RESUMEN
Lung cancer is a major public health problem worldwide, with high rates of morbidity and mortality. It often coexists with chronic obstructive pulmonary disease (COPD), the diagnosis and management of which often receives insufficient attention. In particular, the presence of COPD has significant implications for the clinical management of lung cancer patients. This review systematically assesses the influence of COPD on the efficacy of immunotherapy and the occurrence of immune-related adverse events in patients with lung cancer, identifies existing challenges and proposes avenues for future research in this field.
Asunto(s)
Neoplasias Pulmonares , Enfermedad Pulmonar Obstructiva Crónica , Humanos , Neoplasias Pulmonares/complicaciones , Neoplasias Pulmonares/terapia , Enfermedad Pulmonar Obstructiva Crónica/complicaciones , Enfermedad Pulmonar Obstructiva Crónica/terapia , Enfermedad Pulmonar Obstructiva Crónica/diagnóstico , InmunoterapiaRESUMEN
OBJECTIVES: Families are a transmission route for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) because of the close contact. Monitoring of the viral load will be a valuable method to reduce the optimal number of quarantine days, especially in presymptomatic and symptomatic carriers of their households. The traditional three-generation families living together are seen frequently in East Asia, including in Taiwan. STUDY DESIGN: We report on a family cluster with six individuals infected with coronavirus disease in Taiwan. METHODS: The current public policy in Taiwan is quarantine for at least 14 days, based on the incubation period, or until the patient has tested negative three days in a row using the SARS-CoV-2 reverse transcription polymerase chain reaction. Details on the onset date of clinical symptoms, throat swab conversion, and course of disease were collected from medical records retrospectively. RESULTS: In the household of this three-generation Taiwanese family, the infection rate was 60%. The ratio of males to females was 4:2, and the age range was 11-85 years. The prevalence of asymptomatic disease was 33.3% (2/6). The longest throat swab conversion time was 37 days, and the estimated course of disease from symptoms to first conversion of throat swab was 59 days. CONCLUSIONS: Large families, including three-generation families in a single dwelling, should be monitored when the index case is found. Presymptomatic and symptomatic family members could be quarantined for an appropriate duration which, in our experience, is 2 months.
Asunto(s)
Infecciones por Coronavirus/prevención & control , Infecciones por Coronavirus/transmisión , Familia , Pandemias/prevención & control , Neumonía Viral/prevención & control , Neumonía Viral/transmisión , Cuarentena/estadística & datos numéricos , Adolescente , Adulto , Anciano , Anciano de 80 o más Años , COVID-19 , Niño , Infecciones por Coronavirus/epidemiología , Femenino , Humanos , Masculino , Persona de Mediana Edad , Neumonía Viral/epidemiología , Estudios Retrospectivos , Taiwán/epidemiología , Factores de Tiempo , Adulto JovenRESUMEN
Luminescent gold nanoclusters (AuNCs) with good biocompatibility have gained much attention in bio-photonics. In addition, they also exhibit a unique photo-physical property, namely thermally activated delayed fluorescence (TADF), by which both singlet and triplet excitons can be harvested. The combination of their non-toxic material property and unique TADF behavior makes AuNCs biocompatible nano-emitters for bio-related light-emitting devices. Unfortunately, the TADF emission is quenched when colloidal AuNCs are transferred to solid states under ambient environment. Here, a facile, low-cost and effective method was used to generate efficient and stable TADF emissions from solid AuNCs under ambient environment using polyvinyl alcohol as a solid matrix. To unravel the underlying mechanism, temperature-dependent static and transient photoluminescence measurements were performed and we found that two factors are crucial for solid TADF emission: small energy splitting between singlet and triplet states and the stabilization of the triplet states. Solid TADF films were also deposited on the flexible plastic substrate with patterned structures, thus mitigating the waveguide-mode losses. In addition, we also demonstrated that warm white light can be generated based on a co-doped single emissive layer, consisting of non-toxic, solution-processed TADF AuNCs and fluorescent carbon dots under UV excitation.
RESUMEN
Gilbert's syndrome is suspected in patients with unconjugated hyperbilirubinemia caused by decreased activity of the UDP-glucuronosyltransferase 1A1 (UGT1A1) gene in the absence of abnormal liver function and hemolysis. The major genetic variants underlying Gilbert's syndrome are TATA-box repeats of the promoter region and exon 1 G211A of the coding region, particularly in Asians. The efficacy of DNA melting curve analysis, however, has not been established for the G211A mutation. For rapid and accurate molecular diagnosis of Gilbert's syndrome, DNA melting curve analysis was evaluated for its genotyping capability not only for TATA-box repeats of the UGT1A1 promoter, but also for G211A of UGT1A1 exon 1. TA repeats within the TATA-box sequence and the exon 1 G211A mutation of the UGT1A1 gene were analyzed by DNA melting curve analysis. To evaluate the assay reliability, direct sequencing or polyacrylamide gel electrophoresis was used as a comparative method. All homozygous and heterozygous polymorphisms of A(TA)7TAA within the TATA-box allele and of exon 1 G211A mutants of the UGT1A1 gene were successfully identified with DNA melting curve analysis. DNA melting curve analysis is, therefore, an effective molecular method for the rapid diagnosis of Gilbert's syndrome, as it detects not only TATA-box polymorphisms but also the exon 1 G211A mutation located within the UGT1A1 gene.
Asunto(s)
Enfermedad de Gilbert/genética , Glucuronosiltransferasa/genética , Patología Molecular , Alelos , Pueblo Asiatico/genética , Exones , Genotipo , Enfermedad de Gilbert/diagnóstico , Humanos , Mutación , Desnaturalización de Ácido Nucleico/genética , Polimorfismo Genético , Regiones Promotoras Genéticas , TATA Box/genéticaRESUMEN
The parity-violating (PV) asymmetry of inclusive π- production in electron scattering from a liquid deuterium target was measured at backward angles. The measurement was conducted as a part of the G0 experiment, at a beam energy of 360 MeV. The physics process dominating pion production for these kinematics is quasifree photoproduction off the neutron via the Δ0 resonance. In the context of heavy-baryon chiral perturbation theory, this asymmetry is related to a low-energy constant d(Δ)- that characterizes the parity-violating γNΔ coupling. Zhu et al. calculated d(Δ)- in a model benchmarked by the large asymmetries seen in hyperon weak radiative decays, and predicted potentially large asymmetries for this process, ranging from A(γ)-=-5.2 to +5.2 ppm. The measurement performed in this work leads to A(γ)-=-0.36±1.06±0.37±0.03 ppm (where sources of statistical, systematic and theoretical uncertainties are included), which would disfavor enchancements considered by Zhu et al. proportional to V(ud)/V(us). The measurement is part of a program of inelastic scattering measurements that were conducted by the G0 experiment, seeking to determine the N-Δ axial transition form factors using PV electron scattering.
RESUMEN
We have fabricated surface-enhanced Raman scattering (SERS) substrates based on arrays of silver nanoparticles grown on porous anodic alumina templates. Using this nanotechnology platform, label-free and high-speed detection of bacteria are achieved. SERS spectra of various bacteria including Staphylococcus Aureus (Gram-positive bacterium), Klebsiella Pneumoniae (Gram-negative bacterium), and Mycobacterium Smegmatis (Mycobacterium) were recorded. The highly reproducible SERS-based technological platform is capable of differentiating different kinds of bacteria by PCA, LDA, clustering analysis, and SVM methods, which provides promising opportunity for biosensing of clinical microbes.
Asunto(s)
Bacterias/aislamiento & purificación , Técnicas Biosensibles/instrumentación , Recuento de Colonia Microbiana/instrumentación , Nanoestructuras/química , Nanotecnología/instrumentación , Espectrometría Raman/instrumentación , Bacterias/química , Membrana Celular/química , Diseño de Equipo , Análisis de Falla de Equipo , Luz , Nanoestructuras/ultraestructura , Dispersión de RadiaciónRESUMEN
BACKGROUND: The level of minimal residual disease (MRD) in acute myeloid leukemia (AML) at early time points (TPs) may be an important prognostic factor. Although internal tandem duplication of FLT3 (FLT3-ITD) as an MRD marker has been questioned for its instability based on semi-quantitative methods, we hypothesized that FLT3-ITD dynamics measured by sensitive quantitative real-time PCR at early TPs before appearance of instability may provide prognostic information. PATIENTS AND METHODS: We measured mutant quantity in 493 serial samples from 55 patients with a median follow-up time of 64.8 months. The FLT3-ITD quantities after induction (TP1) and after the first post-induction chemotherapy (TP2) were analyzed. RESULTS: We found that lower FLT3-ITD levels at TP2 predicted longer overall survival (OS) and disease-free survival (DFS) regardless of cytogenetic risk. Multivariate analysis showed that ≥3 log reduction of FLT3-ITD at TP2 independently predicted better DFS and a trend toward better OS. FLT3-ITD disappeared at relapse in 16.7% of patients and none in those harboring mutant NPM1 compared with 29.4% in those with wild-type NPM1 (P = 0.032). CONCLUSIONS: Though the mutation may disappear at relapse in a few patients, FLT3-ITD levels at early TPs after chemotherapy provide prognostic information. FLT3-ITD is significantly more stable in those with mutant NPM1.
Asunto(s)
Leucemia Mieloide Aguda/genética , Neoplasia Residual/genética , Proteínas Nucleares/genética , Tirosina Quinasa 3 Similar a fms/genética , Adolescente , Adulto , Anciano , Anciano de 80 o más Años , Secuencia de Aminoácidos , Supervivencia sin Enfermedad , Femenino , Estudios de Asociación Genética , Marcadores Genéticos , Humanos , Estimación de Kaplan-Meier , Leucemia Mieloide Aguda/tratamiento farmacológico , Leucemia Mieloide Aguda/mortalidad , Masculino , Persona de Mediana Edad , Datos de Secuencia Molecular , Análisis Multivariante , Mutagénesis Insercional , Neoplasia Residual/diagnóstico , Proteínas Nucleares/metabolismo , Nucleofosmina , Pronóstico , Análisis de Secuencia de ADN , Adulto Joven , Tirosina Quinasa 3 Similar a fms/metabolismoRESUMEN
We have measured the beam-normal single-spin asymmetries in elastic scattering of transversely polarized electrons from the proton, and performed the first measurement in quasielastic scattering on the deuteron, at backward angles (lab scattering angle of 108°) for Q² = 0.22 GeV²/c² and 0.63 GeV²/c² at beam energies of 362 and 687 MeV, respectively. The asymmetry arises due to the imaginary part of the interference of the two-photon exchange amplitude with that of single-photon exchange. Results for the proton are consistent with a model calculation which includes inelastic intermediate hadronic (πN) states. An estimate of the beam-normal single-spin asymmetry for the scattering from the neutron is made using a quasistatic deuterium approximation, and is also in agreement with theory.
RESUMEN
We have measured parity-violating asymmetries in elastic electron-proton and quasielastic electron-deuteron scattering at Q2=0.22 and 0.63 GeV2. They are sensitive to strange quark contributions to currents in the nucleon and the nucleon axial-vector current. The results indicate strange quark contributions of approximately < 10% of the charge and magnetic nucleon form factors at these four-momentum transfers. We also present the first measurement of anapole moment effects in the axial-vector current at these four-momentum transfers.
RESUMEN
Entecavir is a potent inhibitor of hepatitis B virus (HBV) polymerase. The efficacy and safety of entecavir in nucleoside-naïve patients with hepatitis B virus e antigen (HBeAg)-positive chronic hepatitis B was established in a large, international, double-dummy study (ETV-022) where patients were randomized to entecavir 0.5 mg/day (n = 354) or lamivudine 100 mg/day (n = 355) once daily. ETV-022 had a 52-week blinded treatment phase, followed by an extended blinded treatment phase for up to 44 additional weeks (96 weeks total). Treatment was discontinued for patients achieving a protocol-defined response as determined by patient management criteria that intended to test the possibility of finite therapy, which has not previously been studied for entecavir or other anti-HBV agents in a large trial. Early results from this study have been previously presented/published separately. This paper compiles the results of up to 2 years of treatment for protocol-defined responders, virologic responders and nonresponders. For responders who discontinued therapy (per protocol), 24-week off-treatment evaluation is presented to provide a more 'complete picture' of what clinicians can expect when treating nucleoside-naïve HBeAg-positive patients with chronic hepatitis B. For patients who discontinued therapy because of nonresponse (nonresponders) and subsequently entered the rollover study ETV-901, follow-up results, including resistance profile, are provided.
Asunto(s)
Antivirales , Guanina/análogos & derivados , Antígenos e de la Hepatitis B/sangre , Hepatitis B Crónica/tratamiento farmacológico , Lamivudine , Antivirales/administración & dosificación , Antivirales/efectos adversos , Antivirales/farmacología , Antivirales/uso terapéutico , ADN Viral/sangre , Relación Dosis-Respuesta a Droga , Método Doble Ciego , Farmacorresistencia Viral , Guanina/administración & dosificación , Guanina/efectos adversos , Guanina/farmacología , Guanina/uso terapéutico , Virus de la Hepatitis B/efectos de los fármacos , Hepatitis B Crónica/virología , Humanos , Lamivudine/administración & dosificación , Lamivudine/efectos adversos , Lamivudine/farmacología , Lamivudine/uso terapéutico , Pruebas de Sensibilidad Microbiana , Factores de Tiempo , Resultado del TratamientoRESUMEN
The primary function of MHC polymorphism is considered as the foundation of self-defense mechanism of the host in surveillance against countless diverse invading pathogens. However, this biological function can also elicit undesirable immunological responses that jeopardize transplantations when compatibility between donors and recipients is unfavourable.
Asunto(s)
Antígenos HLA-DR/genética , Alelos , Exones/genética , Cadenas HLA-DRB1 , Haplotipos/genética , HumanosRESUMEN
The purpose of this study was to investigate the galactose single point (GSP) method, a residual liver function test recently recommended by the US Food and Drug Administration, which can be a useful tool for rat liver function measurement. Rats were treated either with carbon tetrachloride (CCl(4)) alone (1 mL/kg, intraperitoneally [i.p.]) for one day or with isoniazid (INH) alone (150 mg/kg, i.p.) or (in order to ameliorate the effects of INH) with a combination of INH and bis-p-nitrophenyl phosphate (BNPP) (25 mg/kg, i.p.) for 21 days. Hepatotoxicity was assayed by plasma aspartate aminotransferase (AST) and alanine aminotransferase (ALT) activities and scores of histological activity index-necroinflammation (HAI-NI) of the respective liver specimens. The GSP method in rats was defined by the galactose blood level after 60 min. Significant differences in GSP values were observed between controls and the CCl(4)-treated rats. After 21 days of treatment, no significant changes in AST and ALT values were observed among the control, INH and INH-BNPP groups. There were significant differences in average GSP values for controls (P < 0.001) and INH-BNPP (P < 0.001) compared with INH alone. Highly significant correlations (P < 0.001) were obtained between GSP and scores of HAI-NI for all the groups. GSP was concluded to be a more sensitive biomarker of INH-induced hepatotoxicity than AST or ALT in the rats. The GSP method has been proved to be a simple and useful tool for the quantitative determination of liver function in rats, which can possibly be extended to other animals.
Asunto(s)
Galactosa/sangre , Pruebas de Función Hepática/veterinaria , Hígado/metabolismo , Alanina Transaminasa/sangre , Animales , Animales de Laboratorio , Aspartato Aminotransferasas/sangre , Tetracloruro de Carbono , Enfermedad Hepática Inducida por Sustancias y Drogas , Histocitoquímica/veterinaria , Isoniazida , Hepatopatías/sangre , Pruebas de Función Hepática/métodos , Masculino , Ratas , Ratas Sprague-DawleyRESUMEN
Aglaonema (Aglaonema spp.) is a popular ornamental potted plant in Taiwan. In 2003, leaves showing soft rot symptoms were found on a number of Sithiporn aglaonema (A. marantifoloum var. tricolor × A. rotundum) plants in a nursery in southern Taiwan. The disease usually started from leaf tips or wounded sites and the affected areas appeared water soaked. The diseased tissue subsequently turned dark brown and became fragile. More than 50% of Sithiporn aglaonema plants were destroyed in the affected nursery. Bacteria isolated from the symptomatic leaves grew at 39°C, degraded pectate, caused soft rot on slices of potato tuber and petioles of Chinese cabbage, produced phosphatase and lecithinase, and utilized malonate, but did not grow in 5% NaCl or produce acid from trehalose. These characteristics were similar to those of Erwinia chrysanthemi Burkholder et al. (1,2) and the reference strain OS2 from Phalaenopsis sp. provided by K. C. Tzeng of National Chung Hsing University, Taichung, Taiwan. Polymerase chain reaction (PCR) analysis using the primer pair 5A (5' GCGGTTGTTCACCAGGTGTTTT 3') and 5B (5' ATGCACGCTACCTGGAAGTAT 3') specific for E. chrysanthemi (4) confirmed the identity of all seven isolates tested as E. chrysanthemi. The primer pair 5A/5B was designed from the sequences of pT8-1, idg (a gene for blue-pigment synthesis), and pecS (a gene for regulation of pectinase, cellulose, and pigment production). PCR products amplified from E. chrysanthemi DNA with the 5A/5B primer were 500 bp (4). Pathogenicity of isolates was confirmed by rubbing the leaf surface of Sithiporn aglaonema plants with Carborundum and spraying the wounded surface with a bacterial suspension at 1 × 108 CFU/ml in the greenhouse. Plant leaves sprayed with distilled water were used as the control. Three leaves were inoculated for each isolate, and the experiment was conducted twice. Symptoms appeared within 24 h after inoculation. All seven isolates tested were pathogenic, causing an average of 86 to 95% of inoculated leaves to show water-soaked symptoms similar to these observed in nature. Symptoms did not occur on control leaves. E. chrysanthemi was reisolated from diseased tissues of inoculated leaves. To our knowledge, this is the first report of bacterial blight caused by E. chrysanthemi on aglaonema in Taiwan and the first report of the disease on the Sithiporn cultivar of aglaonema. This disease on aglaonema was previously reported in the United States (3). References: (1) R. S. Dickey and A. Kelman. Page 44 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. N. W. Schaad, ed. The American Phytopathological Society, St. Paul, MN, 1988. (2) M. Goto and K. Matsumoto. Int. J. Syst. Bacteriol. 37:130, 1987. (3) L. A. McFadden. Plant Dis. Rep. 53:253. 1969. (4) M. G. Zhu. Ph.D. diss, National Chung Hsing University, Taichung, Taiwan, 1995.
RESUMEN
Zamioculcas zamiifolia (Lodd.) Engl., commonly called 'ZZ' plant, is a monocotyledonous plant in the Araceae. It is a new introduction in the foliage plant industry worldwide and is an increasing popular ornamental foliage plant in Taiwan. In 2003, basal petiole rot and death of ZZ plants were found in two nurseries in southern Taiwan with 18% of the plants diseased at one nursery. Early symptoms were water soaking of the petiole base and a slight yellowing of the leaflets followed by browning of leaflets. As the disease progressed, the petiole base became dark brown, shriveled, collapsed, and eventually rotted. The surface of the roots and rhizomes of diseased plants were initially blackish brown followed by root rots and mortality of plants. A Phytophthora species was consistently isolated from diseased petioles, rhizomes, and roots on a selective medium (4). Two single zoospore isolates (2), each from a different nursery, were used for morphological and pathogenicity tests. The isolates were grown on vegetable juice agar (10% V8 juice, 0.02% CaCO3, and 2% agar [VJA]) at 28°C with 12-h irradiation for 10 days. Sporangia were nondeciduous, terminal or intercalary, and attached to irregularly or sympodially branched sporangiophores. Papillate sporangia were spherical to broadly ovoid or obpyriform, averaged 37.3 × 30.2 µm, and ranged from 23 to 55 µm in length by 17 to 46 µm in diameter, with a length/breadth ratio of 1.24 and a range of 1.1 to 1.4. Chlamydospores with walls 1 to 4 µm thick were terminal or intercalary, spherical, averaged 30.6 µm in diameter, and ranged from 18 to 46 µm. On the basis of the morphological characteristics above, Phytophthora nicotianae Breda de Haar. (synonym P. parasitica Dastur) was identified (1). Paired with known A1 and A2 mating types of P. cinnamomi on VJA, both P. nicotianae cultures were A2, forming oospores after 14 days in darkness at 28°C. Disease-free ZZ plants were propagated by rhizomes in 242-cm3 round pots with 500 g of sterilized potting medium (vermiculite/peat moss/perlite = 1:2:1). Plants with 30 cm long petiole were used for inoculation. For the pathogenicity test, both isolates were grown on VJA plates sealed with Parafilm at 28°C in darkness. After 10 days, aerial mycelia with sporangia were scraped off the plates, placed in 10 ml of sterile distilled water at 8°C for 15 min to release zoospores. A zoospore suspension was adjusted to 104 zoospores/ml following enumeration with a microliter pipette (3) and 200 ml of the suspension was added to each pot, or rhizomes and roots were dipped in 400 ml of the suspension for 60 min and planted immediately. Ten plants were inoculated with either method and water was added to inoculated control plants. Water soaking of the petiole bases developed in 7 days and mortality occurred in 10 days in a screenhouse after plants were inoculated with either method. Control plants remained healthy and no petiole, root, or rhizome rots developed. P. nicotianae was isolated from the advancing lesions of the inoculated plants and both experiments were repeated. To our knowledge, this is the first report of basal petiole rot and plant kill of Zamioculcas zamiifolia caused by P. nicotianae. References: (1) D. C. Erwin and O. K. Ribeiro. Phytophthora Diseases Worldwide. The American Phytopathological Society, St. Paul, MN, 1996. (2) W. C. Ho and W. H. Ko. Bot. Bull. Acad. Sin. 38:41, 1997. (3) W. H. Ko et al. Phytopathology 63:1206, 1973. (4) W. H. Ko et al. Trans. Br. Mycol. Soc. 71:496, 1978.
RESUMEN
BACKGROUND AND AIMS: Gastric residual volumes are widely used to evaluate gastric emptying for patients receiving enteral feeding, but controversy exists about what constitutes gastric residual volume. We have developed a method by using refractometer and derived mathematical equations to calculate the formula concentration, total residual volume (TRV), and formula volume. In this study, we like to validate these mathematical equations before they can be implemented for clinical patient care. METHODS: Four dietary formulas were evaluated in two consecutive validation experiments. Firstly, dietary formula volume of 50, 100, 200, and 400 ml were diluted with 50 ml water, and then the Brix value (BV) was measured by the refractometer. Secondly, 50 ml of water, then 100 ml of dietary formula were infused into a beaker, and followed by the BV measurement. After this, 50 ml of water was infused and followed by the second BV measurement. The entire procedure of infusing of dietary formula (100 ml) and waster (50 ml) was repeated twice and followed by the BV measurement. RESULTS: The formula contents (formula concentration, TRV, and formula volume) were calculated by mathematical equations. The calculated formula concentrations, TRVs, and formula volumes measured from mathematic equations were strongly close to the true values in the first and second validation experiments (R2>0.98, P<0.001). CONCLUSIONS: Refractometer and the derived mathematical equations may be used to accurately measure the formula concentration, TRV, and formula volume and served as a tool to monitor gastric emptying for patients receiving enteral feeding.
Asunto(s)
Alimentos Formulados/análisis , Vaciamiento Gástrico/fisiología , Contenido Digestivo/química , Matemática , Refractometría/normas , Nutrición Enteral/métodos , Humanos , Modelos Biológicos , Refractometría/métodos , Reproducibilidad de los Resultados , Sensibilidad y EspecificidadRESUMEN
The primary objective of this study was to investigate the effect of geniposide, a potent anti-inflammatory, on ovalbumin-antigen-induced tracheal permeability and transepithelial electrical resistance in guinea pigs. Two weeks after sensitization with ovalbumin (100 mg/ml), the permeability of guinea-pig tracheas was evaluated by flux measurements using the transcellular tracer, [(14)C]estradiol, and the paracellular tracer, [(14)C]mannitol. The effect of extracellular Ca(2+) with geniposide was also studied, using deletion of Ca(2+) in the donor chamber. The in vivo treatment effect of aerosolized geniposide on tracheal permeability in the ovalbumin-sensitized guinea pigs was also evaluated. The results indicate that tight junction permeability of ovalbumin-sensitized trachea was significantly dose dependent and decreased by geniposide (1-10 mM), as evidenced by substantial recovery of transepithelial electrical resistance and decreased transepithelial permeability of [(14)C]mannitol at (1.32+/-0.12) x 10(-5) cm/s. The effect of combination of the removal of extracellular Ca(2+) with geniposide had no effect on tight junction permeability of ovalbumin-sensitized trachea and revealed that transepithelial electrical resistance and junction permeability did not recover. In addition, the cAMP levels and phosphodiesterase activity were not significantly influenced in ovalbumin-sensitized tracheal tissues after geniposide treatment. Inhaled geniposide (50 mM, 30 min after ovalbumin sensitization) significantly restored junction permeability induced by ovalbumin (100 mg/ml, 2 min). Junction permeability did not recover on pretreatment with geniposide (50 mM for 30 min over 16 days consecutive before ovalbumin sensitization) after exposure of conscious guinea pigs to aerosol ovalbumin. In conclusion, geniposide has inhibitory effects on ovalbumin-induced junction permeability and recovery of transepithelial electrical resistance in guinea pig trachea, showing its potential as anti-asthma therapy.
Asunto(s)
Antiinflamatorios/provisión & distribución , Iridoides , Piranos/administración & dosificación , Tráquea/efectos de los fármacos , Aerosoles , Animales , Calcio/metabolismo , AMP Cíclico/metabolismo , Cobayas , Masculino , Manitol/farmacocinética , Ovalbúmina/inmunología , Permeabilidad , Uniones Estrechas/efectos de los fármacos , Tráquea/metabolismoRESUMEN
A modified tetracycline-responsive expression system (TRES) for use in insect cells was developed. The TRES contains two components: one encodes a tetracycline-controllable transactivator (tTA) and the other contains a tet operator DNA sequence to drive the luciferase gene. Our results show that the human cytomegalovirus (CMV) promoter, an essential part for strong tTA expression in mammalian system, was not functional in insect cells. Thus further modifications were required. Functional tTA was efficiently expressed in Sf9, Sf21, and TN368 cells by the p10 promoter of Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) in plasmid form with virus co-infection. An increase of up to 258-fold of luciferase activity was detected in these cells when both components in modified TRES were co-transfected. In order to further simplify the experiment, tTA, which is driven by the p10 promoter, was inserted into AcMNPV. Luciferase activity was also strongly stimulated by the infection of this tTA expression-recombinant virus with the transfection of a plasmid containing the second TRES component expressing luciferase. The luciferase expressions in these systems, either in plasmids or the tTA gene in virus and luciferase in plasmid, were significantly suppressed by tetracycline. The time course kinetics of tetracycline action to the TRES were further studied. Within a time span of 50 h, the luciferase activities could be fully suppressed or activated, respectively, corresponding to the addition or removal of tetracycline. These experiments have established a well-regulated gene expression system for further broad applications of molecular biological studies in insect cells.
Asunto(s)
Regulación de la Expresión Génica , Spodoptera/genética , Tetraciclina/farmacología , Animales , Citomegalovirus/genética , ADN Recombinante/biosíntesis , Regulación de la Expresión Génica/efectos de los fármacos , Humanos , Luciferasas/genética , Nucleopoliedrovirus/genética , Plásmidos , Regiones Promotoras Genéticas , Proteínas Represoras/biosíntesis , Proteínas Represoras/genética , Elementos de Respuesta/efectos de los fármacos , Spodoptera/citología , Spodoptera/virología , Transactivadores/biosíntesis , Transactivadores/genética , TransfecciónRESUMEN
BACKGROUND & AIMS: Traditional use of gastric residual volumes (GRVs) is insensitive and cannot distinguish retained enteral formula from the large volume of endogenous secretions. We designed this prospective study to determine whether refractometry and Brix value (BV) measurements could be used to monitor gastric emptying and tolerance in patients receiving continuous enteral feeding. METHODS: Thirty-six patients on continuous nasogastric tube feeding were divided into two groups; patients with lower GRVs (<75 ml) in Group 1, patients with higher GRVs (>75 ml) in Group 2. Upon entry, all gastric contents were aspirated, the volume was recorded (Asp GRV), BV measurements were made by refractometry, and then the contents were reinstilled but diluted with 30 ml additional water. Finally, a small amount was reaspirated and repeat BV measurements were made. Three hours later, the entire procedure was repeated a second time. The BV ratio, calculated (Cal) GRV, and volume of formula remaining were calculated by derived equations. RESULTS: Mean BV ratios were significantly higher for those patients in Group 2 compared to those in Group 1. All but one of the 22 patients (95%) in Group 1 had a volume of formula remaining in the stomach estimated on both measurements to be less than the hourly infusion rate (all these patients had BV ratios <70%). In contrast, six of the 14 patients in Group 2 (43%) on both measurements were estimated to have volumes of formula remaining that were greater than the hourly infusion rate (all these patients had BV ratios >70%). Three of the Group 2 patients (21%) whose initial measurement showed evidence for retention of formula, improved on repeat follow-up measurement assuring adequate gastric emptying. The remaining five patients from Group 2 (35%) had a volume of formula remaining that was less than the hourly infusion rate on both measurements. The pattern of Asp GRVs and serial pre- and post-dilution BVs failed to differentiate these patients in Group 2 with potential emptying problems from those with sufficient gastric emptying. CONCLUSIONS: Refractometry and measurement of the BV may improve the clinical utilization of GRVs, by its ability to identify the component of formula within gastric contents and track changes in that component related to gastric emptying.
Asunto(s)
Nutrición Enteral , Vaciamiento Gástrico/fisiología , Contenido Digestivo , Humanos , Intubación Gastrointestinal/métodos , Estudios Prospectivos , Refractometría/métodosRESUMEN
BACKGROUND AND AIMS: Critically ill patients do not always tolerate nasogastric tube feeding. Gastric residual volumes are widely used to evaluate feeding tolerance, but controversy exists about what constitutes the residual volume (diet formula or digestive juice). In this paper, we describe the use of the refractometer as a tool to monitor dietary formula concentration in gastric juice and evaluate gastric juice refractometry as a possible clinical application. METHODS: Brix value (an index of the total solutes in solution) readings for polymeric diet at pH 1, 4, 7 and 8, and at 4 degrees C, 25 degrees C and 37 degrees C, and in fasting gastric juice were determined with a refractometer. RESULTS: We found that distilled water, minerals, and vitamins had low Brix values of 0+/-0, 1.2+/-0.1, and 0.4+/-0.1, respectively. On the other hand, because carbohydrate (17 g/100 ml), protein (5.3 g/100 ml), fat (4.1 g/100 ml), and full-strength polymeric diet had high concentrations of dissolved nutrients, they also had high Brix values (12.1+/-0.6, 6.5+/-0.1, 6.0+/-0.1, and 23.5+/-0.1, respectively). The Brix values of polymeric diet had a linear additive relationship with the diet formula concentration at various pHs, temperatures, and in the gastric juice. CONCLUSION: Brix value measurement can be used to monitor stomach dietary formula concentration. Such information can be obtained at the bedside and used to evaluate feeding-intolerant patients receiving enteral feeding.
Asunto(s)
Cuidados Críticos/métodos , Nutrición Enteral , Alimentos Formulados/análisis , Jugo Gástrico/química , Refractometría/métodos , Enfermedad Crítica , Vaciamiento Gástrico , Jugo Gástrico/metabolismo , Humanos , Concentración de Iones de Hidrógeno , Intubación Gastrointestinal/efectos adversos , TemperaturaRESUMEN
BACKGROUND: The purpose of this study was to demonstrate the effects of extra-carbohydrate supplementation before bedtime on energy metabolism and substrate oxidation in patients with liver cirrhosis. METHODS: Sixteen cirrhotic patients and eight control subjects were included in this study. To compare the effect of energy metabolism and substrate oxidation with or without a bedtime snack, indirect calorimetry was assessed at 7 to 8 AM after overnight fasting, following either dinner (6 PM) or a bedtime snack (11 PM) the evening before. The bedtime snack contained about 50 g of carbohydrate. The energy expenditure and substrate oxidation were calculated from the indirect calorimetry measurement and 24-hour urinary nitrogen excretion. RESULTS: In those who fasted since dinner, the respiratory quotient (RQ) was significantly lower in cirrhotic patients than in control subjects. Also, the energy utilized by cirrhotic patients was derived primarily from fat oxidation (58%), whereas the main energy source for controls was carbohydrate (55%). An extra-carbohydrate supplement before bedtime did not influence the indirect calorimetry measurement in the controls, but there were significant increases in both RQ and carbon dioxide production (Vco2) in cirrhotic patients. The extra-carbohydrate supplementation did not significantly change the absolute resting energy expenditure utilization in control subjects; however, the utilization of carbohydrate significantly increased with a decrease in fat and protein oxidation in the cirrhotic patients. CONCLUSIONS: These preliminary data suggest that extra-carbohydrate supplementation before bedtime can shorten nocturnal fasting with a more economic fuel utilization and effectively diminish fat and protein oxidation in cirrhotic patients.