Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 76
Filtrar
Más filtros

País/Región como asunto
Tipo del documento
Intervalo de año de publicación
1.
Arch Biochem Biophys ; 754: 109896, 2024 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-38417691

RESUMEN

AIMS: The purpose of this study was to explore the role of RAE1 in the invasion and metastasis of gastric cancer (GC) cells. MATERIALS AND METHODS: RAE1 expression in GC cells was determined by reverse-transcription polymerase chain reaction (qRT-PCR) and Western blotting (WB). Cell models featuring RAE1 gene silencing and overexpression were constructed by lentiviral transfection; The proliferation, migration, and invasion ability of cells were detected by cell counting, colony formation assay, would healing assay, and transwell invasion and migration test. WB analysis of ERK/MAPK signaling pathway (ERK1/2, p-ERK1/2, c-Myc) and EMT-related molecules (ZEB1, E-cadherin, N-cadherin, and Vimentin). RESULTS: The expression level of RAE1 in GC was notably higher than in adjacent tissues. Elevated RAE1 expression correlated with an unfavorable prognosis for GC patients. Knockdown of RAE1, as compared to the control group, resulted in a significant inhibition of proliferation, migration, and invasion abilities in GC cell lines. Furthermore, RAE1 knockdown led to a substantial decrease in the expression of N-cadherin, vimentin, ZEB1, p-ERK1/2, and c-Myc proteins, coupled with a marked increase in E-cadherin expression. The biological effects of RAE1 in GC cells were effectively reversed by the inhibition of the ERK/MAPK signaling pathway using SCH772984. Additionally, RAE1 knockdown demonstrated a suppressive effect on GC tumor size in vivo. Immunohistochemistry (IHC) results revealed significantly lower expression of Ki-67 in RAE1 knockout mice compared to the control group. CONCLUSIONS: RAE1 promotes GC cell migration and invasion through the ERK/MAPK pathway and is a potential therapeutic target for GC therapy.


Asunto(s)
Transición Epitelial-Mesenquimal , Neoplasias Gástricas , Animales , Humanos , Ratones , Cadherinas/genética , Cadherinas/metabolismo , Carcinogénesis , Línea Celular Tumoral , Movimiento Celular , Proliferación Celular , Regulación Neoplásica de la Expresión Génica , Invasividad Neoplásica/genética , Proteínas Asociadas a Matriz Nuclear/genética , Proteínas Asociadas a Matriz Nuclear/metabolismo , Proteínas de Transporte Nucleocitoplasmático/genética , Proteínas de Transporte Nucleocitoplasmático/metabolismo , Neoplasias Gástricas/metabolismo , Neoplasias Gástricas/patología , Vimentina/genética , Vimentina/metabolismo
2.
Cereb Cortex ; 33(12): 7771-7782, 2023 06 08.
Artículo en Inglés | MEDLINE | ID: mdl-36935094

RESUMEN

Poststroke aphasia is an acquired language disorder and has been proven to have adverse effects on patients' social skills and quality of life. However, there are some inconsistencies in the neuroimaging studies investigating poststroke aphasia from the perspective of regional alterations. A meta-analysis has been employed to examine the common pattern of abnormal regional spontaneous brain activity in poststroke aphasia in the current study. Specifically, the Anisotropic effect-size version of seed-based d mapping was utilized, and 237 poststroke aphasia patients and 242 healthy controls (HCs) from 12 resting-state functional magnetic resonance imaging studies using amplitude of low-frequency fluctuations (ALFF), fractional ALFF, or regional homogeneity were included. The results showed that compared with HCs, patients with poststroke aphasia demonstrated increased regional spontaneous brain activity in the right insula, right postcentral gyrus, left cerebellar lobule IX, left angular gyrus, right caudate nucleus, left parahippocampal gyrus, and right supplementary motor area, and decreased regional spontaneous brain activity in the left cerebellar lobule VI, left median cingulate and paracingulate gyri, right cerebellar crus I, and left supplementary motor area. The study could provide further evidence for pathophysiological mechanism of poststroke aphasia and help find targets for treatment.


Asunto(s)
Afasia , Calidad de Vida , Humanos , Imagen por Resonancia Magnética/métodos , Encéfalo/diagnóstico por imagen , Afasia/diagnóstico por imagen , Afasia/etiología , Mapeo Encefálico/métodos
3.
Mol Vis ; 29: 234-244, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-38222445

RESUMEN

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.


Asunto(s)
Proteínas del Ojo , Enfermedades Genéticas Ligadas al Cromosoma X , Glicoproteínas de Membrana , Nistagmo Congénito , Humanos , Albinismo Ocular/genética , Albinismo Ocular/diagnóstico , Proteínas del Ojo/genética , Iris , Glicoproteínas de Membrana/genética , Mutación/genética , Nistagmo Congénito/genética , Nistagmo Congénito/diagnóstico , Linaje
4.
BMC Musculoskelet Disord ; 24(1): 444, 2023 Jun 02.
Artículo en Inglés | MEDLINE | ID: mdl-37268885

RESUMEN

BACKGROUND: Type 2 diabetes mellitus (DM2) and osteoporosis (OP) are currently the two most significant causes of mortality and morbidity in older adults, according to clinical evidence. The intrinsic link between them is yet unknown, despite reports of their coexistence. By utilizing the two-sample Mendelian randomization (MR) approach, we sought to evaluate the causal impact of DM2 on OP. METHODS: The aggregate data of the whole gene-wide association study (GWAS) were analyzed. A two-sample MR analysis was performed using single-nucleotide polymorphisms (SNPs), which are strongly associated with DM2, as instrumental variables (IVs) to evaluate the causal analysis of DM2 on OP risk with OR values, using inverse variance weighting, MR-egger regression, and weighted median methods, respectively. RESULT: A total of 38 single nucleotide polymorphisms were included as tool variables. According to the results of inverse variance-weighted (IVW), we found that there was a causal relationship between DM2 and OP, in which DM2 had a protective effect on OP. For each additional case of DM2, there is a 0.15% decrease in the odds of developing OP (OR = 0.9985;95%confidence interval:0.9974,0.9995; P value = 0.0056). There was no evidence that the observed causal effect between DM2 and the risk of OP was affected by genetic pleiotropy (P = 0.299). Using Cochran Q statistics and MR-Egger regression in the IVW approach, the heterogeneity was calculated; P > 0.05 shows that there is a significant amount of heterogeneity. CONCLUSION: A causal link between DM2 and OP was established by MR analysis, which also revealed that DM2 decreased the occurrence of OP.


Asunto(s)
Diabetes Mellitus Tipo 2 , Humanos , Anciano , Diabetes Mellitus Tipo 2/epidemiología , Diabetes Mellitus Tipo 2/genética , Análisis de la Aleatorización Mendeliana , Estudio de Asociación del Genoma Completo , Estudios de Asociación Genética , Polimorfismo de Nucleótido Simple/genética
5.
Neural Plast ; 2022: 1560748, 2022.
Artículo en Inglés | MEDLINE | ID: mdl-35356364

RESUMEN

Purpose: Several functional magnetic resonance imaging (fMRI) studies have investigated the resting-state functional connectivity (rs-FC) changes in the primary motor cortex (M1) in patients with acute basal ganglia ischemic stroke (BGIS). However, the frequency-specific FC changes of M1 in acute BGIS patients are still unclear. Our study was aimed at exploring the altered FC of M1 in three frequency bands and the potential features as biomarkers for the identification by using a support vector machine (SVM). Methods: We included 28 acute BGIS patients and 42 healthy controls (HCs). Seed-based FC of two regions of interest (ROI, bilateral M1s) were calculated in conventional, slow-5, and slow-4 frequency bands. The abnormal voxel-wise FC values were defined as the features for SVM in different frequency bands. Results: In the ipsilesional M1, the acute BGIS patients exhibited decreased FC with the right lingual gyrus in the conventional and slow-4 frequency band. Besides, the acute BGIS patients showed increased FC with the right medial superior frontal gyrus (SFGmed) in the conventional and slow-5 frequency band and decreased FC with the left lingual gyrus in the slow-5 frequency band. In the contralesional M1, the BGIS patients showed lower FC with the right SFGmed in the conventional frequency band. The higher FC values with the right lingual gyrus and left SFGmed were detected in the slow-4 frequency band. In the slow-5 frequency band, the BGIS patients showed decreased FC with the left calcarine sulcus. SVM results showed that the combined features (slow-4+slow-5) had the highest accuracy in classification prediction of acute BGIS patients, with an area under curve (AUC) of 0.86. Conclusion: Acute BGIS patients had frequency-specific alterations in FC; SVM is a promising method for exploring these frequency-dependent FC alterations. The abnormal brain regions might be potential targets for future researchers in the rehabilitation and treatment of stroke patients.


Asunto(s)
Accidente Cerebrovascular Isquémico , Ganglios Basales/diagnóstico por imagen , Mapeo Encefálico/métodos , Humanos , Accidente Cerebrovascular Isquémico/diagnóstico por imagen , Aprendizaje Automático , Imagen por Resonancia Magnética/métodos
6.
Neural Plast ; 2022: 4106131, 2022.
Artículo en Inglés | MEDLINE | ID: mdl-35111218

RESUMEN

Objective: The purpose of this study was to investigate the characteristics of different frequency bands in the spontaneous brain activity among patients with acute basal ganglia ischemic stroke (BGIS). Methods: In the present study, thirty-four patients with acute BGIS and forty-four healthy controls were examined by resting-state functional magnetic resonance imaging (rs-fMRI) from May 2019 to December 2020. Two amplitude methods including amplitude of low-frequency fluctuations (ALFF) and fractional ALFF (fALFF) calculated in three frequency bands (conventional frequency band: 0.01-0.08 Hz; slow-5 frequency band: 0.01-0.027 Hz; and slow-4 frequency band: 0.027-0.073 Hz) were conducted to evaluate the spontaneous brain activity in patients with acute BGIS and healthy controls (HCs). Gaussian Random Field Theory (GRF, voxel p < 0.01 and cluster p < 0.05) correction was applied. The correlation analyses were performed between clinical scores and altered metrics values. Results: Compared to HCs, patients with acute BGIS showed decreased ALFF in the right supramarginal gyrus (SMG) in the conventional and slow-4 bands, increased fALFF in the right middle frontal gyrus (MFG) in the conventional and slow-4 bands, and increased fALFF in the bilateral caudate in the slow-5 frequency band. The fALFF value of the right caudate in the slow-5 frequency band was negatively correlated with the clinical scores. Conclusion: In conclusion, this study showed the alterations in ALFF and fALFF in three frequency bands between patients with acute BGIS and HCs. The results reflected that the abnormal LFO amplitude might be related with different frequency bands and promoted our understanding of pathophysiological mechanism in acute BGIS.


Asunto(s)
Enfermedades de los Ganglios Basales/fisiopatología , Encéfalo/fisiopatología , Accidente Cerebrovascular Isquémico/fisiopatología , Adulto , Anciano , Enfermedades de los Ganglios Basales/diagnóstico por imagen , Encéfalo/diagnóstico por imagen , Femenino , Humanos , Accidente Cerebrovascular Isquémico/diagnóstico por imagen , Imagen por Resonancia Magnética , Masculino , Persona de Mediana Edad
7.
Opt Express ; 28(8): 11227-11236, 2020 Apr 13.
Artículo en Inglés | MEDLINE | ID: mdl-32403637

RESUMEN

Simultaneous multipolarization and high-resolution oxygen A-band spectrometer (SPHABS) is proposed. The astigmatism correction theory is used to separate beams from different fields of view and make it possible to obtain multiple polarization information simultaneously. SPHABS' design and the basic principle of SPHABS and the astigmatism correction theory are elaborated in detail. The ray-tracing results of the model showed that the resolution reached 0.016 nm and information from four fields of view could be obtained simultaneously on the image surface.

8.
Langmuir ; 36(46): 13833-13842, 2020 11 24.
Artículo en Inglés | MEDLINE | ID: mdl-33190504

RESUMEN

Hollow siloxane-based nanoparticles (HSNs) have attracted significant attention because of their promising unique properties for various applications. For advanced applications, especially in catalysis, drug delivery systems, and smart coatings, high dispersibility and monodispersity of HSNs with precisely controlled shell structures are important. In this study, we established a simple method for preparing colloidal HSNs with a uniform particle size below 50 nm by the reaction of colloidal silica nanoparticles with bridged organoalkoxysilane [1,2-bis(triethoxysilyl)ethylene: (EtO)3Si-C2H2-Si(OEt)3, BTEE] in the presence of a cationic surfactant. Upon the formation of organosiloxane shells by hydrolysis and polycondensation of BTEE, the core silica nanoparticles were spontaneously dissolved, and a part of the silicate species was incorporated into the organosiloxane shells. The size of the colloidal silica nanoparticles, the amount of BTEE added, and the pH of the reaction mixture greatly affected the formation of HSNs. Importantly, colloidal HSNs having micropores and mesopores in the shells were successfully prepared using silica nanoparticles (20, 30, and 40 nm in diameter) at pH values of 9 and 11, respectively. These HSNs are potentially important for applications in drug delivery systems and catalysis.

9.
Biol Lett ; 12(1): 20150925, 2016 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-26740568

RESUMEN

There is increasing recognition of the importance of niche optima in the shift of plant-plant interactions along environmental stress gradients. Here, we investigate whether deviation from niche optima would affect the outcome of plant-plant interactions along a soil acidity gradient (pH = 3.1, 4.1, 5.5 and 6.1) in a pot experiment. We used the acid-tolerant species Lespedeza formosa Koehne as the neighbouring plant and the acid-tolerant species Indigofera pseudotinctoria Mats. or acid-sensitive species Medicago sativa L. as the target plants. Biomass was used to determine the optimal pH and to calculate the relative interaction index (RII). We found that the relationships between RII and the deviation of soil pH from the target's optimal pH were linear for both target species. Both targets were increasingly promoted by the neighbour as pH values deviated from their optima; neighbours benefitted target plants by promoting soil symbiotic arbuscular mycorrhizal fungi, increasing soil organic matter or reducing soil exchangeable aluminium. Our results suggest that the shape of the curve describing the relationship between soil pH and facilitation/competition depends on the soil pH optima of the particular species.


Asunto(s)
Fabaceae/fisiología , Suelo/química , Aluminio/química , Biomasa , Ecosistema , Fabaceae/crecimiento & desarrollo , Concentración de Iones de Hidrógeno , Micorrizas/crecimiento & desarrollo
10.
Int Ophthalmol ; 35(6): 777-83, 2015 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-25586624

RESUMEN

The purpose of this study was to assess the long-term outcome of patients with symptomatic bullous keratopathy after amniotic membrane transplant. A retrospective cohort study includes that 20 patients with symptomatic bullous keratopathy, who have underwent amniotic membrane transplant at the Department of Ophthalmology & Visual Sciences, The Chinese University of Hong Kong, Prince of Wales Hospital & Alice Ho Miu Ling Hospital, Hong Kong between 04/1998 and 06/2011, were invited back. Clinical examination was performed, including, pain score assessment (pain score out of 10), epithelial healing, and vision. A total of 21 eyes of 20 patients returned for our study. The majority of eyes experienced pain reduction (94 %), with a significant mean pain score difference of 6.8 ± 2.6, 2-tail p < 0.001 (99 % CI 4.9-8.7). The mean pre-operative and post-operative pain scores were 7.3 ± 2.9 and 0.5 ± 1.0, respectively. 16 eyes (76 %) were completely pain free, and 10 eyes (47 %) remained symptom free after a mean follow-up of 39.0 ± 36.3 months (range 5-171 months). The median epithelial healing time was 2 weeks (range 1-20 weeks). Amniotic membrane transplant may be considered as a longer-term treatment for bullous keratopathy patients, especially in patients with poorer visual prognosis, but it may also be used as an interim measure for patients awaiting corneal transplant.


Asunto(s)
Amnios/trasplante , Enfermedades de la Córnea/cirugía , Queratoplastia Penetrante/métodos , Anciano , Anciano de 80 o más Años , Vesícula/cirugía , Enfermedades de la Córnea/fisiopatología , Epitelio Corneal/patología , Femenino , Hong Kong , Humanos , Masculino , Persona de Mediana Edad , Dolor Postoperatorio , Estudios Retrospectivos , Agudeza Visual/fisiología
11.
Hormones (Athens) ; 2024 Jun 11.
Artículo en Inglés | MEDLINE | ID: mdl-38861108

RESUMEN

BACKGROUND: The cardiometabolic index (CMI) is a new type of obesity index that is based on a combination of lipid levels and abdominal obesity indicators. It is closely correlated with the occurrence of diabetes mellitus, atherosclerosis, hypertension, and other diseases, thus playing an important role in the screening of metabolic diseases. This is coupled with hepatic steatosis and fibrosis which are characterized by excessive liver fat deposition. The aim of this study was to investigate the possible association between CMI and hepatic steatosis and liver fibrosis. METHODS: A cross-sectional investigation was conducted using the 2017-2020 National Health and Nutrition Examination Survey (NHANES) dataset to probe the relationship between CMI and hepatic steatosis and liver fibrosis, while multiple linear regression models were used to test the linear association between CMI and controlled attenuation parameter (CAP) and liver stiffness measurement (LSM). Smooth-fit curves and threshold effects analysis were used to describe the nonlinear relationships. Subgroup analyses were performed according to gender, age, body mass index (BMI), hypertension, diabetes, cardiovascular disease, and smoking status. RESULTS: A total of 3084 adults aged 18-80 years were included in this analysis, and after controlling for a variety of variables, there was a significant positive correlation between CMI and CAP [20.38 (16.27,24.49)]. When subgroups were analyzed, this positive correlation was found to be stronger in the female population than in the male (P for interaction = 0.0303). Furthermore, the association between CMI and CAP was nonlinear. Using multiple regression analysis, it was shown that the linear relationship between CMI and liver fibrosis was not significant [-0.09 (-0.47,0.29)]. CONCLUSIONS: The findings suggest that elevated CMI levels are associated with hepatic steatosis, but that CMI is not linked to liver fibrosis. Larger prospective investigations are needed to confirm our findings.

12.
J Affect Disord ; 348: 259-264, 2024 03 01.
Artículo en Inglés | MEDLINE | ID: mdl-38171182

RESUMEN

BACKGROUND AND AIM: Depression is a common and complex psychiatric disorder, and lipid metabolism plays an important role in the development of psychiatric disorders such as depression. Cardiometabolic index (CMI) is a novel index that synthesizes two quantitative indicators of blood lipids (triglyceride(TG)/high-density lipoprotein cholesterol (HDL-C)) and human obesity-related parameters (waist height ratio (WHtR)). This study used NHANES data to explore the correlation between CMI and the incidence of depression. METHODS AND RESULTS: Based on the data of the National Health and Nutrition Examination Survey (NHANES) 2011-2018, multivariate logistic regression, sensitivity analysis, and smooth curve fitting were used to study the relationship between CMI and depression. Subgroup analysis and interaction tests were used to investigate whether the association was stable in different populations. CMI was positively associated with depression in 7229 participants aged >20 years. In the fully adjusted model, each unit increase in CMI was associated with 36 % higher likelihood of depression symptoms [1.36(1.16,1.59)]. Participants in the highest quartile of CMI had a 62 % higher risk of depression than participants in the lowest quartile [1.62(1.17,2.23)]. This positive correlation was more pronounced in those with hypertension. CONCLUSIONS: CMI was associated with a higher PHQ-9 score and an increased likelihood of depression among US adults. Further large-scale prospective studies are still need to analyze the role of CMI in depression.


Asunto(s)
Depresión , Hipertensión , Adulto , Humanos , Encuestas Nutricionales , Estudios Prospectivos , Depresión/epidemiología , Obesidad/epidemiología , Hipertensión/epidemiología , Factores de Riesgo
13.
Medicine (Baltimore) ; 103(37): e39421, 2024 Sep 13.
Artículo en Inglés | MEDLINE | ID: mdl-39287270

RESUMEN

OBJECTIVE: To evaluate the effect of diagnosis-related group (DRG) payment method systematically before and after implementation in terms of average hospitalization day, cost and care quality. METHOD: Restricted the period from 2019 to May 31, 2023, we use 6 databases from CNKI, Wipu, Wanfang, PubMed, ScienceDirect, and web of science. With the related study, we extract the data about DRG, then we conducted meta-analysis of the data about length of stay (LOS) and cost by RevMan 5.4 and Stata 12.0 software. Care quality is in conjunction with literature reports. RESULT: About 24 articles were included, covering 2 indicators: average hospitalization expenses and days. Meta-analysis shows that implementing DRG payment method has an advantage in terms of average hospital stay (pooled effect: -1.13%, 95% CI: -1.42 to -0.84, P = .00), and the difference is statistically significant. There is also an advantage in average hospitalization expenses (pooled effect: -2.58, 95% CI: -3.38 to -1.79, P = .00), and the difference is statistically significant. CONCLUSION: The use of DRG payment method can effectively reduce LOS and average hospitalization expenses. However, quality of care may decline with DRG adoption.


Asunto(s)
Grupos Diagnósticos Relacionados , Hospitalización , Tiempo de Internación , Humanos , Tiempo de Internación/economía , Tiempo de Internación/estadística & datos numéricos , Grupos Diagnósticos Relacionados/economía , Hospitalización/economía , Hospitalización/estadística & datos numéricos , Control de Costos/métodos , Costos de Hospital/estadística & datos numéricos , Calidad de la Atención de Salud/economía
14.
Regen Ther ; 27: 244-250, 2024 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-38586873

RESUMEN

Platelet-rich plasma (PRP) has the capability of assisting in the recovery of damaged tissues by releasing a variety of biologically active factors to initiate a hemostatic cascade reaction and promote the synthesis of new connective tissue and revascularization. It is now widely used for tissue engineering repair. In addition, PRP has demonstrated nerve repair and pain relief, and has been studied and applied to the facial nerve, median nerve, sciatic nerve, and central nerve. These suggest that PRP injection therapy has a positive effect on nerve repair. This indicates that PRP has high clinical value and potential application in nerve repair. It is worthwhile for scientists and medical workers to further explore and study PRP to expand its application in nerve repair, and to provide a more reliable scientific basis for the opening of a new approach to nerve repair.

15.
J Cancer Res Clin Oncol ; 150(5): 230, 2024 May 04.
Artículo en Inglés | MEDLINE | ID: mdl-38703300

RESUMEN

OBJECTIVES: Gastric cancer (GC) is a prevalent malignant tumor widely distributed globally, exhibiting elevated incidence and fatality rates. The gene LAMC2 encodes the laminin subunit gamma-2 chain and is found specifically in the basement membrane of epithelial cells. Its expression is aberrant in multiple types of malignant tumors. This research elucidated a link between LAMC2 and the clinical characteristics of GC and investigated the potential involvement of LAMC2 in GC proliferation and advancement. MATERIALS AND METHODS: LAMC2 expressions were detected in GC cell lines and normal gastric epithelial cell lines via qRT-PCR. Silencing and overexpression of the LAMC2 were conducted by lentiviral transfection. A xenograft mouse model was also developed for in vivo analysis. Cell functional assays were conducted to elucidate the involvement of LAMC2 in cell growth, migration, and penetration. Further, immunoblotting was conducted to investigate the impact of LAMC2 on the activation of signal pathways after lentiviral transfection. RESULTS: In the findings, LAMC2 expression was markedly upregulated in GC cell lines as opposed to normal gastric epithelial cells. In vitro analysis showed that sh-LAMC2 substantially inhibited GC cell growth, migration, and invasion, while oe-LAMC2 displayed a contrasting effect. Xenograft tumor models demonstrated that oe-LAMC2 accelerated tumor growth via high expression of Ki-67. Immunoblotting analysis revealed a substantial decrease in various signaling pathway proteins, PI3K, p-Akt, and Vimentin levels upon LAMC2 knockdown, followed by increased E-cadherin expression. Conversely, its overexpression exhibited contrasting effects. Besides, epithelial-mesenchymal transition (EMT) was accelerated by LAMC2. CONCLUSION: This study provides evidence indicating that LAMC2, by stimulating signaling pathways, facilitated EMT and stimulated the progression of GC cells in laboratory settings and mouse models. Research also explored that the abnormal LAMC2 expression acts as a biomarker for GC.


Asunto(s)
Proliferación Celular , Laminina , Invasividad Neoplásica , Fosfatidilinositol 3-Quinasas , Proteínas Proto-Oncogénicas c-akt , Transducción de Señal , Neoplasias Gástricas , Neoplasias Gástricas/patología , Neoplasias Gástricas/genética , Neoplasias Gástricas/metabolismo , Humanos , Animales , Proteínas Proto-Oncogénicas c-akt/metabolismo , Fosfatidilinositol 3-Quinasas/metabolismo , Ratones , Laminina/metabolismo , Línea Celular Tumoral , Ratones Desnudos , Transición Epitelial-Mesenquimal , Movimiento Celular , Femenino , Masculino , Ratones Endogámicos BALB C , Metástasis de la Neoplasia , Ensayos Antitumor por Modelo de Xenoinjerto , Regulación Neoplásica de la Expresión Génica
16.
J Colloid Interface Sci ; 659: 320-329, 2024 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-38176241

RESUMEN

The efficacy of imaging-guided photodynamic therapy (PDT) is compromised by the attenuation of fluorescence and decline in reactive oxygen species (ROS) generation efficiency in the physiological environment of conventional photosensitizers, limited near-infrared (NIR) absorption, and high systemic cytotoxicity. This paper presents the synthesis of two cyclometalated Ir (III) complexes (Ir-thpy and Ir-ppy) by using a triphenylamine derivative (DPTPA) as the primary ligand and their encapsulation into an amphiphilic phospholipid to form nanoparticles (NPs). These complexes exhibit aggregation-induced emission features and remarkably enhanced ROS generation compared to Chlorin e6 (Ce6). Moreover, Ir-thpy NPs possess the unique ability to selectively target mitochondria, leading to depolarization of the mitochondrial membrane potential and ultimately triggering apoptosis. Notably, Ir-thpy NPs exhibit exceptional photocytotoxicity even towards cisplatin-resistant A549/DDP tumor cells. In vivo two-photon imaging verified the robust tumor-targeting efficacy of Ir-thpy NPs. The in vivo results unequivocally demonstrate that Ir-thpy NPs exhibit excellent tumor ablation along with remarkable biocompatibility. This study presents a promising approach for the development of multifunctional Ir-NPs for two-photon imaging-guided PDT and provides novel insights for potential clinical applications in oncology.


Asunto(s)
Nanopartículas , Fotoquimioterapia , Iridio/farmacología , Especies Reactivas de Oxígeno , Fotoquimioterapia/métodos , Fármacos Fotosensibilizantes/farmacología , Mitocondrias , Línea Celular Tumoral
17.
Front Med (Lausanne) ; 11: 1343281, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-38439898

RESUMEN

Purpose: Sepsis-induced cardiomyopathy (SIC) is a major life-threatening condition in critically infected patients. Early diagnosis and intervention are important to improve patient prognosis. Recognizing the pivotal involvement of the glycolytic pathway in SIC, this study aims to establish a glycolysis-related ceRNA network and explore novel diagnostic avenues. Materials and methods: SIC-related datasets were carefully filtered from the GEO database. CytoHubba was used to identify differentially expressed genes (DEGs) associated with glycolysis. A predictive method was then used to construct an lncRNA-miRNA-mRNA network. Dual-luciferase reporter assays validated gene interactions, and the specificity of this ceRNA network was confirmed in peripheral blood mononuclear cells (PBMCs) from SIC patients. Logistic analysis was used to examine the correlation between the ceRNA network and SIC. Diagnostic potential was assessed using receiver operating characteristic (ROC) curves, and correlation analysis investigated any associations between gene expression and clinical indicators. Results: IER3 was identified as glycolysis-related DEG in SIC, and a ceRNA network (SNHG17/miR-214-3p/IER3) was established by prediction. Dual luciferase reporter gene assay confirmed the presence of mutual binding between IER3, miR-214-3p and SNHG17. RT-qPCR verified the specific expression of this ceRNA network in SIC patients. Multivariate logistic analysis established the correlation between the ceRNA network and SIC. ROC analysis demonstrated its high diagnostic specificity (AUC > 0.8). Correlation analysis revealed a negative association between IER3 expression and oxygenation index in SIC patients (p < 0.05). Furthermore, miR-214-3p expression showed a negative correlation with NT-proBNP (p < 0.05). Conclusion: In this study, we identified and validated a ceRNA network associated with glycolysis in SIC: SNHG17/miR-214-3p/IER3. This ceRNA network may play a critical role in the onset and development of SIC. This finding is important to further our understanding of the pathophysiological mechanisms underlying SIC and to explore potential diagnostic and therapeutic targets for SIC.

18.
Nat Plants ; 10(9): 1317-1329, 2024 09.
Artículo en Inglés | MEDLINE | ID: mdl-39179701

RESUMEN

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is crucial for profiling histone modifications and transcription factor binding throughout the genome. However, its application in economically important plant organs (EIPOs) such as seeds, fruits and flowers is challenging due to their sturdy cell walls and complex constituents. Here we present advanced ChIP (aChIP), an optimized method that efficiently isolates chromatin from plant tissues while simultaneously removing cell walls and cellular constituents. aChIP precisely profiles histone modifications in all 14 tested EIPOs and identifies transcription factor and chromatin-modifying enzyme binding sites. In addition, aChIP enhances ChIP efficiency, revealing numerous novel modified sites compared with previous methods in vegetative tissues. aChIP reveals the histone modification landscape for rapeseed dry seeds, highlighting the intricate roles of chromatin dynamics during seed dormancy and germination. Altogether, aChIP is a powerful, efficient and sensitive approach for comprehensive chromatin profiling in virtually all plant tissues, especially in EIPOs.


Asunto(s)
Secuenciación de Inmunoprecipitación de Cromatina , Secuenciación de Inmunoprecipitación de Cromatina/métodos , Semillas/genética , Cromatina/metabolismo , Cromatina/genética , Frutas/genética , Inmunoprecipitación de Cromatina/métodos , Flores/genética , Código de Histonas
19.
ACS Appl Mater Interfaces ; 16(8): 9816-9825, 2024 Feb 28.
Artículo en Inglés | MEDLINE | ID: mdl-38381128

RESUMEN

Imaging-guided photodynamic therapy (PDT) holds great potential for tumor therapy. However, achieving the synergistic enhancement of the reactive oxygen species (ROS) generation efficiency and fluorescence emission of photosensitizers (PSs) remains a challenge, resulting in suboptimal image guidance and theranostic efficacy. The hypoxic tumor microenvironment also hinders the efficacy of PDT. Herein, we propose a "two-stage rocket-propelled" photosensitive system for tumor cell ablation. This system utilizes MitoS, a mitochondria-targeted PS, to ablate tumor cells. Importantly, MitoS can react with HClO to generate a more efficient PS, MitoSO, with a significantly improved fluorescence quantum yield. Both MitoS and MitoSO exhibit less O2-dependent type I ROS generation capability, inducing apoptosis and ferroptosis. In vivo PDT results confirm that this mitochondrial-specific type I-II cascade phototherapeutic strategy is a potent intervention for tumor downstaging. This study not only sheds light on the correlation between the PS structure and the ROS generation pathway but also proposes a novel and effective strategy for tumor downstaging intervention.


Asunto(s)
Neoplasias , Fotoquimioterapia , Humanos , Fármacos Fotosensibilizantes/farmacología , Fármacos Fotosensibilizantes/uso terapéutico , Fármacos Fotosensibilizantes/química , Fotoquimioterapia/métodos , Medicina de Precisión , Especies Reactivas de Oxígeno/metabolismo , Neoplasias/diagnóstico por imagen , Neoplasias/tratamiento farmacológico , Mitocondrias/metabolismo , Línea Celular Tumoral , Nanomedicina Teranóstica/métodos , Microambiente Tumoral
20.
Heliyon ; 10(4): e26198, 2024 Feb 29.
Artículo en Inglés | MEDLINE | ID: mdl-38404781

RESUMEN

Characterized by severe deficits in communication, most individuals with autism spectrum conditions (ASC) experience significant language dysfunctions, thereby impacting their overall quality of life. Wernicke's area, a classical and traditional brain region associated with language processing, plays a substantial role in the manifestation of language impairments. The current study carried out a mega-analysis to attain a comprehensive understanding of the neural mechanisms underpinning ASC, particularly in the context of language processing. The study employed the Autism Brain Image Data Exchange (ABIDE) dataset, which encompasses data from 443 typically developing (TD) individuals and 362 individuals with ASC. The objective was to detect abnormal functional connectivity (FC) between Wernicke's area and other language-related functional regions, and identify frequency-specific altered FC using Wernicke's area as the seed region in ASC. The findings revealed that increased FC in individuals with ASC has frequency-specific characteristics. Further, in the conventional frequency band (0.01-0.08 Hz), individuals with ASC exhibited increased FC between Wernicke's area and the right thalamus compared with TD individuals. In the slow-5 frequency band (0.01-0.027 Hz), increased FC values were observed in the left cerebellum Crus II and the right lenticular nucleus, pallidum. These results provide novel insights into the potential neural mechanisms underlying communication deficits in ASC from the perspective of language impairments.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA