RESUMEN
The emergence of plant pathogens is often associated with waves of unique evolutionary and epidemiological events. Xanthomonas hortorum pv. gardneri is one of the major pathogens causing bacterial spot disease of tomatoes. After its first report in the 1950s, there were no formal reports on this pathogen until the 1990s, despite active global research on the pathogens that cause tomato and pepper bacterial spot disease. Given the recently documented global distribution of X. hortorum pv. gardneri, our objective was to examine genomic diversification associated with its emergence. We sequenced the genomes of X. hortorum pv. gardneri strains collected in eight countries to examine global population structure and pathways of emergence using phylodynamic analysis. We found that strains isolated post-1990 group by region of collection and show minimal impact of recombination on genetic variation. A period of rapid geographic expansion in X. hortorum pv. gardneri is associated with acquisition of a large plasmid conferring copper tolerance by horizontal transfer and coincides with the burgeoning hybrid tomato seed industry through the 1980s. The ancestry of X. hortorum pv. gardneri is consistent with introduction to hybrid tomato seed production and dissemination during the rapid increase in trade of hybrid seeds.
RESUMEN
Xanthomonas spp. infect a wide range of annual and perennial plants. Bacterial blight in young seedlings of Eucalyptus spp. in Indonesia was originally identified as X. perforans. However, these strains failed to elicit a hypersensitive response (HR) on either tomatoes or peppers. Two of the strains, EPK43 and BCC 972, when infiltrated into tomato and pepper leaves, failed to grow to significant levels in comparison with well-characterized X. euvesicatoria pv. perforans (Xp) strains. Furthermore, spray inoculation of 'Bonny Best' tomato plants with a bacterial suspension of the Eucalyptus strains resulted in no obvious symptoms. We sequenced the whole genomes of eight strains isolated from two Eucalyptus species between 2007 and 2015. The strains had average nucleotide identities (ANIs) of at least 97.8 with Xp and X. euvesicatoria pv. euvesicatoria (Xeu) strains, both of which are causal agents of bacterial spot of tomatoes and peppers. A comparison of the Eucalyptus strains revealed that the ANI values were >99.99% with each other. Core genome phylogeny clustered all Eucalyptus strains with X. euvesicatoria pv. rosa. They formed separate clades, which included X. euvesicatoria pv. alangii, X. euvesicatoria pv. citrumelonis, and X. euvesicatoria pv. alfalfae. Based on ANI, phylogenetic relationships, and pathogenicity, we designated these Eucalyptus strains as X. euvesicatoria pv. eucalypti (Xee). Comparative analysis of sequenced strains provided unique profiles of type III secretion effectors. Core effector XopD, present in all pathogenic Xp and Xeu strains, was absent in the Xee strains. Comparison of the hrp clusters of Xee, Xp, and Xeu genomes revealed that HrpE in Xee strains was very different from that in Xp and Xeu. To determine if it was functional, we deleted the gene and complemented with the Xee hrpE, confirming it was essential for secretion of type III effectors. HrpE has a hypervariable N-terminus in Xanthomonas spp., in which the N-terminus of Xee strains differs significantly from those of Xeu and Xp strains.
Asunto(s)
Eucalyptus , Xanthomonas , Sistemas de Secreción Tipo III , Filogenia , Enfermedades de las Plantas/microbiologíaRESUMEN
Onion center rot is caused by at least four species of genus Pantoea (P. ananatis, P. agglomerans, P. allii, and P. stewartii subsp. indologenes). Critical onion pathogenicity determinants for P. ananatis were recently described, but whether those determinants are common among other onion-pathogenic Pantoea species remains unknown. In this work, we report onion pathogenicity determinants in P. stewartii subsp. indologenes and P. allii. We identified two distinct secondary metabolite biosynthetic gene clusters present separately in different strains of onion-pathogenic P. stewartii subsp. indologenes. One cluster is similar to the previously described HiVir phosphonate biosynthetic cluster identified in P. ananatis and another is a novel putative phosphonate biosynthetic gene cluster, which we named Halophos. The Halophos gene cluster was also identified in P. allii strains. Both clusters are predicted to be phosphonate biosynthetic clusters based on the presence of a characteristic phosphoenolpyruvate phosphomutase (pepM) gene. The deletion of the pepM gene from either HiVir or Halophos clusters in P. stewartii subsp. indologenes caused loss of necrosis on onion leaves and red onion scales and resulted in significantly lower bacterial populations compared with the corresponding wild-type and complemented strains. Seven (halB to halH) of 11 genes (halA to halK) in the Halophos gene cluster are required for onion necrosis phenotypes. The onion nonpathogenic strain PNA15-2 (P. stewartii subsp. indologenes) gained the capacity to cause foliar necrosis on onion via exogenous expression of a minimal seven-gene Halophos cluster (genes halB to halH). Furthermore, cell-free culture filtrates of PNA14-12 expressing the intact Halophos gene cluster caused necrosis on onion leaves consistent with the presence of a secreted toxin. Based on the similarity of proteins to those with experimentally determined functions, we are able to predict most of the steps in Halophos biosynthesis. Together, these observations indicate that production of the toxin phosphonate seems sufficient to account for virulence of a variety of different Pantoea strains, although strains differ in possessing a single but distinct phosphonate biosynthetic cluster. Overall, this is the first report of onion pathogenicity determinants in P. stewartii subsp. indologenes and P. allii. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.
Asunto(s)
Organofosfonatos , Pantoea , Pantoea/genética , Cebollas/microbiología , Virulencia/genética , Enfermedades de las Plantas/microbiología , Familia de MultigenesRESUMEN
IMPORTANCE: Phage-derived bacteriocins (tailocins) are ribosomally synthesized structures produced by bacteria in order to provide advantages against competing strains under natural conditions. Tailocins are highly specific in their target range and have proven to be effective for the prevention and/or treatment of bacterial diseases under clinical and agricultural settings. We describe the discovery and characterization of a new tailocin locus encoded within genomes of Pantoea ananatis and Pantoea stewartii subsp. indologenes, which may enable the development of tailocins as preventative treatments against phytopathogenic infection by these species.
Asunto(s)
Bacteriocinas , Pantoea , Pantoea/genética , Enfermedades de las Plantas/microbiologíaRESUMEN
A Gram-stain-negative, aerobic and non-spore-forming bacterial strain, designated 20TX0172T, was isolated from a rotting onion bulb in Texas, USA. The results of phylogenetic analysis based on the 16S rRNA sequence indicated that the novel strain represented a member of the genus Pseudomonas and had the greatest sequence similarities with Pseudomonas kilonensis 520-20T (99.3â%), Pseudomonas corrugata CFBP 2431T (99.2â%), and Pseudomonas viciae 11K1T (99.2â%) but the 16S rRNA phylogenetic tree displayed a monophyletic clade with Pseudomonas mediterranea CFBP 5447T. In the phylogenetic trees based on sequences of four housekeeping genes (gap1, gltA, gyrB and rpoD), the novel strain formed a separate branch, indicating that the strain was distinct phylogenetically from known species of the genus Pseudomonas. The genome-sequence-derived average nucleotide identity (ANI) and digital DNA-DNA hybridization (dDDH) values between the novel isolate and P. mediterranea DSM 16733T were 86.7 and 32.7â%, respectively. These values were below the accepted species cutoff threshold of 96â% ANI and 70â% dDDH, affirming that the strain represented a novel species. The genome size of the novel species was 5.98 Mbp with a DNA G+C content of 60.8 mol%. On the basis of phenotypic and genotypic characteristics, strain 20TX0172T represents a novel species of the genus Pseudomonas. The name Pseudomonas uvaldensis sp. nov. is proposed. The type strain is 20TX0172T (=NCIMB 15426T=CIP 112022T).
Asunto(s)
Genes Bacterianos , Cebollas , Técnicas de Tipificación Bacteriana , Composición de Base , ADN Bacteriano/genética , Ácidos Grasos/química , Cebollas/microbiología , Filogenia , Pseudomonas , ARN Ribosómico 16S/genética , Análisis de Secuencia de ADNRESUMEN
Species of Pantoea represent a group of plant pathogenic bacteria that infect a variety of agro-economically important plant species. Among these, a complex of P. ananatis, P. allii, P. agglomerans, and P. stewartii subsp. indologenes cause center rot in onion, resulting in significant economic losses. As species of Pantoea are phenotypically closely related, identification of Pantoea species relies on the sequencing and phylogenetic analysis of housekeeping genes. To aid in rapid identification of Pantoea species, efforts have been made in developing species-specific primers to be used in PCR assays. In the current study, two P. ananatis, one P. allii, one P. agglomerans, and three P. stewartii published primers as well as newly developed P. agglomerans PagR primers were evaluated for their specificity against 79 Pantoea strains, belonging to 15 different species. To ensure that selected primers were evaluated against accurately identified species, sequencing and phylogenetic analysis of housekeeping gene infB were conducted. Thereafter, PCR assays using selected species-specific primers were performed. The results showed that previously described P. ananatis-specific PANA_1008; P. allii-specific allii-leuS; P. stewartii-specific PANST_rpoB, 3614galE, and DC283galE primers; and one newly designed P. agglomerans-specific PagR primer pair were highly specific for their target Pantoea species. They accurately identified these strains into their species and, in some cases, their subspecies level. The findings of the current study will facilitate rapid and reliable identification of P. ananatis, P. agglomerans, P. allii, and P. stewartii.
Asunto(s)
Pantoea , Pantoea/genética , Filogenia , Reacción en Cadena de la Polimerasa , Especificidad de la EspecieRESUMEN
Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. 'Elpida' located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive "ghost spot" was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 µm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. 'Elpida' with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch's postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.
RESUMEN
BACKGROUND: The order Enterobacterales encompasses a broad range of metabolically and ecologically versatile bacterial taxa, most of which are motile by means of peritrichous flagella. Flagellar biosynthesis has been linked to a primary flagella locus, flag-1, encompassing ~ 50 genes. A discrete locus, flag-2, encoding a distinct flagellar system, has been observed in a limited number of enterobacterial taxa, but its function remains largely uncharacterized. RESULTS: Comparative genomic analyses showed that orthologous flag-2 loci are present in 592/4028 taxa belonging to 5/8 and 31/76 families and genera, respectively, in the order Enterobacterales. Furthermore, the presence of only the outermost flag-2 genes in many taxa suggests that this locus was far more prevalent and has subsequently been lost through gene deletion events. The flag-2 loci range in size from ~ 3.4 to 81.1 kilobases and code for between five and 102 distinct proteins. The discrepancy in size and protein number can be attributed to the presence of cargo gene islands within the loci. Evolutionary analyses revealed a complex evolutionary history for the flag-2 loci, representing ancestral elements in some taxa, while showing evidence of recent horizontal acquisition in other enterobacteria. CONCLUSIONS: The flag-2 flagellar system is a fairly common, but highly variable feature among members of the Enterobacterales. Given the energetic burden of flagellar biosynthesis and functioning, the prevalence of a second flagellar system suggests it plays important biological roles in the enterobacteria and we postulate on its potential role as locomotory organ or as secretion system.
Asunto(s)
Proteínas Bacterianas/genética , Enterobacteriaceae/clasificación , Flagelos/genética , Enterobacteriaceae/genética , Evolución Molecular , Transferencia de Gen Horizontal , Familia de Multigenes , FilogeniaRESUMEN
BACKGROUND: Flagellar motility is an efficient means of movement that allows bacteria to successfully colonize and compete with other microorganisms within their respective environments. The production and functioning of flagella is highly energy intensive and therefore flagellar motility is a tightly regulated process. Despite this, some bacteria have been observed to possess multiple flagellar systems which allow distinct forms of motility. RESULTS: Comparative genomic analyses showed that, in addition to the previously identified primary peritrichous (flag-1) and secondary, lateral (flag-2) flagellar loci, three novel types of flagellar loci, varying in both gene content and gene order, are encoded on the genomes of members of the order Enterobacterales. The flag-3 and flag-4 loci encode predicted peritrichous flagellar systems while the flag-5 locus encodes a polar flagellum. In total, 798/4028 (~ 20%) of the studied taxa incorporate dual flagellar systems, while nineteen taxa incorporate three distinct flagellar loci. Phylogenetic analyses indicate the complex evolutionary histories of the flagellar systems among the Enterobacterales. CONCLUSIONS: Supernumerary flagellar loci are relatively common features across a broad taxonomic spectrum in the order Enterobacterales. Here, we report the occurrence of five (flag-1 to flag-5) flagellar loci on the genomes of enterobacterial taxa, as well as the occurrence of three flagellar systems in select members of the Enterobacterales. Considering the energetic burden of maintaining and operating multiple flagellar systems, they are likely to play a role in the ecological success of members of this family and we postulate on their potential biological functions.
Asunto(s)
Enterobacteriaceae/genética , Flagelos/genética , Flagelina/genética , Secuencia Conservada , Enterobacteriaceae/clasificación , Evolución Molecular , Filogenia , Homología de SecuenciaRESUMEN
Bacterial leaf streak of corn, caused by Xanthomonas vasicola pv. vasculorum, has been present in South Africa for over 70 years, but is an emerging disease of corn in North and South America. The only scientific information pertaining to this disease on corn came from work done in South Africa, which primarily investigated host range on other African crops, such as sugarcane and banana. As a result, when the disease was first reported in the United States in 2016, there was very limited information on where this pathogen came from, how it infects its host, what plant tissue(s) it is capable of infecting, where initial inoculum comes from at the beginning of each crop season, how the bacterium spreads from plant to plant and long distance, what meteorological variables and agronomic practices favor disease development and spread, how many other plant species X. vasicola pv. vasculorum is capable of infecting or using as alternate hosts, and if the bacterium will be able to persist in all corn growing regions of the United States. There were also no rapid diagnostic assays available which initially hindered prompt identification prior to the development of molecular diagnostic tools. The goal of this synthesis is to review the history of X. vasicola pv. vasculorum and bacterial leaf streak in South Africa and its movement to North and South America, and highlight the recent research that has been done in response to the emergence of this bacterial disease.
Asunto(s)
Xanthomonas , Enfermedades de las Plantas , Sudáfrica , América del Sur , Zea maysRESUMEN
We present an amended description of the bacterial species Xanthomonas vasicola to include the causative agent of banana Xanthomonas wilt, as well as strains that cause disease on Areca palm, Tripsacum grass, sugarcane, and maize. Genome-sequence data reveal that these strains all share more than 98% average nucleotide with each other and with the type strain. Our analyses and proposals should help to resolve the taxonomic confusion that surrounds some of these pathogens and help to prevent future use of invalid names.[Formula: see text] Copyright © 2020 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.
Asunto(s)
Musa , Xanthomonas campestris , Xanthomonas , Areca , Enfermedades de las PlantasRESUMEN
Recent studies have described Spirocerca lupi-like nematodes in the stomach of red foxes (Vulpes vulpes) in Europe. A phylogenetic analysis of those specimens using mitochondrial DNA and their morphological reexamination allowed their characterization as a different species, Spirocerca vulpis. Between the years of 2010 and 2017, roundworms were collected from seven red foxes of northeastern Portugal found at necropsy with nodular lesions on their stomach wall. Histopathological analysis of four foxes revealed granulomatous lesions of the gastric nodules. On morphological assessment, by light microscopy, nematodes revealed the presence of six triangular teeth-like buccal capsule structures, which are absent in S. lupi. Polymerase chain reaction was run to amplify a 551 bp partial fragment of the cytochrome c oxidase subunit 1 gene. Sequences were 99% similar to S. vulpis (85% coverage) of red foxes from Spain and Bosnia and Herzegovina, 99% similar (99% coverage) to sequences of Spirocerca sp. of red foxes from Denmark and 93% similar (99% coverage) to S. lupi from South Africa. This is the first report of S. vulpis in foxes or any other host from Portugal.
Asunto(s)
Zorros/parasitología , Infecciones por Spirurida/veterinaria , Thelazioidea/aislamiento & purificación , Animales , Filogenia , Reacción en Cadena de la Polimerasa , Portugal , España , Infecciones por Spirurida/patología , Estómago/parasitología , Estómago/patología , Thelazioidea/clasificación , Thelazioidea/genéticaRESUMEN
Bacterial canker is a common bacterial disease of stone fruit trees. The causal agents responsible for the disease include several pathovars in Pseudomonas syringae sensu lato and newly described Pseudomonas species. Pseudomonad strains were isolated from symptomatic stone fruit trees, namely apricot, peach, and plum trees cultivated in spatially separated orchards in the Western Cape. A polyphasic approach was used to identify and characterize these strains. Using a multilocus sequence typing approach of four housekeeping loci, namely cts, gapA, gyrB, and rpoD, the pseudomonad strains were delineated into two phylogenetic groups within P. syringae sensu lato: P. syringae sensu stricto and Pseudomonas viridiflava. These results were further supported by LOPAT diagnostic assays and analysis of clades in the rep-PCR dendrogram. The pseudomonad strains were pathogenic on both apricot and plum seedlings, indicative of a lack of host specificity between Pseudomonas strains infecting Prunus spp. This is a first report of P. viridiflava isolated from plum trees showing symptoms of bacterial canker. P. viridiflava is considered to be an opportunistic pathogen that causes foliar diseases of vegetable crops, fruit trees, and aromatic herbs, and thus the isolation of pathogenic P. viridiflava from twigs of plum trees showing symptoms of bacterial canker suggests that this bacterial species is a potentially emerging stem canker pathogen of stone fruit trees in South Africa.
Asunto(s)
Frutas , Enfermedades de las Plantas , Filogenia , Pseudomonas syringae , SudáfricaRESUMEN
Tomatoes (Solanum lycopersicum) represent one of the most frequently consumed vegetables in Mauritius after potatoes and onions. The value of the tomato industry is estimated to be around Rs 300 M in Mauritius, with an annual production of 18,376 t over an area of 1365 ha. (Cheung Kai Suet 2019). In August 2019, disease surveillance was conducted in the tomato cv. 'Elipida' grown in the greenhouse situated at Camp Thorel (eastern part of Mauritius), a super-humid zone where the prevailing temperature and humidity were 30°C and 70% respectively. The symptoms included numerous circular to irregular, dark brown, target like lesions on the leaves, followed by the occurrence of yellow halo and occasional defoliation. Disease incidence was estimated to be 80% in the entire greenhouse. From sampled symptomatic leaves, small pieces of infected tissue were surface-disinfected with 1% sodium hypochlorite, air dried, and placed on PDA. After 7 days incubation at 23°C under 12 hours of natural light regime, isolates with fast growing grey-brown, velvety colonies were recovered. In colonies, singly-borne or in short chains, pale brown, cylindrical, straight or slightly curved conidia with 2 - 14 pseudosepta (34 x 2 µm) were numerous. Based on morphological features, the isolates were identified as Corynespora cassiicola (Berk. and M.A. Curtis) C.T. Wei (Dixon et al. 2009). Morphological identification was confirmed by amplifying and sequencing of the ITS region (ITS1, 5.8S rDNA and ITS2 regions) of the rDNA. Total DNA was extracted directly from fungal mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1F and ITS4 (Takamatsu et al. 2010). The nucleotide sequence of the representative isolate 408G-19/M (575 bp) (Accession No. MN860167) was compared with those available in GenBank and shared 98 to 99.82% identity with over 100 C. cassiicola isolates (99.65% with FJ852578 from Solanum melongena, Dixon et al. 2009). Koch's postulates were confirmed by spraying 10 healthy tomato plants (four leaf phenophase) with spore suspension (1 x 103 conidia/ml) prepared from 10 days old colonies of isolate 408G-19/M in sterile water. Healthy tomato plants inoculated with sterile water served as negative control. Plants were maintained in greenhouse conditions. On all inoculated plants, characteristic target like necrotic spots were visible 7 days post inoculation. No symptoms were recorded in the negative control after 15 days. From all symptomatic tomato leaves, the original isolate was successfully recovered. So far in Mauritius, C. cassiicola had been reported on Molucella (Anon. [Director of Agriculture] 1961) and Bignonia spp. (Orieux 1959) and also as an endophyte associated with Jatropha spp. (Rampadarath et al. 2018). Although symptoms resembling target spot were previously observed on field-grown tomatoes (Vally, pers. Comm.), to our knowledge, this is the first study confirming C. cassiicola as a tomato pathogen in Mauritius. As C. cassiicola affects a wide range of hosts (Lopez et al. 2018), including tomato, cucumber, zucchini and banana which are all important for Mauritius, the occurrence of this pathogen is a potential threat. Additionally, the results will help in developing efficient disease control strategies, thus minimizing yield loss of tomatoes produced locally.
RESUMEN
Plants emit a large variety of volatile organic compounds during infection by pathogenic microbes, including terpenes, aromatics, nitrogen-containing compounds, and fatty acid derivatives, as well as the volatile plant hormones, methyl jasmonate, and methyl salicylate. Given the general antimicrobial activity of plant volatiles and the timing of emission following infection, these compounds have often been assumed to function in defence against pathogens without much solid evidence. In this review, we critically evaluate current knowledge on the toxicity of volatiles to fungi, bacteria, and viruses and their role in plant resistance as well as how they act to induce systemic resistance in uninfected parts of the plant and in neighbouring plants. We also discuss how microbes can detoxify plant volatiles and exploit them as nutrients, attractants for insect vectors, and inducers of volatile emissions, which stimulate immune responses that make plants more susceptible to infection. Although much more is known about plant volatile-herbivore interactions, knowledge of volatile-microbe interactions is growing and it may eventually be possible to harness plant volatiles to reduce disease in agriculture and forestry. Future research in this field can be facilitated by making use of the analytical and molecular tools generated by the prolific research on plant-herbivore interactions.
Asunto(s)
Enfermedades de las Plantas/inmunología , Plantas/inmunología , Plantas/metabolismo , Compuestos Orgánicos Volátiles/farmacología , Antiinfecciosos/farmacología , Bacterias/efectos de los fármacos , Vías Biosintéticas , Resistencia a la Enfermedad , Hongos/efectos de los fármacos , Herbivoria , Interacciones Microbianas/efectos de los fármacos , Enfermedades de las Plantas/microbiología , Enfermedades de las Plantas/prevención & control , Terpenos , Virus/efectos de los fármacos , Compuestos Orgánicos Volátiles/inmunologíaRESUMEN
Bacterial species are commonly defined by applying a set of predetermined criteria, including DNA-DNA hybridization values, 16S rRNA gene sequence similarity, phenotypic data as well as genome-based criteria such as average nucleotide identity or digital DNA-DNA hybridization. These criteria mostly allow for the delimitation of taxa that resemble typical bacterial species. Their application is often complicated when the objective is to delineate new species that are characterized by significant population-level diversity or recent speciation. However, we believe that these complexities and limitations can be easily circumvented by recognizing that bacterial species represent unique and exclusive assemblages of diversity. Within such a framework, methods that account for the population processes involved in species evolution are used to infer species boundaries. A method such as genealogical concordance analysis is well suited to delineate a putative species. The existence of the new taxon is then interrogated using an array of traditional and genome-based characters. By making use of taxa in the genera Pantoea, Paraburkholderia and Escherichia we demonstrate in a step-wise process how genealogical concordance can be used to delimit a bacterial species. Genetic, phenotypic and biological criteria were used to provide independent lines of evidence for the existence of that taxon. Our six-step approach to species recognition is straightforward and applicable to bacterial species especially in the post-genomic era, with increased availability of whole genome sequences. In fact, our results indicated that a combined genome-based comparative and evolutionary approach would be the preferred alternative for delineating coherent bacterial taxa.
Asunto(s)
Bacterias/clasificación , Bacterias/genética , Técnicas de Tipificación Bacteriana/métodos , Clasificación/métodos , Filogenia , Evolución Molecular , Genes Bacterianos/genética , Genómica , Tipificación de Secuencias Multilocus , FenotipoRESUMEN
Investigation of the evolutionary relationships between related bacterial species and genera with a variety of lifestyles have gained popularity in recent years. For analysing the evolution of specific traits, however, a robust phylogeny is essential. In this study we examined the evolutionary relationships among the closely related genera Erwinia, Tatumella and Pantoea, and also attempted to resolve the species relationships within Pantoea. To accomplish this, we used the whole genome sequence data for 35 different strains belonging to these three genera, as well as nine outgroup taxa. Multigene datasets consisting of the 1039 genes shared by these 44 strains were then generated and subjected to maximum likelihood phylogenetic analyses, after which the results were compared to those using conventional multi-locus sequence analysis (MLSA) and ribosomal MLSA (rMLSA) approaches. The robustness of the respective phylogenies was then explored by considering the factors typically responsible for destabilizing phylogenetic trees. We found that the nucleotide datasets employed in the MLSA, rMLSA and 1039-gene datasets contained significant levels of homoplasy, substitution saturation and differential codon usage, all of which likely gave rise to the observed lineage specific rate heterogeneity. The effects of these factors were much less pronounced in the amino acid dataset for the 1039 genes, which allowed reconstruction of a fully supported and resolved phylogeny. The robustness of this amino acid tree was also supported by different subsets of the 1039 genes. In contrast to the smaller datasets (MLSA and rMLSA), the 1039 amino acid tree was also not as sensitive to long-branch attraction. The robust and well-supported evolutionary hypothesis for the three genera, which confidently resolved their various inter- and intrageneric relationships, represents a valuable resource for future studies. It will form the basis for studies aiming to understand the forces driving the divergence and maintenance of lineages, species and biological traits in this important group of bacteria.
Asunto(s)
Enterobacteriaceae/clasificación , Erwinia/clasificación , Genoma Bacteriano/genética , Pantoea/clasificación , Filogenia , Secuencia de Aminoácidos , Análisis por Conglomerados , ADN Bacteriano/genética , Bases de Datos Genéticas , Enterobacteriaceae/genética , Erwinia/genética , Evolución Molecular , Genómica , Pantoea/genética , Alineación de SecuenciaRESUMEN
Quorum sensing (QS) plays an important role in the regulation of bacteria-host interactions and ecological fitness in many bacteria. In this study, 2 luxI/R homologs, namely eanI/eanR and rhlI/rhlR, were identified in the genome sequence of Pantoea ananatis LMG 2665T. To determine a role for these luxI/R homologs in pathogenicity and biofilm formation, mutant bacterial strains lacking either eanI/R or rhlI/R and both of these homologs were generated. The results indicated that both the RhlI/R and EanI/R systems are required for pathogenicity and biofilm formation in strain LMG 2665T. This is the first study to characterize the biological significance of the RhlI/R QS system in P. ananatis.
Asunto(s)
Proteínas Bacterianas/genética , Biopelículas , Pantoea/genética , Pantoea/patogenicidad , Percepción de Quorum/genética , Proteínas Represoras/genética , Transactivadores/genética , Factores de Transcripción/genética , Genoma Bacteriano/genética , Mutación/genéticaRESUMEN
Type VI secretion systems (T6SSs) are a class of macromolecular machines that are recognized as an important virulence mechanism in several gram-negative bacteria. The genome of Pantoea ananatis LMG 2665(T), a pathogen of pineapple fruit and onion plants, carries two gene clusters whose predicted products have homology with T6SS-associated gene products from other bacteria. Nothing is known regarding the role of these T6SS-1 and T6SS-3 gene clusters in the biology of P. ananatis. Here, we present evidence that T6SS-1 plays an important role in the pathogenicity of P. ananatis LMG 2665(T) in onion plants, while a strain lacking T6SS-3 remains as pathogenic as the wild-type strain. We also investigated the role of the T6SS-1 system in bacterial competition, the results of which indicated that several bacteria compete less efficiently against wild-type LMG 2665(T) than a strain lacking T6SS-1. Additionally, we demonstrated that these phenotypes of strain LMG 2665(T) were reliant on the core T6SS products TssA and TssD (Hcp), thus indicating that the T6SS-1 gene cluster encodes a functioning T6SS. Collectively, our data provide the first evidence demonstrating that the T6SS-1 system is a virulence determinant of P. ananatis LMG 2665(T) and plays a role in bacterial competition.