Correlations between Multiple SNPs and HbF Levels in ß-Thalassemia Carriers.

BACKGROUND: Increased hemoglobin F (HbF) expression in individuals with ß-thalassemia contributes to the alleviation of pathological phenomena and the reduction of mortality. We have investigated the correlation between six single nucleotide polymorphisms (SNPs) in BCL11A, XmnI-HBG2, HBS1L-MYB, and ANTXR1 and the levels of HbF in ß-thalassemia carriers. METHODS: Samples were collected from 330 cases of ß-thalassemia carriers. The genotypes of the rs4671393, rs-7482144, rs28384513, rs4895441, rs9399137, and rs4527238 were determined using Sanger sequencing. RESULTS: The results both of quantitative and qualitative analysis showed that rs4671393 (BCL11A), rs7482144 (Xmn1-HBG2), and rs9399137 (HBS1L-MYB) in ß-thalassemia carriers correlated with the levels of HbF (p < 0.05), only rs28384513 (HBS1L-MYB) and rs4527238 (ANTXR1) were associated with HbF expression in ß-thalassemia minor (p < 0.05). CONCLUSIONS: These results indicate that the SNP rs4527238 in the ANTXR1 gene was found likely to play a role as a modulator of HbF levels in ß-thalassemia carriers for the first time.

A Rare Case of Abnormal Hemoglobin Variant Hb Mizuho: [HBB: c.206T > C ß 68(E12) Leu-Pro]: A First Report in the Chinese Population.

A 6-month-old female infant presented with unexplained hemolytic anemia, showing no abnormalities by capillary electrophoresis and genetic testing for α- and ß-thalassemia mutations that are commonly seen in the Chinese population. A rare Hb Mizuho: [HBB: c.206T > C ß 68(E12) Leu- Pro] variant was identified by next-generation sequencing (NGS) and verified by Sanger sequencing. Hb Mizuho: [HBB: c.206T > C ß 68(E12) Leu- Pro] is not easily detectable because it is extremely unstable, and the correct diagnosis is usually made via DNA sequencing. This is the first report of this variant in the Chinese population.

Identification of two CUL7 variants in two Chinese families with 3-M syndrome by whole-exome sequencing.

BACKGROUND: 3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population. METHODS: Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed. RESULTS: We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein. CONCLUSION: These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.

Association of polymorphisms in the HBG1-HBD intergenic region with HbF levels.

BACKGROUND: Increased levels of fetal hemoglobin (HbF) can improve the clinical course of the patients with sickle cell anemia (SCA) or ß-thalassemia. The HBG1-HBD intergenic region plays an important role in this process. However, very few studies investigated whether the variations in this region have an effect on HbF expression. METHODS: We retrieved all the SNP data in the HBG1-HBD intergenic region and defined the haplotype blocks, then performed cluster analysis and selected a tagSNP. A total of 500 normal individuals and 300 ß-thalassemia carriers were enrolled. After routine blood and hemoglobin capillary electrophoresis testing, ß-thalassemia mutations were detected using PCR-reverse dot blot. The genotypes of the rs4910736 (A > C) and rs10128556 (C > T) were determined using Sanger sequencing; the relationship between the two SNPs and the levels of HbF was analyzed. RESULTS: Two haplotype blocks were constructed. Block 1 included seven haplotypes divided into two groups M and N by 11 tagSNPs, among which rs4910736 was selected as a tagSNP, while block 2 included three haplotypes. We found that the haplotypes of block 1 were statistically associated with HbF levels, but the non-tagSNP rs10128556 was shown to be more strongly associated with HbF levels than rs4910736. CONCLUSION: This work proved that the haplotypes in the HBG1-HBD intergenic region and SNP rs10128556 are both statistically associated with HbF levels, revealing the association of polymorphisms in the HBG1-HBD intergenic region with HbF levels.

[Analysis of LBR gene mutation in a pedigree affected with Pelger-Huёt anomaly].

OBJECTIVE: To detect mutation of LBR gene in a pedigree affected with Pelger-Huёt anomaly (PHA) and to explore its clinical characteristics. METHODS: Genomic DNA was extracted from the pedigree and healthy controls. The 14 exons of the LBR gene were subjected to PCR amplification and Sanger sequencing. Suspected mutations were verified in other family members and 100 healthy controls. Polyphen-2 and SIFT software were used to predict the effect of the mutation, and Swiss-model software was used to simulate the protein structure. RESULTS: Three patients were found to carry a c.893G>A mutation in exon 8 of the LBR gene, which resulted in substitution of the 298th amino acid residue glycine by glutamic acid (p.Gly298Glu). The same mutation was not found in healthy family members and 100 healthy controls. The mutation was predicted to be damaging. Bioinformatic simulation showed the mutation has altered the 3D structure of the LBR protein. CONCLUSION: The c.893G>A (p.Gly298Glu) mutation in the LBR gene probably underlies the PHA in this pedigree and has enriched the spectrum of LBR gene mutations.

The Prevalence and Spectrum of α-Thalassemia in Guizhou Province of South China.

α-Thalassemia (α-thal) is one of the most prevalent genetic diseases in the world and is especially frequent in tropical and subtropical regions, including South China. The aim of this study was to investigate the prevalence and spectrum of α-thal in Guizhou Province as this information was unknown. A total of 40 α-thal carriers were determined in 1219 newborn umbilical cord blood samples by hemoglobin (Hb) electrophoresis combined with DNA analysis, which revealed that the carrier rate of α-thal in Guizhou Province was 3.28%. One thousand and forty-five individuals referred to our hospital were tested for α-thal mutations. Two hundred and twenty-four cases were determined as α-thal carriers or patients. A total of 11 genotypes and five different α-thal mutations were identified in these 224 cases. Of these mutations, more than 96.0% were deletions, including - -(SEA) (65.89%), -α(3.7) (rightward) (22.87%) and -α(4.2) (leftward) (7.74%). The other two nondeletional mutations, Hb Constant Spring (Hb CS, α(CS)α, HBA2: c.427T > C) and Hb Quong Sze [Hb QS, α(QS)α, HBA2: c.377T > C (or HBA1)] account for 2.71% and 0.78%, respectively. The results of this study will be useful in genetic counseling and prenatal diagnosis (PND) of α-thal in Guizhou Province.

Application and research progress of single cell sequencing technology in leukemia.

Leukemia is a malignant tumor with high heterogeneity and a complex evolutionary process. It is difficult to resolve the heterogeneity and clonal evolution of leukemia cells by applying traditional bulk sequencing techniques, thus preventing a deep understanding of the mechanisms of leukemia development and the identification of potential therapeutic targets. However, with the development and application of single-cell sequencing technology, it is now possible to investigate the gene expression profile, mutations, and epigenetic features of leukemia at the single-cell level, thus providing a new perspective for leukemia research. In this article, we review the recent applications and advances of single-cell sequencing technology in leukemia research, discuss its potential for enhancing our understanding of the mechanisms of leukemia development, discovering therapeutic targets and personalized treatment, and provide reference guidelines for the significance of this technology in clinical research.

Identification of Novel Hb Guiyang [HBA2: c.151C > A α2 50 (CE8) His- Asn] and Phenotype- Genotype Correlation of Abnormal Hemoglobins in Guizhou, Southwest China.

Purpose: To analyze the composition of abnormal hemoglobin and the relationship between genotype and phenotype by screening abnormal hemoglobin in a subpopulation of Guizhou, China. Patients and Methods: Routine blood evaluation, capillary electrophoresis of hemoglobin, and mutation of α - and ß - thalassemia genes were evaluated in 19,976 individuals for thalassemia screening in Guizhou. Sanger sequencing of HBA1, HBA2 and HBB genes was performed in samples with abnormal bands or unexplained increases of normal bands. The types of abnormal hemoglobin were obtained by sequence analysis. Results: Abnormal hemoglobin was detected in 84 individuals (detection rate, 0.42%). Ten types each of α and ß globin chain variants were detected, including most commonly Hb E, Hb New York and Hb Port Phillip. In this study, the abnormal Hb Mizuho was identified for the first time in a Chinese population, and a novel abnormal hemoglobin Hb Guiyang (HBA2: c.151C > A) was detected for the first time. Except for Hb Mizuho, other abnormal hemoglobin heterozygotes without thalassemia or iron deficiency had no significant hematological changes. Conclusion: This study enriched the molecular epidemiological data of abnormal hemoglobin in Guizhou, China and provided reference data for genetic counseling and prenatal diagnosis of abnormal hemoglobin.

Application of third-generation sequencing for genetic testing of thalassemia in Guizhou Province, Southwest China.

OBJECTIVES: To explore the application of third-generation sequencing (TGS) for genetic diagnosis and prenatal genetic screening of thalassemia genes. METHODS: Two groups of subjects were enrolled in this study. The first group included 176 subjects with positive hematological phenotypes for thalassemia. Thalassemia-associated genes were detected simultaneously in each sample using both the PacBio TGS platform based on single-molecule real-time (SMRT) technology and the conventional PCR-reverse dot blot (PCR-RDB). Sanger sequencing was used for validation when results were discordant between the two methods. The second group included 53 couples with at least one partner having a positive thalassemia hematological phenotype, and they were screened for homotypic thalassemia variants by TGS, and the risk of pregnancies with babies presenting with severe thalassemia, was assessed. RESULTS: Of the 176 subjects, 175 had concordant genotypes between the two methods, including 63 normal subjects and 112 α- and/or ß-thalassemia gene carriers, with a concordance rate of 99.43%. TGS detected a rare ß-thalassemia gene variant -50 (G > A) that was not detected by conventional PCR-RDB. TGS identified seven of the 53 couples as homotypic thalassemia gene carriers, five of whom were at risk of pregnancies with severe thalassemia. CONCLUSION: TGS could effectively detect common and rare thalassemia variants with high accuracy and efficiency. This approach would be suitable for prenatal thalassemia genetic screening in areas with high incidence of thalassemia.

[Impact of five genetic polymorphisms on inter-individual variation in warfarin maintenance dose].

OBJECTIVE: To investigate the effect of genetic polymorphisms in VKORC1, CYP2C9, GGCX, EPHX1, APOE genes on inter-individual variation in warfarin maintenance dose. METHODS: Two hundred and forty-nine patients with stable warfarin dose were enrolled in this study, and the clinical data and blood samples of the patients were collected. Genotypes for the 5 genes were determined by using PCR and denaturing high performance liquid chromatography (DHPLC) assay. The warfarin maintenance doses were compared among patients with different genotypes of the 5 genes, and a warfarin stable dosing algorithm was derived based on genetic and non-genetic factors. RESULTS: Of the 5 genes, VKORC1, CYP2C9 and GGCX were associated with warfarin stable dose. The multiple linear regression analysis indicated that VKORC1, CYP2C9 and GGCX genes, age and weight, had significant influence on inter-individual variation in warfarin stable dose, which contributed 30.2%, 22.8%, 1.5%, 4.7% and 6.7% respectively. The warfarin stable dosing algorithm acquired from the optimal regression model could explain 57.8% variation in warfarin dose. CONCLUSION: This study suggested that genetic factors are the major determinants of the warfarin maintenance dose, and warfarin stable dosing algorithm may be useful for helping clinicians to prescribe warfarin with greater safety and efficiency.

[Clinical applications of dosing algorithm in the predication of warfarin maintenance dose].

OBJECTIVE: To evaluate the feasibility of clinical application for genetic based dosing algorithm in the predication of warfarin maintenance dose in Chinese population. METHODS: The clinical data were collected and blood samples harvested from a total of 126 patients undergoing heart valve replacement. The genotypes of VKORC1 and CYP2C9 were determined by melting curve analysis after PCR. They were divided randomly into the study and control groups. In the study group, the first three doses of warfarin were prescribed according to the predicted warfarin maintenance dose while warfarin was initiated at 2.5 mg/d in the control group. The warfarin doses were adjusted according to the measured international normalized ratio (INR) values. And all subjects were followed for 50 days after an initiation of warfarin therapy. RESULTS: At the end of a 50-day follow-up period, the proportions of the patients on a stable dose were 82.4% (42/51) and 62.5% (30/48) for the study and control groups respectively. The mean durations of reaching a stable dose of warfarin were (27.5 ± 1.8) and (34.7 ± 1.8) days and the median durations were (24.0 ± 1.7) and (33.0 ± 4.5) days in the study and control groups respectively. Significant differences existed in the durations of reaching a stable dose between the two groups (P = 0.012). Compared with the control group, the hazard ratio (HR) for the duration of reaching a stable dose was 1.786 in the study group (95%CI 1.088 - 2.875, P = 0.026). CONCLUSION: The predicted dosing algorithm incorporating genetic and non-genetic factors may shorten the duration of achieving efficiently a stable dose of warfarin. And the present study validates the feasibility of its clinical application.

Association between apolipoprotein E gene polymorphism and the dose for warfarin maintenance.

OBJECTIVE: To investigate the association between the apolipoprotein E (apoE) gene polymorphism and the dose for warfarin individual maintenance. METHODS: The genotypes of 249 patients with warfarin treatment in maintenance doses were determined by PCR/DHPLC assay. The doses for warfarin maintenance were compared among patients with different genotypes. RESULTS: In the total of 249 patients, the frequencies of 2/ε2, ε2/ε3, ε2/ε4, ε3/ε3, ε3/ε4, ε4/ε4 genotype were 1.20%, 15.66%, 1.80%, 72.29%, 9.24%, 0.80%, respectively; the allele frequencies of ε2, ε3, ε4 were 9.44%, 84.74%, 5.82%, respectively. The warfarin dose of group ε2 (ε2/ε2, ε2/ε3) was (3.24 ± 1.36) mg/d, slightly higher than that of group ε3 (ε3/ε3, 2.91 ± 1.14 mg/d) or group ε4 [ε4/ε4, ε3/ε4, (2.98 ± 1.05) mg/d], but the difference of the warfarin doses among the 3 groups did not reach statistical significance (F=1.848,P>0.05). CONCLUSION: ApoE polymorphism may be not a major genetic factor that influences the individual dose for warfarin maintenance.

[Effect of ginkgo biloba extract on plasma vascular endothelial growth factor during peri-operative period of cardiac surgery].

OBJECTIVE: To investigate the effect and clinical value of ginkgo biloba extract (Ginaton) on the plasma vascular endothelial growth factor (VEGF) in patients during peri-operative period of cardiac surgery. METHODS: Twenty patients scheduled to receive cardiac operation were randomly assigned to 2 groups by a digital table. For the 10 patients in the control group, the cardiopulmonary bypass (CPB) was established in routine and received cold (4 degrees C) St. Thomas' cardioplegia perfusion (15 mL/kg) via aortic root after ascending aorta blocking, as for the 10 patients in the Ginaton group, the same was done but with 0.5 mg/kg of Ginaton added to the cardioplegia perfusion. Plasma VEGF contents were detected by ELISA at different time points, i.e., before and after anesthesia induction (T1, T2), after aorta intubation (T3), 0.5 h after aorta clamping (T4), 0.5 h after aorta declamping (T5), immediate after terminating the operation (T6), 6 h after operation (T7), and 24 h after operation (T8). RESULTS: In the control group, VEGF level began to rise at T, and reached the peak at T7(P < 0.01), while in the Ginaton group, it reached the peak early at T, (P < 0.01), and began to drop at T (P < 0.01). CONCLUSION: Ginaton could induce the production of VEGF, which may be one of the mechanisms for its myocardial protection.

Reference intervals for HbA2 and HbF and cut-off value of HbA2 for ß-thalassemia carrier screening in a Guizhou population of reproductive age.

OBJECTIVE: The aims of this study were to establish the reference intervals for HbA2 and HbF in a Guizhou population of reproductive age, and to determine the cut-off value of HbA2 for ß-thalassemia carrier screening. METHODS: Hemoglobin analysis was performed on 832 individuals without hypochromic microcytic anemia to calculate the reference intervals for HbA2 and HbF. Three hundred and ninety one ß-thalassemia carriers and non ß-thalassemia individuals were analyzed for their HbA2 levels followed by detecting ß-globin gene mutations, then cut-off value of HbA2 for ß-thalassemia carrier screening was determined using ROC curve analysis. RESULTS: The reference interval for HbA2 in overall normal individuals was 2.3%-3.1%, and reference intervals for HbF in normal males and females (including normal females and pregnant women) were 0-0.5% and 0-1.0% respectively. The cut-off values of HbA2 for ß-thalassemia carrier screening in males, non-pregnant women, pregnant women and the overall set were 4.40%, 3.75%, 3.70% and 3.95% respectively. CONCLUSION: Gender and pregnancy status had no obvious influence on reference interval for HbA2. The HbF level was higher in females than in males, but pregnancy status had no obvious influence on HbF level. Cut-off value of HbA2 for ß-thalassemia carrier screening was obviously affected by gender but not by pregnancy status.

[Effect of Blocking PYR Complex Binding to DNA Site by Peptide Nucleic Acid on γ-Globin Gene Expression].

OBJECTIVE: To investigate the effect of blocking polypyrimidine complex binding to DNA site by using peptide nucleic acid (PNA) on γ-globin gene expression. METHODS: PYR-PNA, ß-PNA and RS-PNA (random sequence-PNA) were designed and synthesized, then were transfected into K562 cells with the cationic liposome lipofectamine 2000 used as vector. The expression of γ-globin gene at both the transcriptional and translational level was detected by RT-PCR and the Western blot respectively at 24 h, 48 h and 72 h after transfection with PNAs. RESULTS: Compared with RS-PNA and control groups, the expression of γ-globin gene at mRNA and protein levels in PYR-PNA group was significantly up-regulated(P<0.05), especially at 48 h after tranfection, the levels of mRNA and protein in PYR-PNA group were increased by 2.0 and 2.5 times than those in control group, respectively. CONCLUSION: PYR-PNA can significantly up-regulate the expression of γ-globin gene in K562 cells, this study may provide a new research idea for gene therapy of ß-thalassemia.

[Effects of Ginaton on the markers of myocardial injury during cardiopulmonary bypass].

OBJECTIVE: To evaluate the effects of Ginaton (Ginkgo biloba leaf extract) on the myocardial injury markers (MIMs) during cardiopulmonary bypass (CPB). METHODS: Forty patients with congenital heart diseases, scheduled to take atrial septum or ventricular septum repairing operation, were randomly divided into the Ginaton group and the control group, 20 cases in each group. Patients in both groups received St. Thomas' cardioplegic perfusion via radix aortae, while Ginaton (0.5 mg/kg) was added into the perfusion for the Ginton group. Cardiac surgery were started after complete heart arrest. Central venous blood was obtained before and at 0, 6th, 12th, 24th and 48th hour after operation for detection of serum C reaction protein (CRP) by immunoturbidimetry, as well as creation kinase-MB isoenzyme (CK-MB), cardiac troponin T (cTnT) and cardiac troponin I (cTnI) with enzyme-linked immunosorbent assay (ELISA). RESULTS: There was no difference in serum concentration of CRP, CK-MB, cTnT and cTnI between the two groups before operation (P > 0.05). These indexes increased immediately after operation in both groups ( P < 0.05). They reached the peak value 12 hrs after CPB and reduced to normal level 48 hrs post-operation in the control group, with the value significantly higher than that in the Ginaton group at all the corresponding time points (P < 0.05, or P < 0.01). CONCLUSION: Perfusion with Ginaton during CPB could significantly decrease the release of MIMs and improve post-CPB cardiac function recovery, exerting favorable myocardium-protective effects.

Differential expression of microRNAs in plasma of patients with prediabetes and newly diagnosed type 2 diabetes.

AIMS: MicroRNAs (miRNAs) are present in plasma and have emerged as critical regulators of gene expression at posttranscriptional level, and thus are involved in various human diseases, including diabetes. The objective of this study was to screen and validate differentially expressed plasma miRNAs in prediabetes and newly diagnosed type 2 diabetes (T2D). METHODS: In this study, we screened differentially expressed plasma miRNAs in prediabetes and newly diagnosed T2D by miRNA microarray analysis, and validated the expression of candidate miRNAs using quantitative reverse transcription polymerase chain reaction assays. Furthermore, we performed gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) pathway analyses to disclose functional enrichment of genes predicted to be regulated by the differentially expressed miRNAs. RESULTS: Notably, our results revealed that hsa-miR-1249, hsa-miR-320b, and hsa-miR-572 (P < 0.05) were differentially expressed among the three groups, which yielded an area under the receiver operator characteristics curve (AUC) of 0.784 [95 % confidence interval (CI) 0.685-0.883], 0.946 (95 % CI 0.906-0.985), and 0.843 (95 % CI 0.766-0.920) discriminating T2D patients from NGT control groups, respectively, while the AUC was 0.887 (95 % CI 0.818-0.957), 0.635 (95 % CI 0.525-0.744), and 0.69 (95 % CI 0.580-0.793) discriminating prediabetes patients from NGT control groups, respectively. In addition, GO and KEGG pathway analyses showed that genes predicted to be regulated by differentially expressed miRNAs were significantly enriched in several related biological processes and pathways, including the development of multicellular organisms, signal transduction, cell differentiation, apoptosis, cell metabolism, ion transport regulation, and other biological functions. CONCLUSIONS: Taken together, our results showed differentially expressed miRNAs in T2D and prediabetes. Plasma hsa-miR-1249, hsa-miR-320b, and hsa-miR-572 may serve as novel biomarkers for diagnosis and potential targets for the treatment for prediabetes and T2D.

Efficacy and safety of interferon-gamma-targeted therapy in Crohn's disease: a systematic review and meta-analysis of randomized controlled trials.

AIMS: To evaluate the efficacy and safety of interferon-gamma-targeted therapy in Crohn's disease (CD). METHODS: Keyword and MeSH searches of MEDLINE/PubMed, EMBASE, the Cochrane Database, Science Citation Index and the Chinese Biomedical Database, from the inception of each database to March 2012, were used to identify all available randomized controlled trials. Summary estimates of treatment effects and safety were produced with Review Manager, using relative risks (RR) of clinical response, clinical remission and adverse events rates. RESULTS: Only three randomized controlled trials comparing anti-interferon-gamma therapy with placebo were qualified for the meta-analysis according to inclusion criteria. There were significant differences in clinical remission rates between groups (at week 6: RR=2.01, 95% confidence interval [CI]: 1.18-3.45; at week 8: RR=1.98, 95% CI: 1.17-3.33). There was also a significant difference in clinical response rates at week 8 (RR=1.60, 95% CI: 1.12-2.27). However, there was no statistically significant difference between anti-interferon-gamma therapy and placebo on adverse events rates (RR=0.98, 95% CI: 0.79-1.20). CONCLUSIONS: Anti-interferon-gamma therapy is safe and effective for treating active CD despite slow onset of action.

[Analysis on effectiveness of platelet transfusion in 1786 patients].

This study was aimed to observe and analyze the effectiveness of platelet transfusion. The platelet count of 1786 patients before transfusion and on 20-24 hours after transfusion was determined by using Auto-Hematology Analyzer, the percent platelet recovery (PPR) was calculated, the platelet transfusion efficiency (PTE) was evaluated by PPR and hemorrhage presentation after platelet transfusion, and the PTE was statistically analyzed according to disease cause, transfusion frequency, platelet type and once transfusion amount. The results showed that the total PTE of 1786 patients was 52.5%. The comparison of PTE among groups of disease cause showed that PTE in leukemia and aplastic anemia (AA) was lowest, as compared with that of other diseases (P < 0.05), while PTE in operation group was highest. The comparison of PTE among groups of transfusion frequency revealed also statistical difference (P < 0.01), meanwhile PTE decreased with increasing of transfusion frequency. The comparison of PTE among groups of platelet type (platelet phoresis or platelet concentrate) showed statistical difference (P < 0.01). The comparison of PTE among groups of platelet concentrate of once transfusion amount showed no statistical difference (P > 0.05). It is concluded that the PTE closely relates with disease cause of patients, moreover transfusion frequency also associates with PTE, the more frequency of transfusion, the higher possibility of transfusion refractoriness. The PTE of platelet pheresis is obviously superior to that of platelet concentrate, while PTE of platelet concentrate not significantly relates with once adequate or not.

Influence of GGCX genotype on warfarin dose requirements in Chinese patients.

INTRODUCTION: It has been widely accepted that genetic factors were the major sources of the variation in warfarin dose. This study is intended to investigate whether the 3261G>A variation in GGCX gene influences stable warfarin dose in Chinese patient population. MATERIALS AND METHODS: A total of 217 patients with stable warfarin dose were enrolled. Genomic DNA was extracted from each subject and the genotype of GGCX 3261G>A was determined by using of denaturing high-performance liquid chromatography (DHPLC). Least significant difference tests (LSDs) were used to compare dose with genotypes. Analysis of variance (ANVOA) was used to calculate the proportion of warfarin dose that could be explained by variation in genotype. RESULTS: In the total of 217 subjects, 84 patients (38.7%) were GG homozygote, whereas 117 (53.9%) were GA heterozygote and 16 (7.4%) were AA homozygote. Patients with the GGCX 3261AA genotype had a significantly higher average daily maintenance dose (3.39 ± 1.40 mg) than those with the GG genotype (2.69 ± 1.07 mg; P=0.027), and GGCX 3261G>A explains 2.3% of the univariate warfarin dose variance. CONCLUSION: GGCX 3261G>A may affect warfarin dose requirements, and showed a small but significant effect on warfarin dose in a Chinese patient population.