Addition of adenoviral vector targeting of chemotherapy to the MUC-1/ecdCD40L VPPP vector prime protein boost vaccine prolongs survival of mice carrying growing subcutaneous deposits of Lewis lung cancer cells.

We studied the effect of adding chemotherapy or vector targeted chemotherapy to the administration of an Ad-sig-hMUC-1/ecdCD40L adenoviral vector prime-hMUC-1/ecdCD40L protein boost cancer vaccine (designated hMUC-1/ecdCD40L VPPP vaccine), which were administered to test mice 10 days following subcutaneous (s.c.) inoculation of 500,000 Lewis Lung Carcinoma cells, at a time when the average volume of the s.c. tumors was 50 cu mm. The survival of hMUC-1/ecdCD40L VPPP vaccine-treated mice was twice as long as untreated mice. Addition of vector-targeted chemotherapy (AdCMVCDIRESE1A/5FC) to the hMUC-1/ecdCD40L VPPP vaccine 10 days after tumor inoculation significantly (P=0.0062) prolonged the survival of the test mice over administration of the hMUC-1/ecdCD40L VPPP vaccine alone or the control mice (P<0.00001). Interestingly, the combination of the AdCMVCDIRESE1A/5FC vector-targeted chemotherapy to the hMUC-1/ecdCD40L VPPP vaccine decreased the levels of CD44(+)CD24⁻ cells in s.c. deposits of the human MUC-1-positive Lewis Lung Cancer cell line (LL2/LL1hMUC-1) by 20 fold. These results suggest that the addition of vector-targeted chemotherapy to an adenoviral-based cancer vaccine is a strategy that deserves further testing.

Hemoglobin synthesis in somatic cell hybrids: independent segregation of the human alpha- and beta-globin genes.

Hybrid somatic cells containing a partial complement of human chromosomes were used to demonstrate that the human alpha- and beta-globin genes are located on different chromosomes. Two cell lines consisting of a cross of mouse with human fibroblasts contained the human alpha- and not the beta-globin gene, while a cross of human marrow cells with mouse erythroleukemia cells expressed the human beta- but not the alpha-globin gene.

Vector vaccination and vector targeted chemotherapy in solid tumors.

Gene therapy is one of the promising treatment modalities in cancer therapy. The current gene therapy modalities are mainly focused on the introduction of suppressed tumor suppressor genes into cancer cells, modulation of anti-tumoral immune response, and the suicide gene therapy by introducing pro-drug-activating enzyme genes into the tumor cells. Currently, various gene therapy trials are being conducted in cancer patients. However, the early results of these trials conducted so far are not so encouraging. Combination of gene therapy strategies with conventional treatment modalities such as chemotherapy, immunotherapy or radiotherapy has yielded encouraging results in experimental models and early clinical trials.

Cyclophosphamide treatment expands the circulating hematopoietic stem cell pool in dogs.

Increased numbers of circulating granulocyte-monocyte precursor cells (CFUc) have been observed in the peripheral blood of man after antineoplastic chemotherapy. We have developed a canine model to study the biologic significance of this phenomenon for hematopoietic reconstitution following hematopoietically lethal exposure to total body irradiation (TBI). After cyclophosphamide administration, a 16-fold expansion of circulating CFUc numbers was observed during the period of rapid leukocyte recovery that occurred after the chemotherapy-induced leukocyte nadir. We had previously noted this association between leukocyte recovery and CFUc expansion in our human studies. After 900 rad TBI hematopoietic reconstitution was attempted with autologous, cryopreserved collections of peripheral blood mononuclear cells obtained either at times of post-cyclophosphamide CFUc expansion (group A, 14 dogs) or without CFUc expansion (group B, 12 dogs). Asd compared to group B collections, group A collections contained 11-fold more CFUc and were 12.5-fold more potent in fostering hematopoietic recovery after TBI. These results suggest that the expansion of CFUc numbers we observed was accompanied by a similar expansion of more primitive hematopoietic stem cell numbers. We conclude that chemotherapy-induced expansion of circulating CFUc numbers appears to be of substantial import in effecting hematopoietic reconstitution--an observation that may be of significance for further studies of autologous hematopoietic reconstitution in man.

Interferon-alpha restores the deficient expression of the cytoadhesion molecule lymphocyte function antigen-3 by chronic myelogenous leukemia progenitor cells.

Hematopoietic cells from the malignant clone in chronic myelogenous leukemia (CML) maintain and expand a proliferative advantage over normal hematopoietic cells within the bone marrow. This advantage is often ameliorated or reversed in vivo by IFN alpha. Based upon earlier studies suggesting decreased adhesiveness of CML progenitor cells, we asked whether CML progenitor cells are deficient in their expression of the cytoadhesion molecule lymphocyte function antigen-3 (LFA-3, CD58) which is normally expressed on hematopoietic progenitors. Progenitor cells from untreated CML patients showed greatly reduced or absent LFA-3 expression, whereas progenitors from patients treated with IFN alpha in vivo or in vitro expressed surface LFA-3 at more normal levels. LFA-3-deficient CML progenitor cells were unable to stimulate normal regulatory proliferative responses in autologous T cells. We hypothesize that IFN alpha-sensitive LFA-3 deficiency reflects a cell surface cytoadhesion defect which may help explain adhesive abnormalities of CML progenitor cells in vitro and clonal proliferation in vivo.

A phosphatase activity present in peripheral blood myeloid cells of chronic myelogenous leukemia patients but not normal individuals alters nuclear protein binding to transcriptional enhancers of interferon-inducible genes.

Cytoplasmic protein from peripheral blood myeloid cells of chronic myelogenous leukemia (CML) patients altered the electrophoretic mobility of complexes formed between nuclear proteins and interferon-inducible transcriptional enhancers. Immature myeloid marrow cells (blasts and promyelocytes) have a higher level of this activity than do mature myeloid marrow cells (bands and polys). This activity, which is not detectable in the peripheral blood cells of normal individuals, is at least 50-fold higher in CML marrow blasts and promyelocytes than that found in marrow blasts and promyelocytes of normal individuals. This activity was inhibited by in vivo incubation of immature myeloid cells with the phosphatase inhibitor, sodium orthovanadate (0.2 mM), and by adding orthovanadate (20 mM) directly to cytoplasmic proteins of myeloid cells. Interferon-alpha (1,000 U/ml) reduced the effects of the CML myeloid cell cytoplasmic protein on the electrophoretic mobility of nuclear protein-DNA complexes. These data suggest that a unique phosphatase may be involved in the abnormalities in CML which are modulated by interferon-alpha.

International Society for Cell and Gene Therapy of Cancer: 2005 meeting in Shenzhen, China.

The 2005 International Society for Cell and Gene Therapy of Cancer (ISCGT) Congress was held in Shenzhen, China (www.iscgtchina2005.com) from December 9th-11th 2005. Here, we describe a representation of the most seminal presentations providing an overview of the progress in the field of cancer gene therapy including the successful introduction of the first approved gene therapy drug.

Mapping of angiogenic markers for targeting of vectors to tumor vascular endothelial cells.

The vasculature of mouse breast tumor spheroids grown on mammary fat pad tissue in an intravital microscopy (IVM) viewing chamber was shown to derive from infiltrating angiogenic mammary vessels. The receptors tissue factor (TF), alpha V beta 3 integrin and Tie-2 were expressed on the vascular endothelium in the periphery but not in the center of the tumor spheroids nor in the mammary tissue nor in smooth muscle tissue, whereas Tie-1 and PCAM-1 were expressed extensively in the entire tumor and in the vascular endothelium of the entire tumor nodule and in normal mammary tissue. TF is a specific target for adenoviral vector-mediated cancer immunotherapy. Subcutaneous injection of the AdfVII/IgG(1)Fc vector leads to the release into the system circulation of a fVII/IgG(1)Fc immunoconjugate molecule that binds specifically and tightly to TF on vascular endothelial cells and tumor cells, activating a cytolytic immune response against the targeted cells. We show that a single administration of the AdfVII/IgG(1)Fc vector destroys the peripheral but not the central vasculature of a tumor spheroid, causing partial tumor regression; additional administrations prevent regeneration of the peripheral vasculature and regrowth of the tumor. These findings indicate that a critical parameter for optimizing tumor damage is the schedule for successive administrations of the AdfVII/IgG(1)Fc, which should coincide with the regeneration of the peripheral vasculature and continue until the tumor is destroyed.

A novel interferon-inducible domain: structural and functional analysis of the human interferon regulatory factor 1 gene promoter.

We have cloned and functionally characterized the human interferon regulatory factor 1 (IRF-1) gene promoter. The promoter contains a CpG island, with several GC boxes, a CAAT box, but no TATA box. IRF-1 mRNA is strongly induced by gamma interferon (IFN-gamma) but more weakly and transiently by IFN-alpha. There are several putative kappa B motifs and numerous AA(G/A)G(G/T)A and GAAANN motifs throughout the promoter. The IRF-1 promoter is not autoregulated by the IRF-1 gene product. IFN inducibility of the promoter was studied with 5' deletion mutants linked to a heterologous reporter gene. Gel mobility shift assays were used to show IFN-inducible factor binding to the IRF-1 promoter. These studies showed that IFN inducibility is conferred by a novel imperfect inverted-repeat arrangement of two GAAANN motifs within a domain, 130 nucleotides upstream of transcription initiation. This inverted repeat binds a factor upon induction with IFN and can confer IFN inducibility on a heterologous promoter. Conversely, point mutations of the inverted repeat are not IFN inducible when linked to the same heterologous promoter.

Wild-type human p53 and a temperature-sensitive mutant induce Fas/APO-1 expression.

Fas/APO-1 is a cell surface protein known to trigger apoptosis upon specific antibody engagement. Because wild-type p53 can activate transcription as well as induce apoptosis, we queried whether p53 might upregulate Fas/APO-1. To explore this possibility, we examined human p53-null (H358 non-small-cell lung adenocarcinoma and K562 erythroleukemia) and wild-type p53-containing (H460 non-small-cell lung adenocarcinoma) cell lines. When H358 or H460 cells were transduced with a replication-deficient adenovirus expression construct containing the human wild-type p53 gene but not with vector alone, a marked upregulation (approximately a three-to fourfold increase) of cell surface Fas/APO-1 was observed by flow cytometry. Similarly, K562, cells stably transfected with a plasmid vector containing the temperature-sensitive human p53 mutant Ala-143 demonstrated a four- to sixfold upregulation of Fas/APO-1 by flow-cytometric analysis at the permissive temperature of 32.5 degrees C. Temperature-sensitive upregulation of Fas/APO-1 in K562 Ala-143 cells was verified by immunoprecipitation and demonstrated to result from enhanced mRNA production by nuclear run-on and Northern (RNA) analyses. Stably transfected K562 cells expressing temperature-insensitive, transcriptionally inactive p53 mutants (His-175, Trp-248, His-273, or Gly-281) failed to upregulate Fas/APO-1 at either 32.5 degrees or 37.5 degrees C. The temperature-sensitive transcription of Fas/APO-1 occurred in the presence of cycloheximide, indicating that de novo protein synthesis was not required and suggested a direct involvement of p53. Collectively, these observations argue that Fas/APO-1 is a target gene for transcriptional activation by p53.

Oncolytic adenoviral vector carrying the cytosine deaminase gene for melanoma gene therapy.

We constructed an oncolytic adenoviral vector Ad.HE1HCD3, in which the adenoviral E1A promoter was replaced by a human tyrosinase enhancer (HTE)/promoter. The RGD-4C peptide was inserted into the HI loop of the fiber knob domain to increase the transduction efficiency of this vector for tumor cell lines. We also inserted the prodrug activating cytosine deaminase gene driven by the HTE/promoter into the E3 region of the Ad.HE1HCD3 vector. The in vitro cytotoxic effect of the Ad.HE1HCD3 vector with 5-fluorocytosine (5-FC) was greater than that of a wild-type adenovirus or that of the Ad.HE1HCD3 vector alone in tyrosinase-positive melanoma cell lines at low multiplicity of infection. Intratumoral injection of low doses of the Ad.HE1HCD3 vector into xenotransplanted human melanoma cell lines followed by the intraperitoneal injection of 5-FC led to a greater degree of tumor regression in vivo than did the intratumoral injection of the same dose of the Ad.HE1HCD3 vector alone. This oncolytic vector with a melanoma-specific prodrug activation therapeutic transcription unit and a RGD targeted fiber protein offers a potent therapeutic combination for the gene therapy of melanoma.

Engineering conditionally replication-competent adenoviral vectors carrying the cytosine deaminase gene increases the infectivity and therapeutic effect for breast cancer gene therapy.

We constructed a conditionally replication-competent adenoviral vector Ad.Lp-CD-IRES-E1A(control) in which the expression of both the prodrug-activating cytosine deaminase gene and the viral replication E1A gene were driven by the L-plastin tumor-specific promoter. In order to overcome the low infectivity of the adenoviral vectors for breast cancer cells, and to increase the safety and efficacy for cancer gene therapy, this vector was further modified on a transductional level by simultaneously ablating the native tropism of the vector to the primary CAR receptor and inserting a RGD-4C peptide into the HI loop of the fiber, which allows the vector to use the alphavbeta3 and alphavbeta5 receptors as alternative receptors. The resulting vector was named Ad.Lp-CD-IRES-E1A(MRGD). The transduction efficiency of the vector for breast cancer cell lines which have low expression level of CAR was increased both in vitro and in vivo. The Ad.Lp-CD-IRES-E1A(MRGD) vector produces a higher vector particle yield and a greater cytotoxic effect in tumor cells which have a low expression level of CAR, than did the Ad.Lp-CD-IRES-E1A(control) vector. Intratumoral injection of the Ad.Lp-CD-IRES-E1A(MRGD) vector following the intraperitoneal injection of 5FC into xenotransplanted human breast cancer cell lines which have low expression level of CAR led to greater degree of tumor regression in vivo than did the intratumoral injection of control adenoviral vectors not so modified.

Evidence for multiple sites of regulation of heme synthesis in murine erythroleukemia cells.

Friend murine erythroleukemia (MEL) cells can be induced to differentiate along the erythroid pathway by such dissimilar agents as dimethyl sulfoxide (DMSO), butyrate, inhibitors of DNA synthesis, and certain highly polar agents. This study showed differential biochemical effects of the potent inducers DMSO and butyrate on the heme biosynthetic pathway in three clones of Friend MEL cells. When the cells were incubated with combinations of DMSO and butyrate, hemoglobin production was less than that amount produced when each inducer was incubated singly with the cells. Procaine, a local anesthetic that competes with Ca2+ and thus affects membrane permeability, slightly inhibited DMSO-mediated hemoglobin production but almost tripled the level stimulated by butyrate alone. Similarly, EDTA, which also can bind Ca2+ and which can modify the activity of heme biosynthetic enzymes, also inhibited hemoglobin production mediated by DMSO, whereas it stimulated hemoglobin production in cells exposed to butyrate. Total porphyrin accumulation was greater in DMSO-treated cells than in butyrate-treated cells, which suggests that butyrate induces the enzymes of the heme pathway more efficiently than does DMSO. DMSO and butyrate may affect the heme biosynthetic pathway by multiple mechanisms or, alternatively, they may affect the multistep pathway at various points, producing partial blocks or incomplete enzyme induction.

Expression of epidermal growth factor receptor and human papillomavirus E6/E7 proteins in cervical carcinoma cells.

BACKGROUND: Epidermal growth factor receptor (EGF-R) proteins are highly expressed in many tumors, including those of the cervix. We have observed previously that the introduction of a transcription unit containing an antisense sequence for the E6/E7 genes of human papillomavirus (HPV) 18, along with a transcription unit containing a sense complementary DNA sequence for the wild-type retinoblastoma (Rb) gene, decreased the growth of human cervical carcinoma HeLa cells (HPV 18 positive) both in vitro and in vivo. To clarify the regulatory mechanisms by which this reduction in cell proliferation occurred, we studied the expression of EGF-R proteins in these cells. METHODS: Western blot and northern blot techniques were used to measure EGF-R expression, and a pulse-chase immunoprecipitation assay was used to measure the stability of EGF-R protein in HeLa cells and HeLa cells that had been transfected with the antisense E6/E7 or sense Rb sequences. Cell proliferation was measured by use of a tetrazolium-based colorimetric assay for numbers of viable cells. RESULTS: The introduction of sense Rb or antisense E6/E7 transcription units or a combination of these two transcription units into HeLa cells dramatically decreased the level of EGF-R proteins in these cells; EGF-R levels were not affected at the transcriptional level but at the post-transcriptional level. Addition of the anti-EGF-R-specific monoclonal antibody 225mAb to HeLa cells caused 53% (95% confidence interval = 44%-62%) growth inhibition. CONCLUSIONS: These results suggest that HeLa cervical carcinoma cells are dependent on EGF-R for proliferation and that changes in functional levels of the E6/E7 HPV proteins and endogenous Rb proteins may alter the growth rate of cervical cancer cell lines by reducing the stability of EGF-R at the post-transcriptional level.

Prognostic indicators of tumor response to Staphylococcus aureus Cowan strain I plasma perfusion.

Ten tumor-bearing dogs were treated with passage of autologous plasma over fixed Staphylococcus aureus Cowan strain I. Five similar dogs were treated identically except for the exposure to S. aureus. These animals have been assessed to identify positive and negative prognostic variables for response. Nonresponder treated animals had significantly larger chest wall tumor bulk than did the responder and control groups (P less than .01). Responder animals had fewer initial circulating immune complexes than did the nonresponders, though each group had similar reductions in immune complexes with therapy. Nonresponder animals had smaller volumes of plasma processed per kilogram of body weight per procedure than did controls (P = .016), whereas responder and control animals had similar volumes processed per kilogram of body weight per procedure (P = .84). These data suggest that the response observed in our original series was significantly related to the larger amount of plasma treated per procedure and suggest that a factor may be eluted from the S. aureus cartridge that mediates this response.

Cisplatin dose intensity in non-small cell lung cancer: phase II results of a day 1 and day 8 high-dose regimen.

Between October 1985 and March 1987, 92 patients were registered on a phase II study of the Northern California Oncology Group investigating the importance of dose intensity in the treatment of advanced non-small cell lung cancer (NSCLC). Treatment consisted of high-dose cisplatin in hypertonic saline (200 mg/m2 on a 28-day cycle) given in a divided day 1 and day 8 schedule. The response rate among 76 assessable patients was 36% (27/76), with complete response (CR) in 8% (6/76) and partial response (PR) in 28% (21/76). If all patients receiving any drug therapy were considered, the overall response rate was 31% (27/87), with CR in 7% (6/87) and PR in 24% (21/87). Median survival times for all assessable patients and all patients receiving any therapy were 37 and 35 weeks, respectively. With the use of a protocol design specifying dose delays rather than dose reduction for toxicity, the mean dose intensity delivered was 47.2 mg/m2 per week, or 94% of projected. Compared with other dose-intensive regimens of cisplatin, this day 1 and day 8 schedule was relatively well tolerated, with peripheral neuropathy as the dose-limiting toxicity. The data on response and median survival times among patients receiving this single-agent therapy are encouraging. They support the potential importance of cisplatin dose intensity in the treatment of NSCLC. Whether these results represent a positive dose-response effect in NSCLC will be tested in a randomized comparative trial of high-dose versus standard-dose cisplatin therapy.

Randomized trial of high-dose chemotherapy and blood cell autografts for high-risk primary breast carcinoma.

BACKGROUND: Uncontrolled studies have reported encouraging outcomes for patients with high-risk primary breast cancer treated with high-dose chemotherapy and autologous hematopoietic stem cell support. We conducted a prospective randomized trial to compare standard-dose chemotherapy with the same therapy followed by high-dose chemotherapy. PATIENTS AND METHODS: Patients with 10 or more positive axillary lymph nodes after primary breast surgery or patients with four or more positive lymph nodes after four cycles of primary (neoadjuvant) chemotherapy were eligible. All patients were to receive eight cycles of 5-fluorouracil, doxorubicin (Adriamycin), and cyclophosphamide (FAC). Patients were stratified by stage and randomly assigned to receive two cycles of high-dose cyclophosphamide, etoposide, and cisplatin with autologous hematopoietic stem cell support or no additional chemotherapy. Tamoxifen was planned for postmenopausal patients with estrogen receptor-positive tumors and chest wall radiotherapy was planned for all. All P values are from two-sided tests. RESULTS: Seventy-eight patients (48 after primary surgery and 30 after primary chemotherapy) were registered. Thirty-nine patients were randomly assigned to FAC and 39 to FAC followed by high-dose chemotherapy. After a median follow-up of 6.5 years, there have been 41 relapses. In intention-to-treat analyses, estimated 3-year relapse-free survival rates were 62% and 48% for FAC and FAC/high-dose chemotherapy, respectively (P =.35), and 3-year survival rates were 77% and 58%, respectively (P =.23). Overall, there was greater and more frequent morbidity associated with high-dose chemotherapy than with FAC; there was one septic death associated with high-dose chemotherapy. CONCLUSIONS: No relapse-free or overall survival advantage was associated with the use of high-dose chemotherapy, and morbidity was increased with its use. Thus, high-dose chemotherapy is not indicated outside a clinical trial.

Inactive p53 mutants may enhance the transcriptional activity of wild-type p53.

The p53 mutants 248Trp, 175His, and 281Gly fail to activate transcription mediated by p53CON element (GGACATGCCCGGGCATGTCC) or the ribosomal gene cluster element (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTT). We studied the effect of these inactive p53 mutants on the transcriptional activity of wild-type p53 by cotransfection of both wild-type and mutant p53 expression vectors into p53-null K562 chronic myelogenous leukemia cells. The p53 mutants enhanced the p53CON-mediated gene expression of wild-type p53 but decreased the wild-type p53-activated transcription mediated by ribosomal gene cluster. Thus, p53CON and ribosomal gene cluster represent distinct p53-binding elements. Furthermore, p53 mutants may affect the transcriptional activity of wild-type p53 in either a dominant positive or a dominant negative manner, depending on the binding element present.

Regression of canine mammary carcinoma after immunoadsorption therapy.

The plasma of dogs afflicted with mammary carcinoma was perfused through chambers bearing Staphylococcus aureus Cowan strain I in an attempt to remove tumor-promoting, immunosuppressive immune complexes from the peripheral blood of these animals. In this canine model of spontaneous mammary carcinoma, reduction of breast and/or soft-tissue tumor (posttreatment size equal to 0 to 50% of pretreatment tumor size) was observed in five of the ten animals so treated. Immune complexes capable of blocking lymphocytotoxicity were measured pre- and postimmunoadsorption; removal was more efficient in the five responders (four of six complexes) than in nonresponders (one of ten complexes), although statistical significance was not attained. The reduction of tumor size seen in soft-tissue sites was not always accompanied by a similar reduction of tumor size in visceral sites, and surgical resection of residual soft-tissue tumor nodules remaining after immunoadsorption treatment was required to achieve a complete response in two responding animals. No significant decrease in tumor size was observed in the control group, perfused without immunoadsorbent, nor in five additional tumor-bearing animals infused with normal dog plasma which had been passed through S. aureus Cowan strain I-containing chambers. These data indicate that immunoadsorption of tumor-bearing host plasma can result in reduction in size of canine mammary adenocarcinoma but that the response is dependent on the site of the tumor (s.c. versus visceral) and may require utilization of other modalities to achieve a complete disappearance of the tumor.

Changes in the translational activity of polyadenylated messenger RNA of HL60 promyelocytic leukemia cells associated with myeloid or macrophage differentiation.

In order to characterize the events which commit the HL60 human promyelocytic leukemia cell line to differentiate into macrophages or mature myeloid cells, we have analyzed the in vitro [35S]methionine-labeled translational products obtained from polyadenylated messenger RNA of the HL60 cells before and after exposure to: (a) dimethylformamide (DMF), an inducer of myeloid differentiation; (b) 12-O-tetradecanylphorbol-13-acetate (TPA), an inducer of macrophage differentiation; or (c) a combination of the two inducers. Exposure of the HL60 cells to either TPA or DMF results in decreases in the relative abundancy of translational products with molecular weights of 20,000, 17,000, and 15,000. Exposure of the HL60 cells so as to generate macrophage differentiation results in elevations of translational products with molecular weights of 60,000, 47,000, 42,000, 32,000, 27,000, 14,000, and 12,300, while DMF-induced myeloid differentiation is associated with increases in the abundancy of translational products with molecular weights of 60,000, 42,000, 35,000, 32,000, 27,000, 13,000 and 12,300. The addition of the macrophage inducer TPA to HL60 cells previously exposed to the myeloid inducer DMF results in changes in the relative abundance of several translational products, yielding a pattern which differs quantitatively from that obtained from cells treated with DMF or TPA alone. These changes in the relative abundancies of the HL60 translational products suggest that the steady state levels of several different populations of mRNA or the ability of these mRNAs to be translated are being modified during the induction of myeloid or macrophage differentiation in the HL60 promyelocytic leukemia cell line.