Leaf thermal safety margins decline at hotter temperatures in a natural warming 'experiment' in the Amazon.

The threat of rising global temperatures may be especially pronounced for low-latitude, lowland plant species that have evolved under stable climatic conditions. However, little is known about how these species may acclimate to elevated temperatures. Here, we leveraged a strong, steep thermal gradient along a natural geothermal river to assess the ability of woody plants in the Amazon to acclimate to elevated air temperatures. We measured leaf traits in six common tropical woody species along the thermal gradient to investigate whether individuals of these species: acclimate their thermoregulatory traits to maintain stable leaf temperatures despite higher ambient temperatures; acclimate their photosynthetic thermal tolerances to withstand hotter leaf temperatures; and whether acclimation is sufficient to maintain stable leaf thermal safety margins (TSMs) across different growth temperatures. Individuals of three species acclimated their thermoregulatory traits, and three species increased their thermal tolerances with growth temperature. However, acclimation was generally insufficient to maintain constant TSMs. Notwithstanding, leaf health was generally consistent across growth temperatures. Acclimation in woody Amazonian plants is generally too weak to maintain TSMs at high growth temperatures, supporting previous findings that Amazonian plants will be increasingly vulnerable to thermal stress as temperatures rise.

Population Genetic Structure of the Rubber Tree Powdery Mildew Pathogen (Erysiphe quercicola) from China.

In order to manage agricultural pathogens, it is crucial to understand the population structure underlying epidemics. Rubber tree powdery mildew, caused by Erysiphe quercicola, is a serious threat to rubber plantations worldwide, especially in subtropical environments including all rubber tree-growing regions in China. However, the population structure of the pathogen is uncertain. In this study, 16 polymorphic microsatellite markers were used to genotype powdery mildew samples from the main rubber tree-growing regions including Yunnan (YN), Hainan (HN), western Guangdong (WG), and eastern Guangdong (EG). YN had higher genotypic diversity (Simpson's indices), genotypic evenness, Nei's gene diversity, allelic richness, and private allelic richness than the other regions. Cluster analysis, discriminant analysis of principal components, pairwise divergence, and shared multilocus genotype analyses all showed that YN differed significantly from the other regions. The genetic differentiation was small among the other three regions (HN, WG, and EG). Analysis of molecular variance indicated that the variability among regions accounted for 22.37% of the total variability. Genetic differentiation was significantly positively correlated (Rxy = 0.772, P = 0.001) with geographic distance. Linkage equilibrium analysis suggested possible occurrence of sexual recombination although asexual reproduction predominates in E. quercicola. The results suggested that although significant genetic differentiation of E. quercicola occurred between YN and the other regions, pathogen populations from the other three regions lacked genetic differentiation.

Southern blight of water lily: The first host record of Agroathelia rolfsii on Nelumbo nucifera discovered in Florida, USA.

Nelumbo nucifera Gaertn. (Nelumbonaceae, Eudicots), also known as water lily or sacred lotus, is a nonnative and invasive plant commonly found in artificial ponds and natural lakes throughout Florida (UF-IFAS 2023; Wunderlin et al. 2023). In August 2020, a single sample of water lily plants showing large leaf spots were collected at a residence in Dunnellon, Marion County, Florida (80% disease prevalence with 40% leaf coverage). Symptoms and signs of the disease were necrotized adaxial leaf spots only, bordered by whitish mycelia and hyphae with clamp connections, and whitish to light brown sclerotia formed in the center (<0.7 mm diameter). Symptomatic tissue was plated on acid potato dextrose agar (APDA) amended with chloramphenicol (100 mg/L) and ampicillin (30mg/L), and incubated at 20 °C for one week. Data supporting the molecular identification of this putative pathogen were gathered by PCR amplification and Sanger sequencing of the complete internal transcribed spacer (ITS) and a fragment of the large subunit (LSU) of the rRNA gene (~1.5 kb) using primers ITS1F and LR5 (FDACS-DPI PPST 2020-105211, GenBank OR492009) (White et al. 1990). The identification of the host was confirmed by Sanger sequencing of three plant barcode fragments: ITS2 (ITS2-S2F/ITS4, OR492008), ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) (rbcLa-F/rbcLa-R, GenBank OR502388), and Maturase K (matK) (matK-KIM1R/matK-KIM3F, GenBank OR502389) (Fazekas et al. 2012). MegaBLAST queries of the ITS/LSU sequence obtained here recovered a 99.61% match to the fungal pathogen Agroathelia (=Athelia) rolfsii (Sacc.) Redhead & Mullineux. (Redhead and Mullineux 2023) (Amylocorticiaceae, Agaricomycotina) strain GP3 (GenBank JABRWF010000005) (Yan et al. 2021). MegaBLAST queries of three host plant DNA barcodes recovered matches of greater than 99.62% similarity to N. nucifera sequences. After diagnosis, symptomatic dried leaf samples were deposited at Plant Industry Herbarium Gainesville (PIHG 17807) and an axenic culture was deposited at the Agricultural Research Services Culture Collection (NRRL 66964). Koch's postulates were fulfilled by the inoculation of sclerotia (as in Terrones-Salgado et al. 2022) on adaxial leaf surface of four-week- old water lily transplants obtained from an artificial pond on campus (two plants with five leaves each). One additional transplant was not inoculated and served as a control; this plant remained asymptomatic during the experimentation period. Each transplant was kept in a 27-gallon plastic container (21W × 30L × 14H in) filled with tap water containing one tablespoon of 20-20-20 all-purpose-water-soluble plant fertilizer (VPG, TX, USA) in a plant biosafety level 2 greenhouse (23 °C, >50% relative humidity, and a 12-h/12-h photoperiod). All inoculated leaves showed necrotized areas after one week and new sclerotia were observed floating on the water surface after three weeks. Fungal pathogen was reisolated and reidentified subsequently. Agroathelia rolfsii is the causal agent of southern blight, also known as grey rot, and is reported from at least in 260 plant genera, including specialty crops such as citrus, cucumber, pepper, peanuts, pumpkin, and strawberry (Farr and Rossman 2018). Agroathelia rolfsii usually causes lower stem, crown, and root rots; consequently, leaf spots are a noteworthy presentation of symptoms for this fungus.

First Report of Rhizoctonia solani AG-4 HG-I Causing Root and Basal Stem Rot on Roselle (Hibiscus sabdariffa) in Mexico.

Roselle (Hibiscus sabdariffa L.) is a crop of economic importance, refreshing drinks are prepared from its calyces, it is also attributed to antioxidant, antibacterial, and antihypertensive properties (Da-Costa-Rocha et al. 2014). In November 2022, in municipality of Iguala (18.355592N, 99.548546W, 749 m above sea level), Guerrero, México, roselle plants of approximately 1.5 months of age with basal rot were detected under greenhouse conditions. The symptoms consisted of wilting, yellowing, and root and stem rot with constriction in the base of the stem. The symptoms were detected in approximately 15% of plants at the operation. From symptomatic tissue, cuts were made into approximately 0.5 cm pieces, sterilized with 2% NaClO, washed with sterile distilled water, transferred to PDA medium amended with 50 mg/liter of Chloramphenicol, and incubated in the dark for four days at 28 °C. Rhizoctonia-like colonies were consistently obtained, and nine isolates were selected and purified by the hyphal-tip method. After four days, isolates developed a mycelium was light-white that became brown with age. Right-angled hyphal branching was also observed, in addition to a slight constriction at the base of the branches. In some older cultures, numerous dark brown sclerotia were observed. They were multinucleate cell with three to eight nuclei and measured from 1 to 2 mm in diameter. Together these characteristics were consistent with the description of Rhizoctonia solani Kühn (Parmeter 1970). The anastomosis group (AG) was confirmed by amplifying the ITS region with the primers ITS1 and ITS4 (White et al. 1990) of the RIJAM3 and RIJAM5 strains. The sequences were deposited in GenBank (Nos. OR364496 and OR364497 for RIJAM3 and RIJAM5, respectively). BLAST analysis, both isolates indicated 99.7 identity to R. solani AG-4 HG-I (GenBank: KM013470) strain ICMP 20043 (Ireland et al. 2015). The phylogenetic analysis of AGs sequences allowed assignment of isolates RIJAM3 and RIJAM5 to the AG-4 HG-1 clade. A pathogenicity test was performed on 20 one-month-old roselle plants. Mycelium of RIJAM3 isolate was inserted into the base of the stem with a sterile toothpick. As a control, a sterile toothpick with no mycelium was inserted in ten healthy plants. Additionally, 50 eight-day-old seedlings were inoculated by placing a 5-mm diameter agar plug colonized with mycelium of RIJAM3 at the base of the stem 10 mm below the soil surface. As control treatments, uncolonized PDA plugs were deposited at the base of 25 seedlings. The inoculated plants were incubated in a greenhouse with an average temperature and relative humidity of 28°C and 85%, respectively. Following inoculation, symptoms similar to those observed in the original outbreak were observed in plants after six days and only after four days in seedlings. In both experiments, the control plants and seedlings remained asymptomatic. R. solani was re-isolated from plants and seedlings, complying with Koch's postulates. The pathogenicity testing was repeated twice, with concordant results. In Nigeria and Malaysia R. solani was reported to seedling death to cause seedling dieback in roselle (Adeniji 1970; Eslaminejad and Zakaria 2011). In México R. solani AG-4 has been previously reported in crops of potato, chili and tomato (Montero-Tavera et al. 2013; Ortega-Acosta et al. 2022; Virgen-Calleros et al. 2000). To the best of our knowledge, this is the first report of R. solani AG-4 HG-I as a causing of root and basal stem rot on roselle in Mexico. This research provides information essential for informing the management of this disease, and may help design measures to prevent the spread of the pathogen to other regions.

Inspirational Story of Agriculture at Living with The Land Attraction at EPCOT.

Since its debut in 1982, The Land has embodied Walt Disney's vision, capturing the attention of millions of EPCOT guests with venues focusing on agriculture and environmental stewardship and sustainability. The Land pavilion spans over eight acres in the World Nature section of EPCOT at the Walt Disney World Resort in Lake Buena Vista, Florida. The pavilion houses three attractions, namely Soarin' Around the World, Awesome Planet, and the Living with The Land boat ride, complemented by a greenhouse walking tour entitled Behind the Seeds and two restaurants. Each attraction derives inspiration from nature and challenges mankind to be responsible stewards of planet earth. This feature article focuses on the Living with The Land boat ride attraction, which traverses greenhouses showcasing agricultural technologies and crops from around the world. The sections below describe both how various show elements are designed to engage guests and how the show is made possible by applying relevant science and technology.

Ralstonia solanacearum species complex in Australia.

The Ralstonia solanacearum species complex (RSSC) causes vascular wilt of many crops and is considered one of the most destructive plant pathogenic bacteria worldwide. The species complex was recently resolved into a stable taxonomy of three species aligning with the previously determined phylotypes, namely R. solanacearum (phylotype II), R. pseudosolanacearum (phylotype I and III), and R. syzygii (phylotype IV). Knowing which Ralstonia species and subspecies are established in Australia is important to Australia's biosecurity and market access. The goal of this study was to analyse Australia's Ralstonia culture collections and to assign the isolates to the modern taxonomic groups. The results shed light on the identity, distribution, and pathogenicity of the Ralstonia strains in Australia. Ralstonia solanacearum, R. pseudosolanacearum phylotype I, and R. syzygii phylotype IV-11 are present in Australia but have limited geographic ranges. We identified two aberrant RSSC strains that have genetic similarity to R. syzygii based on sequevar analysis, but do not yield a phylotype IV multiplex PCR band, similar to the known aberrant strain ACH732. The aberrant strains may represent a novel species. Three new sequevars were determined, 72, 73 and 74. Several Ralstonia lineages remain undetected in Australia, providing evidence that they are absent. These include R. pseudosolanacearum phylotype III and the phylotype I mulberry infecting strains; R. solanacearum strains IIC and the Moko causing strains; and R. syzygii subsp. celebesensis, and R. syzygii subsp. syzygii. This study fulfilled Koch's postulates for the Australian strains, R. solanacearum wilted potato plants, and R. pseudosolanacearum wilted blueberry plants, the hosts from which they were initially isolated. The data supports the hypothesis that Australia has native and introduced strains of Ralstonia.

First Report of Mango Stem-end Rot Caused by Pestalotiopsis kenyana in Yunnan Province, China.

Stem End Rot (SER) is a devastating post-harvest disease of mango fruits causing severe losses during storage. In 22 July 2023, 31 out of 50 intact mangoes (cv. Sensation) collected from five orchards in Huaping county (26°37'N 101°15') showed typical symptoms of SER after stored for 9 d in room temperature (24-28℃). Initially, small dark brown to black spots appeared around the fruit peduncle, which rapidly expanded through the pulp tissues. The symptomatic mangoes were surface disinfected by 3% NaClO for 30 s after soaking in 75% alcohol for 3 min, and cleaned by sterile water for 3 times. Tissues were cut from the edge of lesions, dried by sterile filter paper, transferred to PDA and cultured at 28 ℃ for 5 d (Tovar-Pedraza et al., 2020). The single-spore isolation method was used to obtain pure culture. Thirty eight isolates presented four distinct kind of morphology on PDA medium. Among them, 11 isolates with same morphology were significantly distinct from common pathogens of SER. The colonies were white and pale yellow on reverse side. Mycelia grew fast and reached the edge of 90 mm Petri dish after cultured for 5d. Pycnidia were black and scattered on the mycelial mats after 15-20 d. Conidia were fusoid, straight to slightly curved, four septa, and brown. Pigmented median cells doliiform, 14.97 - 18.62(16.11 ±0.89)×5.61- 7.28 (6.61±0.51) µm. Apical cell hyaline, subcylindrical; 1-3 tubular transparent apical appendages 12.27 - 16.68 (13.65±3.78)×1.14 - 1.99 (1.59±0.36) µm. Basal cell conical with a truncate base, hyaline, and 1-2 tubulose basal appendages with 2.85 - 7.97 (5.18±1.88)×0.99 - 1.85 (1.38±0.29) µm (n=50). These fungi were described as Pestalotiopsis kenyana. based on morphological characters (Maharachchikumbura et al., 2014) which were different from isolates characterized as other common SER pathogens (Botryosphaeria, Neofusicoccum). Based on morphology, HPSX-4 was selected for further identification. ITS region, tef1-α, ß-tub of HPSX-4 were amplified and sequenced (Xun et al., 2023). The sequences were deposited in GenBank (ITS:OR889126, tef1-α:OR913431, ß-tub: OR913432). The ITS, tef1-α, ß-tub sequence of HPSX-4 showed 100% (525/525)，99.59% (241/242), and 100% (742/742) identity to the P. kenyana CBS442.67 sequences (ITS: NR147549，tef1-α: KM199502, ß-tub: KM199395), respectively. HPSX-4 clustered with P. kenyana CBS 442.67 (type strain) based on maximum likelihood method by MEGA 7.0.21(Minh et al., 2013). Pathogenicity test was performed on 12 healthy mangoes (cv. Golek) by placing mycelial plugs around the peduncle and the middle of the fruit by pin-prick method according to Feng et al.(2023). Sterile PDA were used as control (three mangoes). Every inoculated fruit was incubated at 28°C, 95% ± 3% humidity with three replicates for each treatment. The experiment was repeated three times. Typical symptoms of SER were observed. There were no symptoms in the control group. The strain was reisolated and identified as P. kenyana with the method mentioned above which fulfilled Koch's postulates. This is the first report of P. kenyana causing SER disease on Mangifera indica L.. This study expands our understanding of the pathogen range of mango SER which conducive to prevent and control the SER caused by P. kenyana.

First report of basal rot of yellow dragon fruit (Selenicereus megalanthus) caused by Fusarium oxysporum in Peru.

Cultivation of yellow dragon fruit (Selenicereus megalanthus) in Peru has recently expanded (Verona-Ruiz et al. 2020). In August 2021, approximately 170 of 1,110 dragon fruit cuttings (15.3%) in the university's nursery (6°26'10'' S; 77°31'25'' W) showed basal rot symptoms. Initial symptoms included small brown spots on the base of stems, expanding towards the top that became soft and watery. All symptomatic plants eventually died, i.e., a severity of 100%. The disease was more prevalent on cuttings during the rooting phase than on well-established cuttings. We collected five symptomatic cuttings from throughout the nursery. Four sections of 1 × 1 cm2 of tissue adjacent to the diseased area were excised from each cutting, immersed for 1 min in 2% NaClO, rinsed twice with sterile distilled water, placed on potato dextrose agar (PDA) medium (four sections per Petri plate, five plates), and incubated at 25°C for 7 days. Morphologically similar mycelia grew from all sections, and five monosporic isolates were obtained, one per plate. Colonies grew fast, reaching 60 to 64 mm in 7 days, and produced violet-white cottony aerial mycelia with orange sporodochia on PDA, and abundant macro- and microconidia on synthetic nutrient-poor agar. Macroconidia were straight to slightly curved, typically with 2 to 3 septa, 16.6 to 23.3 × 1.7 to 3.7 µm (n = 30); microconidia were oval or kidney-shaped, and commonly hyaline, 6.7 to 16.4 × 2.5 to 4.7 µm (n = 40). Genomic DNA was extracted from isolate AFHP-100, then the ITS region and the TEF1 and RPB2 partial genes were amplified and sequenced (Accession numbers PP977433, OR437358, PP537149) following Gardes and Bruns (1993) and O'Donnell et al. (1998). We conducted a BLASTn search of ITS sequence against the NCBI "nr" database and local 'megablast' searches of TEF1 and RPB2 sequences against FUSARIUM-ID v.3.0 (Torres-Cruz et al. 2022). We found 100%, 98.19 to 99.84%, and 98.81 to 99.76% identities in ITS, TEF1, and RPB2 sequences, respectively, to the ex-epitype and other reference strains of Fusarium oxysporum (CBS 144134, NRRL26406, among others). A maximum likelihood phylogenetic analysis with a TEF1-RPB2 concatenated dataset with FUSARIUM-ID sequences also showed isolate AFHP-100 was F. oxysporum. A pathogenicity test was carried out by inoculating wounded healthy roots of three cuttings with submersion in a 5 × 106 conidia/ml suspension for 25 min. Then, the inoculated plants were planted in sterile soil. One cutting with wounded roots submerged in sterile water served as a control. In parallel, sterile soil was inoculated with 20 mL of the conidial suspension, and another three healthy cuttings were planted. A cutting planted in noninoculated soil also served as a control. Basal rot symptoms developed in all inoculated plants after 25 days. After re-isolation, the same fungus, corroborated based on micromorphology and TEF1 sequence (PP335689), was recovered, fulfilling Koch's postulates. The isolate was deposited in the KUELAP Herbarium (voucher KUELAP-3214), located and administered by the National University Toribio Rodriguez de Mendoza de Amazonas, in Chachapoyas, Peru. Fusarium oxysporum has been reported to cause basal stem rot in Bangladesh and Argentina (Mahmud et al. 2021; Wright et al. 2007), and stem blight in Malaysia (Mohd Hafifi et al. 2019) on dragon fruit. This is the first report of F. oxysporum causing basal rot in S. megalanthus in Peru. This fungus is among the most destructive plant pathogens, and the rapid expansion of the crop in Peru requires a comprehensive knowledge of the biotic factors influencing production. Therefore, this report is foundational to implementing proper control strategies.

Bisifusarium lunatum causing cladode soft rot in pear cactus (Nopalea cochenillifera L. Salm-Dyck) in Brazil.

Cactus pear var. miúda (Nopalea cochenillifera L. Salm-Dyck) is an important crop for the Northeast region of Brazil, composing one of the main sources of animal feed. By April 2021, cladode rot caused death of several cactus pear plants in a production area located in Itaporanga, Paraíba state, Brazil (7°21'55.35" S and 38°11'38.68" W). The infected cladodes showed brown circular necrotic spots, and soft rot with perforations that extended throughout the cladode, followed by tipping over and death of the infected plants. The incidence of the disease ranged from 10 to 30% of the plants. Bisifusarium strains were isolated and cultured on potato dextrose agar (PDA) and syntetic-nutrient-poor-agar (SNA). The colonies showed purple color on PDA. On SNA, macroconidia (n = 100) were abundant, hyaline, slightly falcate, three-septate, measuring 11.0-23.1 x 2.3-4.1 µm. Microconidia (n = 100) were oval, generally aseptate, measuring 4.1-8.7 x 2.3-3.0 µm. Conidiogenic cells formed into short monophialides. Chlamydospores were not observed. According to these morphological features, the pathogen was initially identified as Bisifusarium lunatum (Gryzenhoutm et al. 2017). For further confirmation of the identification, the partial sequences of translation elongation factor 1-alpha (TEF1-α) and the second largest subunit of RNA polymerase II (RPB2) genes were sequenced for a representative isolate (CMA 34: GenBank accession no: TEF1-α: OR536502; and RPB2: OR553509) and compared to other Bisifusarium species from GenBank database. Subsequently, it was subjected to a phylogenetic analysis of maximum likelihood including previously published sequences. According to BLAST searches, the TEF1-α and RPB2 sequences were 99% (637/640 nt) and 100% (312/312 nt) similar to B. lunatum (COUFAL0213: TEF1-α (MK640219), and RPB2 (MK301291)), respectively. The isolate was also clustered in a clade containing the ex-type of B. lunatum with 100% support (SH-aLRT and UFboot), being confidently assigned to this species. The pathogenicity test was performed after Medeiros et al. (2015), by using healthy two months old cactus pear seedlings (n = 10) cultivated in a greenhouse. Sterile toothpicks were distributed over colonies of the representative isolate grown on PDA at 25 ± 2 °C for seven days. Seedling cladodes were stuck with the toothpicks, moistened with sterile water and covered with transparent plastic bags for 24h, thus simulating a humid chamber. Following three months, all control plants (stuck with sterile toothpicks) remained healthy, while those inoculated with the representative isolate exhibited rot symptoms. This test was performed twice. B. lunatum was reisolated from symptomatic cladodes and identified as previously described, thus fulfilling the Koch's postulates. To our best knowledge, this is the first report of B. lunatum causing soft rot on N. cochenillifera in Brazil. Besides N. cochenillifera, this species was also reported on Opuntia ficus-indica in India (Gryzenhoutm et al., 2017), which raises concern regarding its ability to infect other forage sources for cattle feed in Brazilian semiarid regions. The present study highlights that the precise identification of B. lunatum is a key factor to adjust control strategies and management of the disease to prevent the spread of this disease to prevent its spread to other crops.

First report of nectarine virus M in grapefruit (Citrus × paradisi Macfad.) in association with citrus chlorotic blotch disease in Texas, USA.

During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.

First report of Erwinia papayae associated with papaya mushy canker disease in Guam.

Carica papaya (papaya) in Guam, USA may experience soft rot symptoms, often referred to as mushy canker disease. Disease symptoms first appear as expanding water-soaked dark-green stem lesions or leaf spotting with chlorotic halos. Defoliation at petiole-stem junctions and crown necrosis leads to plant death. Papaya diseases caused by Erwinia spp. are documented in nearby tropic regions such as the Northern Mariana Islands (Trujillo and Schroth 1982), the Philippines (Dela Cueva et al. 2017), Japan (Hanagasaki et al. 2020), and Indonesia (Suharjo et al., 2021). The pathogen was isolated from symptomatic papaya stem sections (cv. Red Lady) from a nursery at the University of Guam Agriculture and Life Sciences building in April 2023. Approximately 20% of seedlings collapsed from stem soft rot, with nearly all plants showing varying degrees of water-soaked lesions on leaves or stems. Stem tissue from lesion margins was excised, surface sterilized with 70% EtOH, and macerated in sterile water. Macerate was plated onto nutrient agar (NA) and incubated at 28°C, yielding colonies that were clear to white in color, smooth, circular and mucoid on NA plates for five suspect isolates (JGD231-235). Strains produced blue diffusible pigment on King's B (KB) media, were Gram-negative rods, and exhibited swimming motility on semi-solid (0.5% agar) NA plates. Crown stab inoculation of ten papaya plants (cv. Red Lady) with isolates resulted in mushy canker symptoms within seven days, while negative control plants stabbed with a sterile probe remained asymptomatic. Koch's postulates were fulfilled by drench-inoculating spontaneous rifampicin-resistant (100µg/ml) mutants, JGD233r and JGD235r, onto ten papaya plants (cv. Solo Sunrise). Nine days post-inoculation, bacterial strains were recovered from symptomatic stem tissue macerate plated on rifampicin (100µg/ml) NA and incubated at 28°C. No symptoms or bacterial cells were recovered from the tissue of negative control plants. Cell morphology, culture phenotypes, and disease symptoms suggested the isolates were Erwinia spp., and blue pigment production on KB further suggested E. papayae (Gardan et al. 2004). Partial 16S rDNA sequences of Guam strains JGD231-235 (sequenced using PCR forward primer 5' - AGAGTTTGATCMTGGCTCAG - 3' and reverse primer 5' - GGTTACCTTGTTACGACTT - 3', GENEWIZ (South Plainfield, NJ)) were deposited into GenBank (OR577627- 631). Highest NCBI BLAST results for all strains showed a 16S rDNA sequence identity of 98.17-98.91% with those of Erwinia sp. I-leaf (LC590218) and E. mallotivora BT-MARDI (HQ456230). A maximum likelihood phylogenetic tree based on concatenated partial atpD, infB, and rpoB sequences of strains JGD232 (PP669340, PP669346, PP669343), JGD233 (PP669341, PP669347, PP669344), and JGD235 (PP669342, PP669348, PP669345) (Brady et al. 2008) constructed using MEGA11 (Tamura et al. 2021) showed all strains formed a monophyletic group with Erwinia sp. I-leaf (Hanagasaki et al. 2020) and E. papayae NCPPB 4294T (Gardan et al. 2004), supported with 98% bootstrap. This note documents the first occurrence of E. papayae as a papaya pathogen in Guam. Papaya cultivation supports sustainable food security for Guam (Bevacqua and Sayama 2023), and Erwinia spp. pathogens threaten papaya on other Pacific islands like Hawaii. These findings convey the need for effective quarantine practices, local disease management, and further research on this pathogen.

Colletotrichum caladii sp. nov. causing anthracnose leaf spot of Caladium × hortulanum (Araceae) in Florida, USA.

Caladium (Caladium × hortulanum) is an ornamental plant popular for its variable and colorful foliage. In 2020, plants showing leaf spots and blight, typical of anthracnose, were found in a field trial at the University of Florida's Gulf Coast Research and Education Center (UF/GCREC) in Wimauma, FL, USA. Leaf samples consistently yielded a Colletotrichum-like species with curved conidia and abundant setae production in the acervuli. The internal transcribed spacer (ITS), partial sequences of the glyceraldehyde-3-phosphate dehydrogenase gene (gapdh), actin gene (act), chitin synthase 1 gene (chs-1), beta-tubulin gene (tub2), and histone3 gene (his3) were amplified and sequenced. Blastn searches in the NCBI GenBank database revealed similarities to species of the Colletotrichum truncatum species complex. Phylogenetic analyses using multi-locus sequence data supports a distinct species within this complex, with the closest related species being C. curcumae. Based on morphological and phylogenetic analyses, a new species of Colletotrichum, named C. caladii, is reported. Pathogenicity assays and subsequent isolation confirmed that this species was the causal agent of the disease.

Genetic Analysis of Colletotrichum siamense Populations from Different Hosts and Counties in Hainan, China, Using Microsatellite Markers.

Colletotrichum siamense was demonstrated as the dominant species among Colletotrichum spp. that infected rubber tree, areca palm, and coffee in Hainan, China. However, the extent of genetic differentiation within the species C. siamense in relation to geographical regions and host species is not known. In this study, 112 C. siamense isolates were genotyped with 12 microsatellite markers. In total, there were 99 multilocus genotypes. Results from permutational multivariate analysis of variance and analysis of molecular variance indicated that there was no significant genetic differentiation between fungal populations with respect to host, location (county), and year. Discriminant analysis of principal components and STRUCTURE analysis showed that C. siamense isolates grouped into three clusters; further analysis confirmed that there were significant (P < 0.001) genetic differences among the three clusters. However, each cluster had isolates from different hosts, counties, or years, supporting the lack of genetic differentiation with respect to host, county, and year. Statistical analyses of allelic associations indicated some evidence for recombination within the populations defined on the basis of host or county. The present findings provide insights into the genetic structure of C. siamense on the three perennial host species in Hainan and suggest that the disease on these three crops can be effectively considered as one disease and, hence, needs to be controlled simultaneously in mixed plantations.

Complete Genome Sequence Resource of Pectobacterium colocasium Strain F1-1 that Causes Soft Rot Disease of Taro.

Pectobacterium colocasium is a recently named, narrow-host-range phytopathogenic bacterium causing soft rot of taro (Colocasium esculenta). It is found on the Chinese mainland and the island of Taiwan. Taro is a domesticated crop with a long history of cultivation in Taiwan and the Pacific islands. However, not much was known about Pectobacterium spp. from taro, especially from the islands in the Pacific. Herein, we report a high-quality, completely annotated genome sequence of P. colosacium strain F1-1. The 4,816,345 bp genome, which was assembled with Illumina and Nanopore reads with 217× and 311× coverage, respectively, consists of one chromosome and no plasmid. This completely circularized genome will aid future studies in comparative genomics, evolution, and pathogenicity of P. colocasium. This genome resource will also be helpful for developing strategies to control P. colocasium in taro.[Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

First report of Pseudocerradoa paullula causing aroid leaf rust on Swiss cheese plant Monstera deliciosa in South Carolina, USA.

In February 2023, two Monstera deliciosa Liebm. (Araceae) plants with typical symptoms of leaf rust disease were detected at a grocery store in Oconee Co., South Carolina. Symptoms included chlorotic leaf spots and abundant brownish uredinia, mainly on the adaxial surface of more than 50% of leaves. The same disease was detected on 11 out of 481 M. deliciosa plants in a greenhouse at a plant nursery located in York Co., South Carolina, in March 2023. The first plant sample detected in February was used for morphological characterization, molecular identification, and pathogenicity confirmation of the rust fungus. Urediniospores were densely aggregated, globose, golden to golden brown in color, and measured 22.9 to 27.9 µm (aver. 26.0 ± 1.1 µm; n=50) in diameter with wall thickness at 1.3 to 2.6 µm (aver. 1.8 ± 0.3 µm; n=50). Telia were not observed. These morphological traits aligned with those of Pseudocerradoa paullula (basionym: Puccinia paullula; Ebinghaus et al. 2022; Sakamoto et al. 2023; Sydow and Sydow 1913; Urbina et al. 2023). Genomic DNA was extracted from urediniospores collected from the naturally infected plant sample and used for PCR amplification and DNA sequencing of the large subunit (LSU) genetic marker with primers LRust1R and LR3 (Vilgalys and Hester 1990; Beenken et al. 2012). The LSU sequence of the rust fungus in South Carolina (GenBank accession: OQ746460) is 99.9% identical to that of Ps. paullula voucher BPI 893085 (763/764 nt.; KY764151), 99.4% identical to that of voucher PIGH 17154 in Florida, USA (760/765 nt.; OQ275201), and 99% identical to that of voucher TNS-F-82075 in Japan (715/722 nt.; OK509071). Based on its morphological and molecular characteristics, the causal agent was identified as Ps. paullula. This pathogen identification was also corroborated by the U.S. Department of Agriculture, Animal and Plant Health Inspection Service, Plant Pathogen Confirmatory Diagnostics Laboratory in Laurel, Maryland. To confirm the fungus's pathogenicity on M. deliciosa and M. adansonii Schott (Sakamoto et al. 2023), three plants of each Monstera species were inoculated by spraying with a suspension of urediniospores collected from the original plant sample (1 × 106 spores per ml; approx. 40 ml per plant). Three non-inoculated control plants of each host species were treated with deionized water in the same manner. Plants were placed in a plastic tray with wet paper towels to maintain moisture. The tray was placed at 22C for an 8-h photoperiod and covered for five days to facilitate infection. On 25 days after inoculation, abundant spots bearing urediniospores were produced on all leaves of inoculated M. deliciosa plants. A few uredinia were observed on two of the three inoculated M. adansonii plants. All non-inoculated control plants remained asymptomatic. Morphological features of urediniospores collected from inoculated plants matched those of Ps. paullula used as the inoculum. Aroid leaf rust on Monstera plants was officially reported in Australia, China, Japan, Malaysia, Philippines, and Florida, USA (Shaw 1991; Sakamoto et al. 2023; Urbina et al. 2023). This is the first report of Ps. paullula causing this disease on M. deliciosa in South Carolina, USA. Monstera species are popular indoor and landscape plants. Potential impact and regulatory responses regarding Ps. paullula, a newly introduced and rapidly spreading pathogen in the USA, warrant further evaluation and discussion.

First report of Lasiodiplodia theobromae causing stem canker of pomegranate (Punica granatum L.) in India.

In March 2022, cankers and lesions appeared on the branches of 2-3-year-old pomegranate plants grown in four orchards of Hanumangarh, Rajasthan, India. The disease incidence ranged from 5-15%. Field symptoms such as dark brown lesions on one side of the branches, cracked lesions, vascular tissue discoloration and drooping of the plants were noticed. To identify the causative agent, 2 diseased branch samples, showing typical symptoms collected from each orchard 25-30 km apart. The samples were washed with distilled water and small sections of tissue were excised from both symptomatic and asymptomatic areas using a sterile scalpel. Sections were surface sterilized with 1% sodium hypochlorite for 30 sec and 70% ethanol for 2 min followed by rinsing with sterilized water thrice. Sterile sections were dried on sterile filter paper and then transferred onto potato dextrose agar (PDA) amended with streptomycin (100 mgL-1) and incubated at 24±1°C in the dark. Samples (n=5) collected from different orchards produced similar colonies, with greyish white aerial mycelia, which became dark black after 5-7 days. The morphological characteristics of all isolates were observed under microscope. Immature conidia (6.3±1.05*14.7±0.98 µm: average of 50 measurements) were single celled, hyaline, ellipsoid or ovoid, apex rounded and truncated at the base while the matured conidia (8.4±1.41*15.3±1.17 µm: average of 50 measurements) had two cells with dark septa. The conidial morphology of all isolates was in accordance with Lasiodiplodia sp. (Alves et al; 2008) therefore, one representative isolate (HSC-1) was used for molecular identification at species level. Three loci viz., ITS, EF1-a and ß tubulin of fungal genomic DNA were PCR amplified using ITS-1/4, EF-F/R and TUB-2A/2B primers, respectively. The amplicons were sequenced and deposited in GenBank, NCBI database with accession no. ON598885 (ITS), ON605203 (EF) and ON605204 (TUB). BLASTn analysis showed similarity with the sequences of Lasiodiplodia theobromae isolates: ITS showed 100% with MK530071.1 (492 bases), EF 99.77% with MT975688.1 (436 bases) and BT 99.76% with MW287586.1 (422 bases). Phylogenetic analysis using Neighbour Joining method revealed close association among L. theobromae isolates. Thus, causative agent associated with stem canker of pomegranate was confirmed as L. theobromae. Further, the same isolate was used for pathogenicity tests on 1-year-old pomegranate plants (n=6). Briefly, 2 cm wound was created in the main stem with a sterile scalpel and a same-size mycelial plug was placed in the wound and wrapped with parafilm. Six plants that were wrapped with uncultured PDA served as control. The inoculated plants were maintained at 26°C and 65-70% RH in a polyhouse. After 4 days parafilm was removed from all plants. The experiment was repeated twice. Inoculated plants produced lesions (0.7 x 5.5 cm; average of 6 measurements) similar to field symptoms after 10-15 days and no such symptoms developed on control plants. The difference between control and inoculated plants was statistically significant (p=0.0001). The fungus was re-isolated from symptomatic tissue and colonies were morphologically similar to HSC-1, thus fulfilling the Koch's postulates. The fungus, L. theobromae causes stem canker and dieback on different host plants and is mainly distributed in tropical and subtropical regions and has been reported on pomegranate from Florida (Xavier et al 2017). To the best of our knowledge, this is the first report of L. theobromae causing stem canker of pomegranate in India.

First Report of a Root Lesion Nematode (Pratylenchus brachyurus) on Cassava in Taiwan.

The root lesion nematode, Pratylenchus spp., has a wide host range affecting many economically important crops (Castillo and Vovlas 2007). Cassava (Manihot esculenta Crantz) is an important food crop in several countries, commonly used for the material of bioethanol, animal feed, and starch extraction (Howeler 2014). Soil samples were collected from a mono-cropping cassava farm located in the Houbi district, Tainan city, in Southern Taiwan in October 2021 in a routine soil survey, and there is no obvious above ground symptoms. The cassava is a local cultivar, the sampled tuber did not have lesions, but small brown lesions were present on the roots. Nematodes were extracted using the modified Baermann funnel method (Tsay et al. 2004) for 24 h. Root lesion nematodes were the dominant genera in this sample, containing over 20 individuals per 100 cm3 of soil. Females of the root lesion nematodes were picked, and surface-sterilized with 2000 ppm malachite green for 30 sec and streptomycin for 30 mins. After sterilization, a single female was transferred onto the carrot discs to establish a pure line (Coyne et al. 2014). After 2 months, nematodes were extracted from that pure culture for morphometric, molecular identification, and pathogenicity tests. The female has a moderately slender body, a low and flat lip region, a sclerotized head frame, and a short ventral overlap of the esophagus, monovarial, prodelphic, and post-uterine sac. The tail is conical and the tip is rounded or flattened. The body measures of 20 females were: body length 564.43 µm (511 to 619 µm), stylet length 18.64 µm (18.1 to 19.5 µm), tail length 32.43 µm (27.1 to 38.5 µm), post uterine sac length 12.79 µm (9.41 to 16.9 µm), and V value 85.16% (84.1 to 86.6%). Values of a, b, c, and c' ratios were 22.32 (18.9 to 26.1), 6.11 (5.36 to 6.73), 17.55 (13.8 to 20.5), and 1.18 (0.92 to 1.5), respectively. All morphometric data were similar to the previous description of P. brachyurus (Castillo and Volvlas 2007). DNA was extracted from three nematodes of the pure cultures using Viagen DirectPCR lysis buffer, and used for PCR amplification of the 18S rRNA fragment and the D2-D3 expansion segment of 28S rRNA using primer sets D2A/D3B and 988F/2646R, respectively (Holterman et al. 2006; Subbotin et al. 2006). The sequence of 18S ribosomal RNA (OP020594) shared 99% similarity with the P. brachyurus sequence deposited in the GenBank database (KY424148), and the sequence of 28S rRNA (OP020593) also shared 99% similarity with several P. brachyurus sequences (e.g. KF712473, MG745329). Bayesian consensus trees, constructed from both 18S and 28S sequences revealed that the nematodes collected in this study are clustered together with P. brachyurus sequences from other countries(Subbotin, et al. 2008). Therefore, the nematodes collected from cassava were identified as P. brachyurus based on morphology, molecular data, and phylogenetic relationship. To determine the pathogenicity, three eight-week-old cassava plants (cv. TMS 60444) were planted in 12-cm-diameter pots filled with 600 cm3 of sterile peat moss: sand (1:1, W: W) and inoculated with 50 nematodes containing different stages. Two plants treated with water were used as the mock control. Seventy-five days after inoculation, nematodes in the soil were recovered using the modified Baermann funnel method for 24 h, and the nematodes inside the root were stained with acid fuchsin. The average reproduction factor (final population/initial population) was 3.93, thus confirming cassava as a host of P. brachyurus. P. brachyurus was previously reported on peanuts and bananas in Taiwan, and wasn't a dominant species in the field. Finding this nematode on this cassava farm suggests this nematode might have a wider distribution than expected.

First report of Neopestalotiopsis foedans causing pestalotia spot in leaf on coconut in Brazil.

The coconut (Cocos nucifera L., Arecaceae) is one of the most important tropical species used by humans. In Brazil, its cultivation has been expanding in the recent years (Souza et al. 2020) and many diseases have emerged. The pestalotia spot, caused by Pestalotiopsis guepinii (Desm.), is a leaf disease of the coconut characterized by elliptic lesions with defined dark borders varying in size from 3 to 5 mm (Cardoso et al. 2003). In January of 2018, leaves with symptoms of pestalotia spot were obtained from ten year old coconut plants "dwarf variety" in a commercial planting in the city of Neópolis (10°20'S/36°42'W), Sergipe, Brazil. Disease incidence was 80% on 60 plants observed. Twenty samples of symptomatic tissues were collected and disinfested for 2 min in 1% sodium hypochlorite, washed in sterile water, placed on PDA (potato dextrose agar), and incubated at 25 ± 1°C with a 12-h photoperiod for 4 days. Five isolates were obtained, and pure cultures deposited in Phytopathogen Collection of the Federal University of Alagoas, accession numbers: COUFAL0240 to COUFAL0244. Seven day old colonies grown on PDA at 25°C, were whitish with aerial mycelium on the surface and abundant production of black conidiomata. Conidia were fusiform, straight to slightly curved with five cells, three median cells with brown coloring being the second and third being darker and the apical and basal cells, hyaline. Fifty conidia were measured and varied in size from 20.02-24.26 x 5.37-7.50 µm. The conidia presented two to four apical appendages and one basal appendage (Fig. S1). The morphological characteristics coincide with the Neopestalotiopsis foedans (Sacc. & Ellis), Maharachchikumbura et al. (2014). Molecular identification was conducted using partial nucleotide sequences from the ITS (ITS1/ITS4) region (GenBank no. MT605375 to MT605379) and from the genes TUB2 (Bt2a/Bt2B) (no. MT634202 to MT634206) and TEF-1α (526F/1567R) (no. MT634197 to MT634201). Besides that, the isolates grouped with the ex-type N. foedans species (CGMCC 3.9123) in a phylogenetic tree of Bayesian inference using concatenated sequences (Fig. S2). The pathogenicity was confirmed on seedling from coconut plants "dwarf variety" maintained in a greenhouse. Four plants were used, being one as a control. Spore suspensions of 106 conidia mL-1 was prepared from a 7 days old culture (cultivated at 25ºC). Inoculations were performed by spraying the conidial suspension on two whole leaves per plant (wounded and unwounded). In the control, sterilized distilled water was used. Plants were incubated at 25 ± 1°C and 100% relative humidity. Ten days after inoculation, depressed and necrotic lesions were observed in 100% on the inoculated leaves with wound. No symptoms observed on unwounded leaves, nor in the control treatment. To complete Koch's postulates, the N. foedans fungus was successfully re-isolated from the symptomatic leaves and identified phenotypically in optical microscope. Neopestalotiopsis foedans has already been reported in Calliandra haematocephala (Hassk), Neodypsis decaryi (Jum.), Rhizophora mangle (L.), Thuja occidentalis and Psidium guajava (L.) (Saccardo, 1882; Maharachchikumbura et al. 2014, Solarte et al. 2018). However, this is first report of N. foedans causing leaf spot in coconut in the world. The pestalotia spot is commonly observed in Brazil in C. nucifera and should be considered an important disease for this culture, as this can significantly reduce its photosynthetic area.

Papaya Sticky Disease Caused by Virus "Couples": A Challenge for Disease Detection and Management.

Papaya sticky disease (PSD) is a major virus disorder of papaya (Carica papaya). The disease is characterized by fruit damage caused by the oxidation of spontaneously exuded latex. In Brazil, PSD is caused by the coinfection of two viruses, papaya meleira virus (PMeV), a toti-like virus, and papaya meleira virus-2 (PMeV-2), an umbra-like virus. The disorder has also been reported in Mexico and, more recently, in Australia, but the presence of both PMeV and PMeV-2 in symptomatic plants has been documented only in Brazil. In 2021, 2-year-old papaya plants (cultivar Passion Red) exhibiting PSD-like symptoms were observed in Santa Elena Province, Ecuador. Molecular tests of leaf tissue and fruit latex from symptomatic plants failed to detect PMeV. However, papaya virus Q (PpVQ), an umbra-like virus related to but distinct from PMeV-2, and a novel virus, tentatively named papaya sticky fruit-associated virus (PSFaV), were found in the symptomatic samples. PSFaV shares 56% nucleotide identity with the genome of PMeV, suggesting that PSD symptoms can be caused by "couples" of viruses related to but distinct from PMeV (a toti-like virus) and PMeV-2 (an umbra-like virus). This review discusses the history and epidemiology of PSD and the genomic features of newly discovered virus couples involved in this syndrome. Given the unusual etiology of PSD, which involves distinct virus species, the importance of implementing proper diagnostic approaches for PSD is highlighted.

Occurrence of Anthracnose Caused by Colletotrichum fructicola on Ficus hirta in Southern China.

Ficus hirta Vahl. is a Moraceae plant, named for its palm-like leaves. It is a widely used traditional medicinal material with definite curative effect. At the same time, it is also a commonly used soup material among the folk in South China. In March 2022, a serious leaf spot disease with symptoms similar to anthracnose was observed on F. hirta in several plantations in Qinzhou and Zhanjiang City of China, with an incidence of 32~65%. The early symptoms of infected leaves were small, round, yellow spots that further expanded into larger, brown, irregular, necrotic lesions surrounded by dark brown edges, which eventually led to leaf wilt. Twenty symptomatic leaves were collected from three plantations with a total area of about 10 hm2. Fragments (2×2 mm) from the 20 infected leaves were surface sterilized, plated on potato dextrose agar (PDA) and incubated at 28°C. After 3 days, isolates with similar cultural morphology were obtained and three representative isolates (WZMT-1, WZMT-3 and WZMT-8) were randomly selected for following study. The colonies by single-spore purification on PDA were initially cottony, pale white and became grayish green with age. The conidia were hyaline, abundant, cylindrical, with rounded ends, 14.4~18.2 µm×4.6~6.0 µm (av. 16.2 µm×5.4 µm, n=100). Conidiogenous cells hyaline, cylindrical or ampulliform, 6.2~22.7 µm × 2.7~5.0 µm (av. 12.9 µm×3.8 µm, n=50). Appressoria were brown to dark brown, ovoid to clavate, elliptical or irregular, 7.9~13.4 µm × 5.6~9.2 µm (av. 10.6 µm×7.9 µm, n=50). The morphology of the fungus resembled Colletotrichum fructicola (Prihastuti et al. 2009). For molecular identification, the internal transcribed spacer (ITS) regions, glyceraldehyde-3-phosphatedehydrogenase (GAPDH), actin (ACT), beta-tubulin 2 (TUB2), calmodulin (CAL), partial manganese superoxide dismutase (sod2), partial Apn2-Mat1-2 intergenic spacer and partial mating type (Mat1-2) (ApMat) genes were amplified from genomic DNA for the isolates using the primers described by Silva et al. (2012) and Weir et al. (2012). The sequences of the above seven loci of the three isolates (accession nos. OQ121661 to OQ121663 and OQ133400 to OQ133417) were obtained and showed over 99% identity with the existing sequences of ex-type culture ICMP 18581 of Colletotrichum fructicola (Weir et al. 2012). A multilocus phylogenetic analysis of the seven loci concatenated sequences using the maximum likelihood method revealed that the isolates belong to C. fructicola. To confirm pathogenicity, five 3-month-old potted plants were used for inoculation with each representative isolate. Tested plants were sprayed with 10 ml of a conidial suspension (1 × 108 conidia/ml) , and the controls plants were sprayed with sterile water. All the plants were incubated in a growth chamber at 26 ± 2°C with 95% relative humidity. After 10 days, typical lesions like those observed on the field plants appeared on all inoculated plants, while the control remained healthy. The same fungal pathogen was reisolated and the identity was confirmed by morphological characterization and molecular analysis, confirming Koch's postulates. The pathogen has been reported as the causal agent of anthracnose on a wide range of plant hosts worldwide (Marquez-Zequera et al. 2018; Horfer et al. 2021; Jiang et al. 2022; Li et al. 2023). To our knowledge, this is the first report of anthracnose on F. hirta caused by C. fructicola in southern China.