2) like other methanogens.

Wayward effect of polymorphism (TA)8 in the promoter region of UGT1A1 gene in a Mexican family.

Gilbert syndrome (GS) is a hereditary relatively common benign unconjugated hyperbilirubinaemia. The promoter region of uridine diphosphate glycosyltransferase 1 (UGT1A1) gene contains a normal A (TA)6TAA element; variations in this motif (A(TA)7/8TAA) are generally associated with this disorder This is a report of the varied effects of GS in a Mexican Mestizo family with a non-common (TA)8 repeat in this population. The proposita and her mother showed (TA)7/(TA)8 genotype, while her father and sister were (TA)6/(TA)7, but only the proposita showed clinical manifestations. This report supports that the (TA)7 and (TA)8 are necessary, but not enough to explain the features of GS. There are probably additional genetic variations ie, the presence of "modifier" genes or one can speculate that an oligogenetic trait can contribute to the expression of the final phenotype.

Single centrosome manipulation reveals its electric charge and associated dynamic structure.

The centrosome is the major microtubule-organizing center in animal cells and consists of a pair of centrioles surrounded by a pericentriolar material. We demonstrate laser manipulation of individual early Drosophila embryo centrosomes in between two microelectrodes to reveal that it is a net negatively charged organelle with a very low isoelectric region (3.1 +/- 0.1). From this single-organelle electrophoresis, we infer an effective charge smaller than or on the order of 10(3) electrons, which corresponds to a surface-charge density significantly smaller than that of microtubules. We show, however, that the charge of the centrosome has a remarkable influence over its own structure. Specifically, we investigate the hydrodynamic behavior of the centrosome by measuring its size by both Stokes law and thermal-fluctuation spectral analysis of force. We find, on the one hand, that the hydrodynamic size of the centrosome is 60% larger than its electron microscopy diameter, and on the other hand, that this physiological expansion is produced by the electric field that drains to the centrosome, a self-effect that modulates its structural behavior via environmental pH. This methodology further proves useful for studying the action of different environmental conditions, such as the presence of Ca(2+), over the thermally induced dynamic structure of the centrosome.

Phosphoglucomutase: evidence for a new locus expressed in human milk.

Electrophoretic study of phosphoglucomutase (PGM) in human milk revealed different patterns that can be explained by the existence of a locus distinct from the common PGM1, PGM2, and PGM3. One hundred and forty samples were tested and the results showed four different alleles of PGM4 whose frequencies were under Hardy-Weinberg equilibrium.

Experimental study of the application of a new bone cement loaded with broad spectrum antibiotics for the treatment of bone infection. / Estudio experimental de la aplicación de un nuevo cemento óseo cargado con antibióticos de amplio espectro para el tratamiento de la infección ósea.

OBJECTIVES: To evaluate the in vivo behaviour of a new bone cement loaded with antibiotics, in a rabbit bone infection model. MATERIAL AND METHODS: Sixteen New Zealand rabbits divided into 4 groups were used, depending on the cement (commercial or experimental) and the antibiotic (vancomycin or linezolid) used to control a bone infection caused by Staphylococcus aureus. The commercial cement is Palacos® R and the experimental cement has been achieved by adding PLGA to the solid phase of Palacos® R cement. A novel histological staging method based on bone histoarchitecture has been used. This staging allows us a global vision of bone repair capacity, in the presence of modified cement, and also allows us to correlate the damage generated with the functionality of the tissue. RESULTS: The degree of bone destructuration found depended on the type of cement and antibiotic, and was higher in the groups with commercial cement than in the experimental group (P<.01) and in the groups with linezolid with respect to vancomycin (P=.04) The percentage of macrophages varied exclusively depending on the antibiotic used, and was higher in the vancomycin groups (P=.04). DISCUSSION: The development of new formulations of bone cement that release more, and more prolonged, new generation antibiotics such as linezolid, present an in vivo behaviour superior to commercial cement, respecting the bone structure. This behaviour would have a clinical implication in fighting infections by increasingly resistant germs in the treatment of prosthetic infection.

[Detection of episodes of ischemic tissue hypoxia by means of the combined intraoperative neurophysiologic monitoring with the tissue oxygenation monitoring in aneurysm surgery]. / Detección de episodios de hipoxia tisular isquémica mediante la monitorizaciónneurofisiológica intraoperatoria combinada con la monitorización de la oxigenacióntisular en la cirugía aneurismática.

INTRODUCTION: Intraoperative neuromonitoring in aneurysm surgery can be very useful to determine inadequate positions of the vascular clip that cause partial or complete compromise of the cerebral sanguineous flow in the vascular territories irrigated by the arteries related to aneurysm. The direct visualization of these arteries after the application of the surgical clip can be insufficient in detecting this potentially detrimental situation. Knowing this circumstance on the onset would allow the neurosurgeon to correct it and to avoid, therefore, cerebral ischemic tissue hypoxia. We show the utility of the intraoperative monitoring of the oxygen tissue pressure (PtiO2) and the somatosensorial evoked potential (SSEP) for the detection of these situations with the example of a clinical case. CLINICAL CASE: We present the case of a 62 year-old woman, that presented with subarachnoid hemorrhage of aneurysmal origin. The cerebral arteriography demonstrated the existence of an aneurysm of the posterior communicating artery that was treated initially by endovascular procedure with partial exclusion of the aneurysm. For this reason it was decided to complete the treatment with a programmed surgery. The patient was put on an intraoperative monitoring system with a PtiO2 sensor located in the risk area and with SSEP. After positioning the surgical clip the partial oxygen pressure decreased rapidly, as well as the amplitude of the cortical potential of the left posterior tibial nerve. The knowledge of this situation allowed the detection of a trapped posterior communicating artery. After correcting this situation by replacing the surgical clip, both variables recovered to their basal values. CONCLUSIONS: The intraoperative PtiO2 monitoring, combined with neurophysiologic monitoring during aneurysm surgery offers a fast and trustworthy form of early detection of ischemic phenomena caused by bad positioning of the surgical clip.

Isolation and characterization of Bacillus thioparus sp. nov., chemolithoautotrophic, thiosulfate-oxidizing bacterium.

A novel bacterium, strain BMP-1(T), was isolated from a continuous wastewater treatment culture system operating with a bacterial consortium. Cells of the isolate were Gram-variable, aerobic, moderately halotolerant, motile and endospore-forming rods. Strain BMP-1(T) grew chemolithoautotrophically by oxidation of thiosulfate to sulfate with a growth yield of 1.07 g protein mol(-1) of thiosulfate consumed. DNA G+C content was 43.8 mol%. Its cell wall had peptidoglycan based on m-diaminopimelic acid, and the major component of fatty acid was C(15 : 0). The 16S rRNA gene analysis showed that strain belongs to the genus Bacillus, sharing a 99.5% of sequence similarity with Bacillus jeotgali CCM 7133(T). DNA-DNA hybridization between the isolate of this study and this strain was 44%. Thus, the inclusion of strain BMP-1(T) in the genus Bacillus is suggested as a novel species and the name Bacillus thioparus sp. nov. (Type strain BMP-1(T)=BM-B-436(T)=CECT 7196(T)) is proposed. The sequence of the 16S rRNA gene has been deposited in GenBank with accession number DQ371431.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ß-Thalassemia in Mexican mestizo patients.

INTRODUCTION: Beta-thalassemia (ß-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. METHODS: One hundred and forty-nine ß-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δß-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. RESULTS: Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δß-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. CONCLUSION: Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of ß-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans.

Development of advanced biantibiotic loaded bone cement spacers for arthroplasty associated infections.

The incidence increase of infections in patients with hip or knee implants with resistant pathogens (mainly some S. coagulase-negative and gram positive bacteria) demands advanced antibiotic loaded formulations. In this paper, we report the design of new biantibiotic acrylic bone cements for in situ delivery. They include a last generation antibiotic (daptomycin or linezolid) in combination with vancomycin and are performed based on a novel modification of the Palacos R® acrylic bone cement, which is based on two components, a liquid (methyl methacrylate) and a solid (polymeric phase). Hence, the solid component of the experimental formulations include 45wt% of microparticles of poly(D,L-lactic-co-glycolic) acid, 55wt% of poly(methyl methacrylate) beads and supplements (10wt-% each) of antibiotics. These formulations provide a selective and excellent control of the local release of antibiotics during a long time period (up to 2 months), avoiding systemic dissemination. The antimicrobial activity of the advanced spacers tested against S. aureus shows that single doses would be enough for the control of the infection. In vitro biocompatibility of cements on human osteoblasts is ensured. This paper is mainly focused on the preparation and characterization of cements and the studies of elution kinetics and bactericidal effects. Developed formulations are proposed as spacers for the treatment of infected arthroplasties, but also, they could be applied in other antibiotic devices to treat relevant bone-related infection diseases.

Purification and functional characterization of p16, the ATPase of the bacteriophage Phi29 packaging machinery.

Bacteriophage Phi29 codes for a protein (p16) that is required for viral DNA packaging both in vivo and in vitro. Co-expression of p16 with the chaperonins GroEL and GroES has allowed its purification in a soluble form. Purified p16 shows a weak ATPase activity that is stimulated by either DNA or RNA, irrespective of the presence of any other viral component. The stimulation of ATPase activity of p16, although induced under packaging conditions, is not dependent of the actual DNA packaging and in this respect the Phi29 enzyme is similar to other viral terminases. Protein p16 competes with DNA and RNA in the interaction with the viral prohead, which occurs through the N-terminal region of the connector protein (p10). In fact, p16 interacts in a nucleotide-dependent fashion with the viral Phi29-encoded RNA (pRNA) involved in DNA packaging, and this binding can be competed with DNA. Our results are consistent with a model for DNA translocation in which p16, bound and organized around the connector, acts as a power stroke to pump the DNA into the prohead, using the hydrolysis of ATP as an energy source.

Y-linked haplotypes in Amerindian chromosomes from Mexican populations: genetic evidence to the dual origin of the Huichol tribe.

We studied six Y-linked short tandem repeats (Y-STRs) to describe the internal diversity of the Amerindian haplogroup Q-M3 in 129 males from eight Mexican populations. The low gene diversity in the Huichol tribe demonstrated the effects of genetic drift, attributable to geographic isolation and founder effect. The presence of two principal paternal lineages supported the historical and anthropometric records, which indicate that Huichols were formed by the fusion of two ancestral Mexican tribes. Moreover, genetic distances and close relationships of haplotypes between Huichols and Tarahumaras were in agreement with their linguistic affiliation. The high genetic diversity of the Purépechas and wide distribution of haplotypes along the constructed network-joining tree suggest that the present genetic composition was influenced by Purépecha dominance in western Mesoamerica. The Y-haplotypes shared between populations suggest that, among the Amerindian tribes studied herein, the paternal genetic pool of Nahuas could have contributed more importantly to the European-admixed population, the Mexican-Mestizos.

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

INTRODUCTION: Alpha-thalassemia (α-thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α-thal and beta-thalassemia (ß-thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α- and ß-thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2 . METHODS: Common deletional alleles (-α(3.7) , -α(4.2) , - -(SEA) , - -(MED) , - -(FIL) , - -(THAI) , -α(20.5) ) and α-triplication were studied by gap-PCR and nondeletional alleles (α(IVSI) ((-5nt)) , α2 (NcoI) , α1 (NcoI) ) by ARMS. ß-thal alleles Cd39 (C>T), IVS1:1 (G>A), IVS1:110 (G>A), and Spanish δß-thal were also investigated. DNA sequencing was performed on HBA2, HBA1, and HBB genes. Negative samples were subjected to MLPA. RESULTS: In 35 subjects, we identified the mutations, -α(3.7) , - -(SEA) , - -(FIL) , α(IVSI) ((-5nt)) , and ααα(anti3.7) and two novel deletion alleles - -(Mex1) (6.8-8.9 kb) and - -(Mex2) (77.6-135.7 kb). Four individuals also had a ß-thal allele (Cd39/IVS1:110). No α-thal alleles were observed in 16 subjects, but three had a ß-thal mutation Cd39, IVS1:110, and Spanish δß-thal. CONCLUSION: α-thal is relatively common in Mexican patients, the combination with ß-thal is sometimes unexpected, and this underlines the importance of performing molecular analysis for both α- and ß-genes defects in patients showing microcytic hypochromic anemia.

Topology of the components of the DNA packaging machinery in the phage phi29 prohead.

Chromosome condensation inside dsDNA viral particles is a complex process requiring the coordinated action of several viral components. The similarity of the process in different viral systems has led to the suggestion that there is a common underlying mechanism for DNA packaging, in which the portal vertex or connector plays a key role. We have studied the topology of the packaging machinery using a number of antibodies directed against different domains of the connector. The charged amino-terminal, the carboxyl-terminal, and the RNA binding domain are accessible areas in the connector assembled into the prohead, while the domains corresponding to the 12 large appendages of the connector are buried inside the prohead. Furthermore, while the antibodies against the carboxyl and amino-terminal do not affect the packaging reaction, incubation of proheads with antibodies against the RNA binding domain abolishes the packaging activity. The comparison of the three-dimensional reconstructions of bacteriophage phi29 proheads with proheads devoid of their specific pRNA by RNase treatment shows that this treatment removes structural elements of the distal vertex of the portal structure, suggesting that the pRNA required for packaging is located at the open gate of the channel in the narrow side of the connector.

Nasal eosinophilic angiocentric fibrosis with IgG4-positive plasma cell infiltration

@#Introduction: Eosinophilic angiocentric fibrosis (EAF) is a rare lesion that predominantly affects the upper respiratory tract. Its etiology is unknown and it has been recently associated with the IgG4related disease (IgG4-RD) spectrum. To the author’s knowledge, this is the sixth case report of the relationship between EAF and IgG4-RD. Case Report: We report the case of a 37-year-old woman with nasal deformity and facial pain. The lesion was surgically excised. Histological examination revealed features of EAF with an IgG4/IgG plasma cell ratio >73% and 31 IgG4 stained cells per high power field. No clinical or radiological recurrence was detected during follow-up. Serum IgG4 quantification one year after surgery was within normal limits. Discussion: The relationship between both entities may have therapeutic impact because IgG4-RD of the head and neck has a high remission rate with corticosteroids and immunosuppressive therapy. Additional reports of this infrequent disease are necessary to elucidate appropriate treatment and prognosis.