Identification of Viruses Infecting Phalaenopsis Orchids Using Nanopore Sequencing and Development of an RT-RPA-CRISPR/Cas12a for Rapid Visual Detection of Nerine Latent Virus.

Phalaenopsis orchids are one of the most popular ornamental plants. More than thirty orchid viruses have been reported, and virus-infected Phalaenopsis orchids significantly lose their commercial value. Therefore, the development of improved viral disease detection methods could be useful for quality control in orchid cultivation. In this study, we first utilized the MinION, a portable sequencing device based on Oxford Nanopore Technologies (ONT) to rapidly detect plant viruses in Phalaenopsis orchids. Nanopore sequencing revealed the presence of three plant viruses in Phalaenopsis orchids: odontoglossum ringspot virus, cymbidium mosaic virus, and nerine latent virus (NeLV). Furthermore, for the first time, we detected NeLV infection in Phalaenopsis orchids using nanopore sequencing and developed the reverse transcription-recombinase polymerase amplification (RT-RPA)-CRISPR/Cas12a method for rapid, instrument-flexible, and accurate diagnosis. The developed RT-RPA-CRISPR/Cas12a technique can confirm NeLV infection in less than 20 min and exhibits no cross-reactivity with other viruses. To determine the sensitivity of RT-RPA-CRISPR/Cas12a for NeLV, we compared it with RT-PCR using serially diluted transcripts and found a detection limit of 10 zg/µL, which is approximately 1000-fold more sensitive. Taken together, the ONT platform offers an efficient strategy for monitoring plant viral pathogens, and the RT-RPA-CRISPR/Cas12a method has great potential as a useful tool for the rapid and sensitive diagnosis of NeLV.

Identification of an Isolate of Citrus Tristeza Virus by Nanopore Sequencing in Korea and Development of a CRISPR/Cas12a-based Assay for Rapid Visual Detection of the Virus.

Citrus tristeza virus (CTV) is a highly destructive viral pathogen posing a significant threat to citrus crops worldwide. The disease management and crop protection strategies necessitate the development of rapid and accurate detection methods. In this study, we employed Oxford Nanopore sequencing (ONT) to detect CTV in Citrus unshiu samples. Subsequently, we developed a specific and sensitive detection assay combining CRISPR/Cas12a with reverse transcription-recombinase polymerase amplification. The CRISPR-Cas12a assay exhibited exceptional specificity for CTV, surpassing conventional RT-PCR by at least 10-fold in sensitivity. Remarkably, the developed assay detected CTV in field samples, with zero false negatives. This diagnostic approach is user-friendly, cost-effective, and offers tremendous potential for rapid on-site detection of CTV. Therefore, the CRISPR-Cas12a assay plays a significant role in managing and preserving citrus trees that are free from viruses in the industry.

First report of dasheen mosaic virus infecting calla lilies in South Korea.

In April 2022, leaves showing virus-like symptoms including mosaic, feathery chlorotic mottle and distortions were observed on calla lilies (Zantedeschia sp.) growing in a greenhouse in Jeolla province, South Korea. Leaf samples from nine symptomatic plants from the same greenhouse were collected and tested for Zantedeschia mosaic virus (ZaMV), Zantedeschia mild mosaic virus (ZaMMV) and Dasheen mosaic virus (DaMV) by reverse transcription-polymerase chain reaction (RT-PCR) with specific primers, ZaMV-F/R (Wei et al. 2008), ZaMMV-F/R (5'-GACGATCAGCAACAGCAGCAACAGCAGAAG-3'/5'-CTGCAAGGCTGAGATCCCGAGTAGCGAGTG-3') and DsMV-CPF/CPR, respectively. In previous surveys, ZaMV and ZaMMV were detected in calla lily fields in South Korea. Of 9 symptomatic samples, 8 were positive for ZaMV and ZaMMV but no PCR product was obtained from the ninth sample, which showed a yellow feather-like pattern. To identify the causal virus, total RNA from a leaf sample of the symptomatic calla lily was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and analyzed by high-throughput sequencing. Ribosomal RNA was removed and a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Plants) and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 150 nt paired end reads. De novo assembly of the 88,171,036 reads was performed using Trinity software (r20140717) while the 113,140 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. One contig of 10,007 bp (GenBank LC723667) shared 79.89-87.08% nucleotide (nt) identities to the available genomes of other DsMV isolates including Colocasia esculenta isolates Et5 (MG602227, 87.08%; Ethiopia) and CTCRI-II-14 (KT026108, 85.32%; India), and a calla lily isolate (AJ298033, 84.95%; China). No contigs representing other plant viruses were identified. To confirm the presence of DsMV, and because the virus was not detected using DsMV-CPF/CPR, RT-PCR was performed using new virus-specific primers DsMV-F/R (5'-GATGTCAACGCTGGCACCAGT-3'/5'-CAACCTAGTAGTAACGTTGGAGA-3'), designed based on the contig sequence. PCR products of the expected 600 bp were obtained from the symptomatic plant, cloned into the pGEM-T Easy Vector (Promega, USA), and two independent clones were bidirectionally sequenced (BIONEER, Korea), and shown to be identical. The sequence was deposited in GenBank as acc. no. LC723766, and shared 100% nt identity to the full-length contig LC723667, and 91.83% identity to the Chinese calla lily DsMV isolate (AJ298033). DsMV, a member of the genus Potyvitus in the family Potyviridae, is one of the major viruses infecting taro in South Korea, showing mosaic and chlorotic feathering symptoms (Kim et al. 2004); however, there is no record in the literature of the identification of this virus in South Korea in ornamental species including calla lily. To survey the sanitary status of other calla lilies, 95 samples with or without symptoms were collected from other regions and subjected to RT-PCR detection for DsMV. Ten of these samples were positive with primers DsMV-F/R, including seven mixed infections (DsMV+ZaMV or DsMV+ZaMV+ZaMMV). To our knowledge, this is the first report of DsMV infecting calla lilies in South Korea. The virus is easily spread by vegetative propagation (Babu et al. 2011) and by aphids (Reyes et al. 2006). This study will help the management of viral diseases on calla lilies in South Korea.

Development and application of reverse transcription droplet digital PCR assay for sensitive detection of apple scar skin viroid during in vitro propagation of apple plantlets.

Apple scar skin viroid (ASSVd), of the genus Apscaviroid, causes serious pome fruit diseases, such as apple scar skin, dapple apple, pear rusty skin, pear fruit crinkle, and pear dimple fruit. This study aimed at establishing a sensitive and accurate method for quantification of ASSVd in apple leaves and plantlets using a reverse transcription droplet digital polymerase chain reaction (RT-ddPCR) assay. The specificity was analyzed using other apple viruses, and the negative amplification of the cross-reaction assay demonstrated the high specificity of RT-ddPCR. The detection limit of ASSVd by RT-ddPCR was 1.75 × 102 copies/µL (0.14 concentration), and the sensitivity was ten-fold higher than that of RT-qPCR. Similarly, positive detection in apple plantlet samples by RT-ddPCR was higher than that by RT-qPCR. The RT-ddPCR assay represents a promising alternative for accurate quantitative detection and diagnosis of ASSVd infection in ASSVd-free certification programs.

Construction of full-length infectious cDNA clones of two Korean isolates of turnip mosaic virus breaking resistance in Brassica napus.

In this work, two new turnip mosaic virus (TuMV) strains (Canola-12 and Canola-14) overcoming resistance in canola (Brassica napus) were isolated from a B. napus sample that showed typical TuMV-like symptoms and was collected in the city of Gimcheon, South Korea, in 2020. The complete genome sequence was determined and an infectious clone was made for each isolate. Phylogenetic analysis indicated that the strains isolated from canola belonged to the World-B group. Both infectious clones, which used 35S and T7 promoters to drive expression, induced systemic symptoms in Nicotiana benthamiana and B. napus. To our knowledge, this is the first report of TuMV infecting B. napus in South Korea.

Construction of full-length infectious clones of turnip mosaic virus isolates infecting Perilla frutescens and genetic analysis of recently emerged strains in Korea.

Perilla is an annual herb with a unique aroma and taste that has been cultivated in Korea for hundreds of years. It has been widely cultivated in many Asian and European countries as a food and medicinal crop. Recently, several viruses have been reported to cause diseases in perilla in Korea, including turnip mosaic virus (TuMV), which is known as a brassica pathogen due to its significant damage to brassica crops. In this study, we determined the complete genome sequences of two new TuMV isolates originating from perilla in Korea. Full-length infectious cDNA clones of these two isolates were constructed, and their infectivity was tested by agroinfiltration of Nicotiana benthamiana and sap inoculation of Chinese cabbage and radish plants. In addition, we analyzed the phylogenetic relationship of six new Korean TuMV isolates to members of the four major groups. We also used RDP4 software to conduct recombination analysis of recent isolates from Korea, which provided new insight into the evolutionary relationships of Korean isolates of TuMV.

Reassortment of Infectious Clones of Radish Mosaic Virus Shows that Systemic Necrosis in Nicotiana benthamiana Is Determined by RNA1.

Three infectious clones of radish mosaic virus (RaMV) were generated from isolates collected in mainland Korea (RaMV-Gg) and Jeju Island (RaMV-Aa and RaMV-Bb). These isolates differed in sequences and pathogenicity. Examination of the wild-type isolates and reassortants between the genomic RNA1 and RNA2 of these three isolates revealed that severe symptoms were associated with RNA1 of isolates Aa or Gg causing systemic necrosis in Nicotiana benthamiana, or with RNA1 of isolate Bb for induction of veinal necrosis and severe mosaic symptoms in radish. Reverse transcription, followed by quantitative real-time PCR (Q-RT-PCR), results from infected N. benthamiana confirmed that viral RNA2 accumulation level was correlated to RaMV necrosis-inducing ability, and that the RNA2 accumulation level was mostly dependent on the origin of RNA1. However, in radish, Q-RT-PCR results showed more similar viral RNA2 accumulation levels regardless of the ability of the isolate to induce necrosis. Phylogenetic analysis of genomic RNAs sequence including previously characterized isolates from North America, Europe, and Asia suggest possible recombination within RNA1, while analysis of concatenated RNA1+RNA2 sequences indicates that reassortment of RNA1 and RNA2 has been more important in the evolution of RaMV isolates than recombination. Korean isolate Aa is a potential reassortant between isolates RaMV-J and RaMV-TW, while isolate Bb might have evolved from reassortment between isolates RaMV-CA and RaMV-J. The Korean isolates were shown to also be able to infect Chinese cabbage, raising concerns that RaMV may spread from radish fields to the Chinese cabbage crop in Korea, causing further economic losses.

First report of zucchini yellow mosaic virus infecting bitter melon (Momordica charantia) in South Korea.

Bitter melon (Momordica charantia L., family Cucurbitaceae) is used in traditional medicine for diabetes, cancer, and inflammation-associated diseases due to bioactive compounds in Asia and tropical Africa (Bortolotti et al. 2019). In July 2021, approximately 10% of bitter melon plants in the field showed symptoms such as mosaic, yellowing, and leaf deformation on the leaves, in Samchcuk, South Korea. Cucumber and zucchini plants growing in the same field exhibited symptoms like those of bitter melon plants (Ali et al. 2012). To investigate the causative virus, leaf dip preparations from three symptomatic bitter melon leaf samples with symptoms were analyzed by transmission electron microscopy (TEM). Potyvirus-like particles (approximately 680-730 nm in length and 11-13 nm in diameter) were observed in all samples. To further identify the causal viral pathogens, leaf extracts from five symptomatic bitter melon plants were tested by DAS-ELISA using specific antibodies (Agdia, Elkhart, IN, USA) against cucumber mosaic virus, zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus, and papaya ring spot virus. Positive controls from commercial kits and negative controls from healthy bitter melon plants were included in ELISA assay. The serological assay revealed that all five symptomatic samples positively reacted with the antiserum against ZYMV, but not for other viruses. Total RNA extracted from the five ELISA-positive samples and two healthy bitter melon plants (as negative controls), using Clear-S Total RNA extraction kit (InVirusTech Co., Gwangju, Korea), was tested by RT-PCR with ZYMV-specific primers as previously described (Cho et al. 2011). All amplicons of the expected size (~822 bp) were individually cloned into the pGEM-T Easy Vector (Promega, Madison, WI), and sequenced in both orientations. Thereafter, all the sequenced clones shared 100% nucleotide identity. The sequence of ZYMV-MC1 isolated from bitter melon was deposited in the GenBank (accession no. LC652434). Pairwise comparison of the nucleotide sequence with that of ZYMV isolates in the GenBank revealed 99% sequence identity with ZYMV-chk (MG020559) from Korea, 98% with ZYMV-14-HY-SCS (KU743321) from China, 97% with ZYMV-Y21 (MW345249) from Turkey, 96% with ZYMV-AUIKTPK (KR261951) from Pakstan. Leaf saps from the ZYMV-positive bitter melon samples, prepared in 10 mM phosphate buffer (pH 7.0), were mechanically inoculated in five young, healthy bitter melon plants to fulfil Koch's postulates. ZYMV-MC1 isolate caused mosaic and leaf deformation on bitter melon plants 10 days post-inoculation. The presence of ZYMV in the symptomatic leaves was confirmed by RT-PCR using the mentioned above primers mentioned above followed by nucleotide sequencing of the amplicons. Several cotton aphids (Aphis gossypii) were observed in the bitter melon field, which indicated that they might transmit the virus from ZYMV-infected cucumber or zucchini plants. ZYMV is one of the economically important viruses of cucurbits worldwide and has been recently reported from various crops as natural hosts, including Chayote (Yoon et al. 2018) and balloon flowers (Kim et al. 2021). To the best of our knowledge, this is the first report of ZYMV naturally infecting bitter melon in South Korea. Further large -scale surveys are required to determine its incidence, yield losses, and management in bitter melon in Korea.

First report of pepino mosaic virus infecting tomato in South Korea.

Pepino mosaic virus (PepMV), a member of the genus Potexvirus in the family Alphaflexiviridae, has been responsible for economic losses in tomato across Africa, Asia, Europe, and the Americas over the last two decades, but has not previously been reported in South Korea. In December 2020, virus-like symptoms (foliar interveinal chlorosis and unevenly discolored fruits) were observed on ~5% of tomato (Solanum lycopersicum) plants growing in a greenhouse in Jeolla province, South Korea. To identify the causal virus, total RNA from a leaf sample of the symptomatic tomato was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and analyzed by high-throughput sequencing. Ribosomal RNA was removed and a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Plants) and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 151 nt paired end reads. De novo assembly of the 74,417,192 reads was performed using Trinity software (r20140717) while the 308,940 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. Two contigs of 6,419 and 6,391 bp (GenBank LC656469, JKT1; and LC656470, JKT2) shared 94.81% and 98.34% nucleotide (nt) identities with isolates of the CH2 group (MK133092 and MF422613) and US1 group (FJ940225), respectively. No contigs representing other plant viruses were identified. A phylogenetic tree of the genomes of 44 isolates encompassing different PepMV strains (Abrahamian et al., 2020) also placed JKT1 in the CH2 clade, and JKT2 in the US1 clade. Leaf samples from 24 randomly selected plants from the same greenhouse were tested by reverse transcription-polymerase chain reaction (RT-PCR) with PepMV-specific primers, Pep3/Pep4 and PepCP-D/PepCP-R (Souiri et al., 2019), yielding products of the expected sizes (625 bp for Pep3/Pep4 and 848 bp for PepCP-D/PepCP-R) from all samples. Amplicons were cloned into the pGEM-T Easy Vector (Promega, USA); two clones for each amplicon were bidirectionally sequenced (BIONEER, Korea) and deposited in GenBank. The 848 bp amplicon (accession no. LC637517) showed 99.65% nt identity to the JKT1 genome (LC656469) and 94.69% identity to a CH2 isolate (JN835466); the 625 bp amplicon (LC637518) had 99.36% nt identity to the JKT2 genome (LC656470) and 97.28% identity to a US1 isolate (FJ940225). Primers specific to the coat protein gene of each isolate (JKT1-F/JKT1-R, CGCTTGCTGGTGCTGTTCAAG/ACGTCTAGACAAAGCAGGGTT, 934 bp; JKT2-F/JKT2-R, CACTAAATGCAGCAGTTTCTG/AGTTTCATTAGCAGCCAGTC, 830 bp) also yielded the expected amplicons from all 24 samples, indicating mixed infections of PepMV strains CH2 and US1. The PCR products from three randomly-selected samples shared 79.93-80.17% nt identity between (JKT1/JKT2) two JKT1-derived sequences (LC683791 and LC683792) and two JKT2-derived sequences (LC683793 and LC683794), further supporting the presence of mixed infections in the samples. To our knowledge, this is the first report of PepMV infecting tomato in South Korea. The virus is carried on tomato seeds (Córdoba-Sellés et al., 2007; Hanssen et al., 2010), and efficiently transmitted by mechanical means leading to rapid spread in tomato crops, and the severe strain CH2 may be a serious threat to tomato production in South Korea. It is important to concentrate on the phytosanitary control for both importation and exportation to manage and prevent further spread of contaminated seeds or infected transplants.

Rapid and visual detection of tomato spotted wilt virus using recombinase polymerase amplification combined with lateral flow strips.

Tomato spotted wilt virus (TSWV) is economically important in Korea as it causes significant losses to a wide range of important ornamental and vegetable crops. Therefore, a rapid detection method is imperative for TSWV diagnosis. Specific primers and probes were designed based on the conserved sequences of the TSWV coat protein gene. In this study, an isothermal reverse transcription recombinase polymerase amplification (RT-RPA) assay, combined with lateral flow strips (LFS), was established for rapid detection of TSWV in pepper infected leaves. The RT-RPA reaction was performed at an optimal condition of 38 °C for 10 min and an LFS incubation time of approximately 5 min. There was no cross-reactivity with other viruses infecting pepper such as cucumber mosaic virus, pepper mottle virus, pepper mild mottle virus, and broad bean wilt virus 2, thus confirming the specificity of RT-RPA-LFS. The sensitivity of the RT-RPA assay was similar to that of RT-PCR, and RT-RPA-LFS was successfully applied to detect TSWV in the pepper samples collected from the field. Thus, RT-RPA-LFS assay might be a promising candidate for quick diagnosis of TSWV-infected pepper plants.

Development of a reverse transcription droplet digital PCR assay for sensitive detection of peach latent mosaic viroid.

Peach latent mosaic viroid (PLMVd) represents a continuing threat to peach tree production worldwide. In this study, a sensitive and accurate quantification of PLMVd in peach leaves was established using a reverse transcription droplet digital polymerase chain reaction (RT-ddPCR) assay. The quantitative linearity, accuracy, and sensitivity of RT-ddPCR for the detection of PLMVd were comparatively assessed to those of reverse-transcription real-time quantitative polymerase chain reaction (RT-qPCR) assay. The specificity assay shows no amplification in major peach viruses, apple chlorotic leaf spot virus and prunus necrotic ring spot virus and negative control. Furthermore, the levels of PLMVd transcripts determined using RT-ddPCR and RT-qPCR showed a high degree of linearity and quantitative correlation. Our results also indicated that the RT-ddPCR assay is at least two-fold more sensitive than qPCR and could therefore, be used to detect PLMVd in field samples. Moreover, optimization of RT-ddPCR was found to enhance the sensitivity of PLMVd detection in the peach leaf samples with low viral loads. In summary, the established RT-ddPCR assay represents a promising alternative method for the precise quantitative detection of PLMVd; it would be particularly applicable for diagnosing PLMVd infections in plant quarantine inspection and PLMVd-free certification program.

First report of a resistance-breaking strain of Tomato spotted wilt orthotospovirus infecting Capsicum annuum carrying the Tsw resistance gene in South Korea.

Tomato spotted wilt orthotospovirus (TSWV) was first reported in 2004 from paprika in South Korea (Kim et al., 2004), where it is currently widespread. TSWV infections were reported in chili pepper, tomato, weeds, and ornamental plant species in South Korea (Choi et al., 2014; Choi and Choi, 2015; Yoon et al., 2016; Yoon et al., 2018; Yoon et al., 2019). One of the best strategies for TSWV management is planting resistant cultivars containing the Tsw gene. In 2019 virus-like symptoms were observed in chili pepper (Capsicum annuum) plants bearing the Tsw gene in Anseong-si, South Korea. The infected chili peppers showed mosaic and wilting followed by necrosis on leaves and fruits in the field. To identify the causal virus, symptomatic leaf samples were analyzed using ImmunoStrip kits (Agdia, USA); we detected three pepper-infecting viruses: Pepper mild mottle virus, Cucumber mosaic virus, and TSWV. TSWV was only detected from 40 naturally infected chili pepper plants exhibiting virus-like symptoms. To further confirm the presence of TSWV (named TSWV-P1), we amplified reverse-transcription polymerase chain reaction (RT-PCR) products for L, M, and S RNA segments using tospovirus-specific and TSWV-specific primers (Batuman et al., 2014). Expected fragments of 445, 868, and 777 bp in length were amplified and sequenced. The complete genome sequences of TSWV-P1 from a symptomatic chili pepper plant were also determined using TSWV-specific primers (Choi et al., 2014; Lian et al., 2013). The complete genome sequences of TSWV-P1 were deposited to GenBank (LC549179, LC549180, and LC549181). The sequences of each fragment were identical to a consensus sequence, showing 99.1%, 98.5%, and 98.6% identity with TSWV-L, M, and S RNA (KP008132, AY744492, and KP008134), respectively. These results clearly showed only a single TSWV infection among the naturally infected chili pepper plants, without reassortment between TSWV and another tospovirus. To confirm whether TSWV-P1 is a resistance-breaking (RB) strain, Nicotiana rustica was mechanically inoculated with sap from leaves of the infected pepper samples to propagate TSWV-P1. A non-RB TSWV isolate (TSWV-Kor-lisianthus) from lisianthus was used as a control (Yoon et al., 2017). Two resistant (with Tsw) and two susceptible chili pepper cultivars (20 plants per cultivar) were mechanically inoculated with sap from leaves of the TSWV-infected N. rustica. The incidence rates of disease caused by TSWV-P1 were 90-100% for resistant and 95-100% for susceptible cultivars. In contrast, TSWV-Kor-lisianthus caused symptoms only in the susceptible pepper cultivars (90-100% incidence). TSWV infection in representative plants was confirmed using the TSWV- ImmunoStrip kit and RT-PCR. The NSs gene of TSWV-P1 consists of 1,404 nucleotides (468 amino acids); sequence analysis of the TSWV-P1 NSs gene showed high nucleotide (99.7%) and amino acid identities (99.8%) with the NSs sequences of two TSWV isolates (FR693035, CBX24121). Protein sequence analysis of TSWV-P1 NSs revealed that no amino acid mutation was associated with those of a representative TSWV RB strain, as previously described (Almási et al., 2017), suggesting that TSWV-P1 is a RB strain. Because this TSWV-P1 can overcome resistance conferred by the Tsw gene in commercially grown chili pepper cultivars, it represents a potential threat to pepper production in South Korea.

First report of Cucurbit chlorotic yellows virus infecting Cucumis melo (muskmelon and oriental melon) in Korea.

In December 2018, virus-like symptoms (yellowing, vein clearing) were observed on 2% of muskmelon (Cucumis melo L.) plants in plastic houses on a farm in Gyeongsang province, Korea Total RNA from two symptomatic and two asymptomatic plants was extracted using RNeasy Plant Mini Kit (Qiagen, Germany) for high throughput sequencing (HTS). After pre-processing and Ribo-Zero rRNA removal, a cDNA library was prepared (Illumina TruSeq Stranded Total RNA kit) and sequenced (Illumina NovaSeq 6000 system: Macrogen Inc. Korea). De novo assembly of 88,222,684 HTS reads with Trinity software (r20140717) yielded 146,269 contigs of 201-28,442 bp, which were screened against the NCBI viral genome database by BLASTn. Contigs from cucumber mosaic virus (CMV), melon necrotic spot virus (MNSV), tobacco mosaic virus (TMV) and watermelon mosaic virus (WMV) were identified, all previously reported in Korea. Two contigs (8,539 and 8,040 bp) with 99.9% sequence identity to distinct cucurbit chlorotic yellows virus (CCYV) isolates (JN641883, RNA1, Taiwan; MH819191, RNA2, China) were also identified. The ten sequences most closely related to each RNA of the Korean isolate (≥99% coverage, ≥99.6% nt identity) were from Japan, China, Taiwan, or Israel. CCYV presence was confirmed by reverse transcription-PCR (RT-PCR) using newly designed specific primers, RdRp-F/RdRp-R (5'-ACCGAACACTTGGCTATCCAA-3'/5'-CTTAATGCCGCGTATGAACTCA-3') span style="font-family:'Times New Roman'; letter-spacing:-0.5pt">and HSP-F/HSP-R (5'-TGAACGACACTGAGTTCATTCCTA-3'/5'-CGCCAAGATCGTACATGAGGAA-3'), against RNA dependent RNA polymerase (RdRp; RNA1) and the heat shock protein 70 homolog (HSP70h; RNA2). Symptomatic samples yielded products of expected sizes (RdRp,450 bp; HSP70h, 510 bp) while asymptomatic samples did not. The amplicons were cloned, and two clones of each were sequenced (BIONEER, Korea; GenBank acc. nos. LC592226 and LC592227) showing 100% and 99.2% nt identity with RdRp and HSP70h genes of Chinese CCYV isolate SD (MH819190 and MH819191, respectively) and other Asian isolates. Primers specific for CMV, WMV, beet pseudo-yellows virus (BPYV) (Okuda et al., 2007), TMV (Kim et al., 2018), MNSV (F/R, 5'-ATCTCGCATTTGGCATTACTC-3'/5'-ATTTGTAGAGATGCCAACGTA-3'), cucurbit yellow stunting disorder virus (CYSDV; Zeng et al., 2011) and cucurbit aphid-borne yellows virus (CABYV; F/R, 5'-CGGTCTATTGTCTGCAGTACCA-3'/5'- GTAGAGGATCTTGAATTGGTCCTCA-3') were also used. None of these viruses were detected in the symptomatic samples, but both asymptomatic plants were positive for CMV and WMV, and one also for MNSV. In June and September 2020, muskmelon and oriental melon (Cucumis melo L. var. makuwa) plants with yellowing disease (incidence 80-90%) and whiteflies were observed in all investigated plastic houses of one muskmelon and one oriental melon farm in Gyeonggi and Jeolla provinces. Symptomatic samples (14 muskmelon; 6 oriental melon) were collected and RT-PCR tested as above; 19/20 samples were positive for CCYV, but none for the other viruses. The oriental melon sequence (LC592895, LC592230) showed 99.7% and 100% nt identity with the RdRp and HSP70h genes of Chinese isolate SD, respectively. CCYV was first reported in Japan (Okuda et al., 2010), Taiwan, and China (Huang et al., 2010; Gu et al., 2011); to our knowledge, this is the first report of CCYV infecting muskmelon and oriental melon in Korea. Whitefly-transmitted CCYV could present a serious threat of yield losses to cucurbit crops in Korea, requiring control of vector populations to prevent spread of CCYV.

First report of Passiflora latent virus(Passiflora latent virus;PLV) infecting persimmon in Korea.

Passiflora latent virus (PLV), a member of the genus Carlavirus in the family Betaflexiviridae has been reported in Passiflora species in Australia, Germany, Israel, the United States, and New Zealand (Tang et al., 2008). In September 2019, leaves showing a virus-like disease with mosaic, curling and necrosis were collected from ten persimmon (Diospyros kaki Thunb.) orchards in Gyeongsang province, Korea. Total RNA from a pooled sample of leaves from 21 trees was extracted using RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high throughput sequencing. After pre-processing and Ribo-Zero rRNA Removal, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo assembly of the 74,862,810 reads was performed using Trinity software (r20140717); the initially assembled 213,476 contigs were screened against the NCBI viral genome database using BLASTN. By these means, 12 contigs derived from PLV were identified. Contigs with lengths of 209 to 802 nt shared nt identities of 90.70 to 94.82% with PLV isolates, covering a total of 5,169 nt (~61.6% of the full PLV genome). Two additional viruses were also detected from the pooled sample: persimmon cryptic virus (PeCV) and persimmon virus A (PeVA). To confirm PLV infection, reverse transcription-polymerase chain reaction (RT-PCR) was performed using virus-specific primers, PLV-F (5'-ACACAAAACTGCGTGTTGGA-3') and PLV-R (5'-CAAGACCCACCTACCTCAGTGTG-3'), designed based on a 633 nt contig sequence in the polymerase gene. RT-PCR products of the expected 571 bp were obtained from two of 21 individual original samples; no asymptomatic plants were tested. Amplicons were cloned into the pGEM-T Easy Vector, and two clones per sample Sanger sequenced bidirectionally (BIONEER, Korea). The identical Sequence (GenBank LC556232) showed 99.65% nt identity to the contig, and 93.87% identity with the corresponding polymerase sequence of PLV-Rehovot isolate from passion fruit in Israel (MH379331). The two PLV positive samples showing leaf necrosis were also co-infected with PeVA, identified by RT-PCR using previously reported primers PeVAfor/ PeVArev (Morell et al., 2014), but not with PeCV (mixed with PeVA in only 1/21 plants; PeVA was found in 19/21 plants). None of the tested viruses were detected in two trees, displaying mosaic, and leaf curling, respectively. The foliar symptoms of PLV infection on passionfruit have been reported to vary throughout the year (Spiegel et al., 2007). No such observations in persimmon was possible, as the infected persimmon trees were removed and destroyed because they might pose a threat to the cultivation of passion fruits in Korea. To our knowledge, this is the first report of persimmon as a host of PLV anywhere in the world, and the first report of PLV in Korea in any host. A further survey is needed to determine possible presence of PLV on persimmon and Passiflora species.

Inhibitory Activity of Quercetin 3-O-Arabinofuranoside and 2-Oxopomolic Acid Derived from Malus domestica on Soluble Epoxide Hydrolase.

Flavonoids and triterpenoids were revealed to be the potential inhibitors on soluble epoxide hydrolase (sEH). The aim of this study is to reveal sEH inhibitors from Fuji apples. A flavonoid and three triterpenoids derived from the fruit of Malus domestica were identified as quercetin-3-O-arabinoside (1), ursolic acid (2), corosolic acid (3), and 2-oxopomolic acid (4). They had half-maximal inhibitory concentration of the inhibitors (IC50) values of 39.3 ± 3.4, 84.5 ± 9.5, 51.3 ± 4.9, and 11.4 ± 2.7 µM, respectively, on sEH. The inhibitors bound to allosteric sites of enzymes in mixed (1) and noncompetitive modes (2-4). Molecular simulations were carried out for inhibitors 1 and 4 to calculate the binding force of ligands to receptors. The inhibitors bound to the left (1) and right (4) pockets next to the enzyme's active site. Based on analyses of their molecular docking and dynamics, it was shown that inhibitors 1 and 4 can stably bind sEH at 1 bar and 300 K. Finally, inhibitors 1 and 4 are promising candidates for further studies using cell-based assays and in vivo cardiovascular tests.

Sequence Variations Among 17 New Radish Isolates of Turnip mosaic virus Showing Differential Pathogenicity and Infectivity in Nicotiana benthamiana, Brassica rapa, and Raphanus sativus.

Infectious clones were generated from 17 new Korean radish isolates of Turnip mosaic virus (TuMV). Phylogenetic analysis indicated that all new isolates, and three previously characterized Korean radish isolates, belong to the basal-BR group (indicating that the pathotype can infect both Brassica and Raphanus spp.). Pairwise analysis revealed genomic nucleotide and polyprotein amino acid identities of >87.9 and >95.7%, respectively. Five clones (HJY1, HJY2, KIH2, BE, and prior isolate R007) had lower sequence identities than other isolates and produced mild symptoms in Nicotiana benthamiana. These isolates formed three distinct sequence classes (HJY1/HJY2/R007, KIH2, and BE), and several differential amino acid residues (in P1, P3, 6K2, and VPg) were present only in mild isolates HJY1, HJY2, and R007. The remaining isolates all induced systemic necrosis in N. benthamiana. Four mild isolates formed a phylogenetic subclade separate from another subclade including all of the necrosis-inducing isolates plus mild isolate KIH2. Symptom severity in radish and Chinese cabbage genotypes was not correlated with pathogenicity in N. benthamiana; indeed, Chinese cabbage cultivar Norang was not infected by any isolate, whereas Chinese cabbage cultivar Chusarang was uniformly susceptible. Four isolates were unable to infect radish cultivar Iljin, but no specific amino acid residues were correlated with avirulence. These results may lead to the identification of new resistance genes against TuMV.

Evaluation of phenolic compounds from viroid-free and viroid-infected apples using HPLC-PDA-ESI-MS/MS.

INTRODUCTION: Apples are the most consumed fruits in Korea and have played an economically important role in Korean agriculture. However, widespread viroid infection in apples had been reported in recent years. OBJECTIVES: The objective of this study was to clarify the relationships between viroid-disease resistance and phenols content of three apple cultivars: "Fuji", "Gamhong", and "Hongro". A model for distinguishing between viroid-free and viroid-infected apples was also developed. METHODOLOGY: Phenolic compounds in samples were detected using high-performance liquid chromatography photodiode array tandem mass spectrometry (HPLC-PDA-MS/MS) and quantified using an ultraviolet detector at 280 nm. A C18 -column and 0.5% aqueous acetic acid-methanol were used as the stationary and mobile phase. The HPLC method was validated with respect to linearity, precision, accuracy, and recovery. Multivariate analysis was performed using phenols content as variables to classify viroid-free and viroid-infected apples. RESULTS: An accurate method for identifying and quantifying phenol compounds in apple samples was developed and validated. In response to viroid infection, considerable increases in the content of dihydrochalcones (in all three cultivars), hydroxycinnamic acid (in "Fuji"), and flavonols (in "Hongro") were observed. The flavonols content in "Fuji" viroid-infected samples, however, decreased dramatically. An effective linear discriminant model, with 98.2% accuracy and 94.6% predictive ability, was achieved to discriminate between viroid-free and viroid-infected samples. CONCLUSION: The developed HPLC method is suitable to identify and quantify phenol compounds in viroid-free and viroid-infected apples. A hypothesis about the significance of these compounds in viroid-disease resistance was proposed. The linear discriminant model with high predictive ability is useful for identifying viroid-infected apples in the orchards.

Identification of rehmannia virus 1, a novel putative member of the genus Closterovirus, from Rehmannia glutinosa.

Transcriptome sequencing analysis of a symptomatic Rehmannia glutinosa plant revealed a virome containing two known RNA viruses and one novel virus. In this study, we examined the molecular and biological characteristics of the novel virus. The complete genome of the novel virus is composed of monopartite single-stranded RNA of 15,322 nucleotides with 69% nucleotide sequence identity (with 68% coverage) to tobacco virus 1. Its genome organization is typical of the members of the genus Closterovirus, containing nine putative open reading frames. Molecular and phylogenetic analyses of the genome and encoded protein sequences strongly support that the identified virus is a new species of the genus Closterovirus in the family Closteroviridae. The name rehmannia virus 1 (ReV1) is proposed for this novel virus.

Kushenol A and 8-prenylkaempferol, tyrosinase inhibitors, derived from Sophora flavescens.

Tyrosinase is known for an enzyme that plays a key role in producing the initial precursor of melanin biosynthesis. Inhibition of the catalytic reaction of this enzyme led to some advantage such as skin-whitening and anti-insect agents. To find a natural compound with inhibitory activity towards tyrosinase, the five flavonoids of kushenol A (1), 8-prenylkaempferol (2), kushenol C (3), formononetin (4) and 8-prenylnaringenin (5) were isolated by column chromatography from a 95% methanol extract of Sophora flavescens. The ability of these flavonoids to block the conversion of L-tyrosine to L-DOPA by tyrosinase was tested in vitro. Compounds 1 and 2 exhibited potent inhibitory activity, with IC50 values less than 10 µM. Furthermore, enzyme kinetics and molecular docking analysis revealed the formation of a binary encounter complex between compounds 1-4 and the enzyme. Also, all of the isolated compounds (1-5) were confirmed to possess antioxidant activity.

Complete nucleotide sequence of a highly divergent cherry-associated luteovirus (ChALV) isolate from peach in South Korea.

We determined the complete genome sequence of a highly divergent South Korean (SK) isolate of a cherry-associated luteovirus (ChALV) from peach. The ChALV-SK genome consists of 5,815 nucleotides, and contains five open reading frames (ORFs). A comparative analysis of the full genome showed only 73.1% nucleotide sequence identity with a recently described ChALV from the Czech Republic (CZ). Amino acid similarities of the individual ORFs between ChALV-SK and other luteoviruses range from 17.3 to 92%, which places the new isolate close to the species demarcation value for luteoviruses. Results show our ChALV-SK isolate to be highly diverged from the ChALV-CZ isolate.