The P4-ATPase Drs2 interacts with and stabilizes the multisubunit tethering complex TRAPPIII in yeast.

Multisubunit Tethering Complexes (MTCs) are a set of conserved protein complexes that tether vesicles at the acceptor membrane. Interactions with other components of the trafficking machinery regulate MTCs through mechanisms that are partially understood. Here, we systematically investigate the interactome that regulates MTCs. We report that P4-ATPases, a family of lipid flippases, interact with MTCs that participate in the anterograde and retrograde transport at the Golgi, such as TRAPPIII. We use the P4-ATPase Drs2 as a paradigm to investigate the mechanism and biological relevance of this interplay during transport of Atg9 vesicles. Binding of Trs85, the sole-specific subunit of TRAPPIII, to the N-terminal tail of Drs2 stabilizes TRAPPIII on membranes loaded with Atg9 and is required for Atg9 delivery during selective autophagy, a role that is independent of P4-ATPase canonical functions. This mechanism requires a conserved I(S/R)TTK motif that also mediates the interaction of the P4-ATPases Dnf1 and Dnf2 with MTCs, suggesting a broader role of P4-ATPases in MTC regulation.

Actin-generated force applied during endocytosis measured by Sla2-based FRET tension sensors.

Mechanical forces are integral to many cellular processes, including clathrin-mediated endocytosis, a principal membrane trafficking route into the cell. During endocytosis, forces provided by endocytic proteins and the polymerizing actin cytoskeleton reshape the plasma membrane into a vesicle. Assessing force requirements of endocytic membrane remodeling is essential for understanding endocytosis. Here, we determined actin-generated force applied during endocytosis using FRET-based tension sensors inserted into the major force-transmitting protein Sla2 in yeast. We measured at least 8 pN force transmitted over Sla2 molecule, hence possibly more than 300-880 pN applied during endocytic vesicle formation. Importantly, decreasing cell turgor pressure and plasma membrane tension reduced force transmitted over the Sla2. The measurements in hypotonic conditions and mutants lacking BAR-domain membrane scaffolds then showed the limits of the endocytic force-transmitting machinery. Our study provides force values and force profiles critical for understanding the mechanics of endocytosis and potentially other key cellular membrane-remodeling processes.

Structure of the endocytic adaptor complex reveals the basis for efficient membrane anchoring during clathrin-mediated endocytosis.

During clathrin-mediated endocytosis, a complex and dynamic network of protein-membrane interactions cooperate to achieve membrane invagination. Throughout this process in yeast, endocytic coat adaptors, Sla2 and Ent1, must remain attached to the plasma membrane to transmit force from the actin cytoskeleton required for successful membrane invagination. Here, we present a cryo-EM structure of a 16-mer complex of the ANTH and ENTH membrane-binding domains from Sla2 and Ent1 bound to PIP2 that constitutes the anchor to the plasma membrane. Detailed in vitro and in vivo mutagenesis of the complex interfaces delineate the key interactions for complex formation and deficient cell growth phenotypes demonstrate its biological relevance. A hetero-tetrameric unit binds PIP2 molecules at the ANTH-ENTH interfaces and can form larger assemblies to contribute to membrane remodeling. Finally, a time-resolved small-angle X-ray scattering study of the interaction of these adaptor domains in vitro suggests that ANTH and ENTH domains have evolved to achieve a fast subsecond timescale assembly in the presence of PIP2 and do not require further proteins to form a stable complex. Together, these findings provide a molecular understanding of an essential piece in the molecular puzzle of clathrin-coated endocytic sites.

The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

FRET Microscopy in Yeast.

Förster resonance energy transfer (FRET) microscopy is a powerful fluorescence microscopy method to study the nanoscale organization of multiprotein assemblies in vivo. Moreover, many biochemical and biophysical processes can be followed by employing sophisticated FRET biosensors directly in living cells. Here, we summarize existing FRET experiments and biosensors applied in yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe, two important models of fundamental biomedical research and efficient platforms for analyses of bioactive molecules. We aim to provide a practical guide on suitable FRET techniques, fluorescent proteins, and experimental setups available for successful FRET experiments in yeasts.

Cohabitation of two different lexA regulons in Pseudomonas putida.

In contrast to the vast majority of the members of the domain Bacteria, several Pseudomonas and Xanthomonas species have two lexA genes, whose products have been shown to recognize different LexA binding motifs, making them an interesting target for studying the interplay between cohabiting LexA regulons in a single species. Here we report an analysis of the genetic composition of the two LexA regulons of Pseudomonas putida KT2440 performed with a genomic microarray. The data obtained indicate that one of the two LexA proteins (LexA1) seems to be in control of the conventional Escherichia coli-like SOS response, while the other LexA protein (LexA2) regulates only its own transcriptional unit, which includes the imuA, imuB, and dnaE2 genes, and a gene (PP_3901) from a resident P. putida prophage. Furthermore, PP_3901 is also regulated by LexA1 and is required for DNA damage-mediated induction of several P. putida resident prophage genes. In silico searches suggested that this marked asymmetry in regulon contents also occurs in other Pseudomonas species with two lexA genes, and the implications of this asymmetry in the evolution of the SOS network are discussed.

An organized co-assembly of clathrin adaptors is essential for endocytosis.

Clathrin-mediated endocytosis, the main trafficking route from the plasma membrane to the cytoplasm, is critical to many fundamental cellular processes. Clathrin, coupled to the membrane by adaptor proteins, is thought to play a major structural role in endocytosis by self-assembling into a cage-like lattice around the forming vesicle. Although clathrin adaptors are essential for endocytosis, little is known about their structural role in this process. Here we show that the membrane-binding domains of two conserved clathrin adaptors, Sla2 and Ent1, co-assemble in a PI(4,5)P2-dependent manner to form organized lattices on membranes. We determined the structure of the co-assembled lattice by electron cryo-microscopy and designed mutations that specifically impair the lattice formation in vitro. We show that these mutations block endocytosis in vivo. We suggest that clathrin adaptors not only link the polymerized clathrin to the membrane but also form an oligomeric structure, which is essential for membrane remodeling during endocytosis.

Widespread distribution of a lexA-regulated DNA damage-inducible multiple gene cassette in the Proteobacteria phylum.

The SOS response comprises a set of cellular functions aimed at preserving bacterial cell viability in front of DNA injuries. The SOS network, negatively regulated by the LexA protein, is found in many bacterial species that have not suffered major reductions in their gene contents, but presents distinctly divergent LexA-binding sites across the Bacteria domain. In this article, we report the identification and characterization of an imported multiple gene cassette in the Gamma Proteobacterium Pseudomonas putida that encodes a LexA protein, an inhibitor of cell division (SulA), an error-prone polymerase (DinP) and the alpha subunit of DNA polymerase III (DnaE). We also demonstrate that these genes constitute a DNA damage-inducible operon that is regulated by its own encoded LexA protein, and we establish that the latter is a direct derivative of the Gram-positive LexA protein. In addition, in silico analyses reveal that this multiple gene cassette is also present in many Proteobacteria families, and that both its gene content and LexA-binding sequence have evolved over time, ultimately giving rise to the lexA lineage of extant Gamma Proteobacteria.