Mitochondrial DNA copy number variation across three generations: a possible biomarker for assessing perinatal outcomes.

BACKGROUND: Mitochondria have their own circular multi-copy genome (mtDNA), and abnormalities in the copy number are implicated in mitochondrial dysfunction, which contributes to a variety of aging-related pathologies. However, not much is known about the genetic correlation of mtDNA copy number across multiple generations and its physiological significance. METHODS: We measured the mtDNA copy number in cord blood or peripheral blood from 149 three-generation families, specifically the newborns, parents, and grandparents, of 149 families, totaling 1041 individuals. All of the biological specimens and information were provided by the Tohoku Medical Megabank Project in Japan. We also analyzed their maternal factors during pregnancy and neonatal outcomes. RESULTS: While the maternal peripheral blood mtDNA copy number was lower than that of other adult family members, it was negatively correlated with cord blood mtDNA copy number in male infants. Also, cord blood mtDNA copy numbers were negatively correlated with perinatal outcomes, such as gestation age, birth weight, and umbilical cord length, for both male and female neonates. Furthermore, the mtDNA copy number in the infants born to mothers who took folic acid supplements during pregnancy would be lower than in the infants born to mothers who did not take them. CONCLUSIONS: This data-driven study offers the most comprehensive view to date on the genetic and physiological significance of mtDNA copy number in cord blood or peripheral blood taken from three generations, totaling more than 1000 individuals. Our findings indicate that mtDNA copy number would be one of the transgenerational biomarkers for assessing perinatal outcomes, as well as that appropriate medical interventions could improve the outcomes via quantitative changes in mtDNA.

An Analytical Method for Quantifying the Yields of DNA Double-Strand Breaks Coupled with Strand Breaks by γ-H2AX Focus Formation Assay Based on Track-Structure Simulation.

Complex DNA double-strand break (DSB), which is defined as a DSB coupled with additional strand breaks within 10 bp in this study, induced after ionizing radiation or X-rays, is recognized as fatal damage which can induce cell death with a certain probability. In general, a DSB site inside the nucleus of live cells can be experimentally detected using the γ-H2AX focus formation assay. DSB complexity is believed to be detected by analyzing the focus size using such an assay. However, the relationship between focus size and DSB complexity remains uncertain. In this study, using Monte Carlo (MC) track-structure simulation codes, i.e., an in-house WLTrack code and a Particle and Heavy Ion Transport code System (PHITS), we developed an analytical method for qualifying the DSB complexity induced by photon irradiation from the microscopic image of γ-H2AX foci. First, assuming that events (i.e., ionization and excitation) potentially induce DNA strand breaks, we scored the number of events in a water cube (5.03 × 5.03 × 5.03 nm3) along electron tracks. Second, we obtained the relationship between the number of events and the foci size experimentally measured by the γ-H2AX focus formation assay. Third, using this relationship, we evaluated the degree of DSB complexity induced after photon irradiation for various X-ray spectra using the foci size, and the experimental DSB complexity was compared to the results estimated by the well-verified DNA damage estimation model in the PHITS code. The number of events in a water cube was found to be proportional to foci size, suggesting that the number of events intrinsically related to DSB complexity at the DNA scale. The developed method was applicable to focus data measured for various X-ray spectral situations (i.e., diagnostic kV X-rays and therapeutic MV X-rays). This method would contribute to a precise understanding of the early biological impacts of photon irradiation by means of the γ-H2AX focus formation assay.

Mitochondrial DNA Copy Number and Developmental Origins of Health and Disease (DOHaD).

Mitochondrial dysfunction is known to contribute to mitochondrial diseases, as well as to a variety of aging-based pathologies. Mitochondria have their own genomes (mitochondrial DNA (mtDNA)) and the abnormalities, such as point mutations, deletions, and copy number variations, are involved in mitochondrial dysfunction. In recent years, several epidemiological studies and animal experiments have supported the Developmental Origin of Health and Disease (DOHaD) theory, which states that the environment during fetal life influences the predisposition to disease and the risk of morbidity in adulthood. Mitochondria play a central role in energy production, as well as in various cellular functions, such as apoptosis, lipid metabolism, and calcium metabolism. In terms of the DOHaD theory, mtDNA copy number may be a mediator of health and disease. This paper summarizes the results of recent epidemiological studies on the relationship between environmental factors and mtDNA copy number during pregnancy from the perspective of DOHaD theory. The results of these studies suggest a hypothesis that mtDNA copy number may reflect environmental influences during fetal life and possibly serve as a surrogate marker of health risks in adulthood.

No Intercellular Regulation of the Cell Cycle among Human Cervical Carcinoma HeLa Cells Expressing Fluorescent Ubiquitination-Based Cell-Cycle Indicators in Modulated Radiation Fields.

The non-targeted effects of radiation have been known to induce significant alternations in cell survival. Although the effects might govern the progression of tumor sites following advanced radiotherapy, the impacts on the intercellular control of the cell cycle following radiation exposure with a modified field, remain to be determined. Recently, a fluorescent ubiquitination-based cell-cycle indicator (FUCCI), which can visualize the cell-cycle phases with fluorescence microscopy in real time, was developed for biological cell research. In this study, we investigated the non-targeted effects on the regulation of the cell cycle of human cervical carcinoma (HeLa) cells with imperfect p53 function that express the FUCCI (HeLa-FUCCI cells). The possible effects on the cell-cycle phases via soluble factors were analyzed following exposure to different field configurations, which were delivered using a 150 kVp X-ray irradiator. In addition, using synchrotron-generated, 5.35 keV monochromatic X-ray microbeams, high-precision 200 µm-slit microbeam irradiation was performed to investigate the possible impacts on the cell-cycle phases via cell-cell contacts. Collectively, we could not detect the intercellular regulation of the cell cycle in HeLa-FUCCI cells, which suggested that the unregulated cell growth was a malignant tumor. Our findings indicated that there was no significant intercellular control system of the cell cycle in malignant tumors during or after radiotherapy, highlighting the differences between normal tissue and tumor characteristics.

Hokkaido birth cohort study on environment and children's health: cohort profile 2021.

BACKGROUND: The Hokkaido Study on Environment and Children's Health is an ongoing study consisting of two birth cohorts of different population sizes: the Sapporo cohort and the Hokkaido cohort. Our primary objectives are to (1) examine the effects that low-level environmental chemical exposures have on birth outcomes, including birth defects and growth retardation; (2) follow the development of allergies, infectious diseases, and neurobehavioral developmental disorders, as well as perform a longitudinal observation of child development; (3) identify high-risk groups based on genetic susceptibility to environmental chemicals; and (4) identify the additive effects of various chemicals, including tobacco. METHODS: The purpose of this report is to provide an update on the progress of the Hokkaido Study, summarize recent results, and suggest future directions. In particular, this report provides the latest details from questionnaire surveys, face-to-face examinations, and a collection of biological specimens from children and measurements of their chemical exposures. RESULTS: The latest findings indicate different risk factors of parental characteristics on birth outcomes and the mediating effect between socioeconomic status and children that are small for the gestational age. Maternal serum folate was not associated with birth defects. Prenatal chemical exposure and smoking were associated with birth size and growth, as well as cord blood biomarkers, such as adiponectin, leptin, thyroid, and reproductive hormones. We also found significant associations between the chemical levels and neuro development, asthma, and allergies. CONCLUSIONS: Chemical exposure to children can occur both before and after birth. Longer follow-up for children is crucial in birth cohort studies to reinforce the Developmental Origins of Health and Disease hypothesis. In contrast, considering shifts in the exposure levels due to regulation is also essential, which may also change the association to health outcomes. This study found that individual susceptibility to adverse health effects depends on the genotype. Epigenome modification of DNA methylation was also discovered, indicating the necessity of examining molecular biology perspectives. International collaborations can add a new dimension to the current knowledge and provide novel discoveries in the future.

Diversity of ATM gene variants: a population-based genome data analysis for precision medicine.

BACKGROUND: Ataxia-telangiectasia (AT) is a rare autosomal recessive disorder that causes deficiency or dysfunction of the ataxia-telangiectasia mutated (ATM) protein. Not only AT patients, but also certain ATM heterozygous mutation carriers show a significantly reduced life expectancy due to cancer and ischemic heart disease; in particular, female carriers having particular alleles have an increased risk of breast cancer. The frequency of such risk heterozygotes at a population level remains to be fully determined, and evidence-based preventive medical guidelines have not yet been established. METHODS: Using the 3.5KJPNv2 allele frequency panel of Japanese Multi Omics Reference Panel v201902, which shows single-nucleotide variant (SNV) and insertion/deletion (INDEL) allele frequencies from 3552 Japanese healthy individuals, we investigated the diversity of ATM gene variants. RESULTS: We detected 2845 (2370 SNV and 475 INDEL) variants in the ATM gene, including 1338 (1160 SNV and 178 INDEL) novel variants. Also, we found a stop-gained SNV (NC_000008.11:g.108115650G > A (p.Trp266*)) and a disruptive-inframe-deletion (NC_000008.11:g. 108181014AAGAAAAGTATGGATGATCAAG/A (p.Ala1945_Phe1952delinsVal) and two frameshift INDELs (NC_000008.11:g.108119714CAA/C (p.Glu376fs) and NC_000008.11:g.108203577CTTATA/C (p.Ile2629fs)), which would be novel variants predicted to lead to loss of ATM functionality. CONCLUSION: The combination of population-based biobanking and human genomics provided a novel insight of diversity of ATM gene variants at a population level. For the advancement of precision medicine, such approach will be useful to predict novel pathogenic/likely pathogenic variants in the ATM gene and to establish preventive medical guidelines for certain ATM heterozygotes pertaining to their risk of particular diseases.

The Effect of Low Temperatures on Environmental Radiation Damage in Living Systems: Does Hypothermia Show Promise for Space Travel?

Low-temperature treatments (i.e., hypothermia) may be one way of regulating environmental radiation damage in living systems. With this in mind, hibernation under hypothermic conditions has been proposed as a useful approach for long-term human space flight. However, the underlying mechanisms of hypothermia-induced radioresistance are as yet undetermined, and the conventional risk assessment of radiation exposure during hibernation remains insufficient for estimating the effects of chronic exposure to galactic cosmic rays (GCRs). To promote scientific discussions on the application of hibernation in space travel, this literature review provides an overview of the progress to date in the interdisciplinary research field of radiation biology and hypothermia and addresses possible issues related to hypothermic treatments as countermeasures against GCRs. At present, there are concerns about the potential effects of chronic radiation exposure on neurological disorders, carcinogenesis, ischemia heat failures, and infertility in astronauts; these require further study. These concerns may be resolved by comparing and integrating data gleaned from experimental and epidemiological studies.

Alzheimer's Disease and Specialized Pro-Resolving Lipid Mediators: Do MaR1, RvD1, and NPD1 Show Promise for Prevention and Treatment?

Alzheimer's disease (AD) is a common neurodegenerative disease and a major contributor to progressive cognitive impairment in an aging society. As the pathophysiology of AD involves chronic neuroinflammation, the resolution of inflammation and the group of lipid mediators that actively regulate it-i.e., specialized pro-resolving lipid mediators (SPMs)-attracted attention in recent years as therapeutic targets. This review focuses on the following three specific SPMs and summarizes their relationships to AD, as they were shown to effectively address and reduce the risk of AD-related neuroinflammation: maresin 1 (MaR1), resolvin D1 (RvD1), and neuroprotectin D1 (NPD1). These three SPMs are metabolites of docosahexaenoic acid (DHA), which is contained in fish oils and is thus easily available to the public. They are expected to become incorporated into promising avenues for preventing and treating AD in the future.

Precision Radiotherapy and Radiation Risk Assessment: How Do We Overcome Radiogenomic Diversity?

Precision medicine is a rapidly developing area that aims to deliver targeted therapies based on individual patient characteristics. However, current radiation treatment is not yet personalized; consequently, there is a critical need for specific patient characteristics of both tumor and normal tissues to be fully incorporated into dose prescription. Furthermore, current risk assessment following environmental, occupational, or accidental exposures to radiation is based on population effects, and does not account for individual diversity underpinning radiosensitivity. The lack of personalized approaches in both radiotherapy and radiation risk assessment resulted in the current situation where a population-based model, effective dose, is being used. In this review article, to stimulate scientific discussion for precision medicine in both radiotherapy and radiation risk assessment, we propose a novel radiological concept and metric - the personalized dose and the personalized risk index - that incorporate individual physiological, lifestyle-related and genomic variations and radiosensitivity, outlining the potential clinical application for precision medicine. We also review on recent progress in both genomics and biobanking research, which is promising for providing novel insights into individual radiosensitivity, and for creating a novel conceptual framework of precision radiotherapy and radiation risk assessment.

Non-uniform radiation-induced biological responses at the tissue level involved in the health risk of environmental radiation: a radiobiological hypothesis.

BACKGROUND: The conventional concept of radiation protection is based on epidemiological studies of radiation that support a positive correlation between dose and response. However, there is a remarkable difference in biological responses at the tissue level, depending on whether radiation is delivered as a uniform or non-uniform spatiotemporal distribution due to tissue sparing effects (TSE). From the point of view of radiation micro-dosimetry, environmental radiation is delivered as a non-uniform distribution, and radiation-induced biological responses at the tissue level, such as TSE, would be implicated in individual risk following exposure to environmental radiation. HYPOTHESIS: We hypothesize that the health risks of non-uniform radiation exposure are lower than the same dose at a uniform exposure, due to TSE following irradiation. Testing the hypothesis requires both radiobiological studies using high-precision microbeams and the epidemiological data of environmental radiation-induced effects. The implications of the hypothesis will lead to more personalized approaches in the field of environmental radiation protection. CONCLUSION: The detection of spatiotemporal dose distribution could be of scientific importance for more accurate individual risk assessment of exposure to environmental radiation. Further radiobiological studies on non-uniform radiation-induced biological responses at the tissue level are expected.

Radiobiological Implications of Fukushima Nuclear Accident for Personalized Medical Approach.

On March 11, 2011, a devastating earthquake and subsequent tsunami caused serious damage to areas of the Pacific coast in Fukushima prefecture and prompted fears among the residents about a possible meltdown of the Fukushima Daiichi Nuclear Power Plant reactors. As of 2017, over six years have passed since the Fukushima nuclear crisis and yet the full ramifications of the biological exposures to this accidental release of radioactive substances remain unclear. Furthermore, although several genetic studies have determined that the variation in radiation sensitivity among different individuals is wider than expected, personalized medical approaches for Fukushima victims have seemed to be insufficient. In this commentary, we discuss radiobiological issues arising from low-dose radiation exposure, from the cell-based to the population level. We also introduce the scientific utility of the Integrative Japanese Genome Variation Database (iJGVD), an online database released by the Tohoku Medical Megabank Organization, Tohoku University that covered the whole genome sequences of 2,049 healthy individuals in the northeastern part of Japan in 2016. Here we propose a personalized radiation risk assessment and medical approach, which considers the genetic variation of radiation sensitivity among individuals, for next-step developments in radiological protection.

Mental Health Crisis in Northeast Fukushima after the 2011 Earthquake, Tsunami and Nuclear Disaster.

The great earthquake of 11 March 2011 and resulting tsunami caused serious damage to various areas of the Pacific coast in northeast Fukushima, and all the residents faced fears of meltdown of the reactors at the Fukushima Daiichi Nuclear Power Plant. One of the most seriously affected areas was the district of Soso, located in the northeast part of Fukushima prefecture, with 12 municipalities (Soma City, Minamisoma City, Shinchi Town, Namie Town, Futaba Town, Okuma Town, Tomioka Town, Naraha Town, Hirono Town, Iitate Village, Katsurao Village and Kawauchi Village). The district of Soso is home to approximately 200,000 residents, many of whom were seriously affected by the threefold disaster. During the subsequent four years, the population of Soso decreased by nearly 10%. In March 2011 before the disaster, five hospitals and two clinics for psychiatric patients, along with 712 inpatients, were operating in the district of Soso. However, as of March 2015, there were only one hospital and three clinics, along with approximately 50 inpatients, although a new mental health clinic in Soma City was opened in 2012 for supporting victims suffering from the disaster. We hereby suggest that the patients and residents of northeast Fukushima may be undergoing mental health crisis. In fact, disaster-related psychological stress could have induced several physical and mental disorders. The mid- and long-term supports are urgently needed not only for psychiatric patients but also for all residents in the district of Soso.

Evaluation of Cell Cycle-Dependent Migration Activity after X-ray Exposure: A Radiobiological Approach for Optimization of Radiotherapy with Cell Cycle-Targeting Agents.

Radiotherapy with cell cycle-specific anticancer agents has become an important option in the control of both primary tumors and metastases. Here, we used image analysis algorithms that enable quick segmentation and tracking to describe a radiobiological approach for the optimized selection of cell cycle-targeting anticancer drugs for radiotherapy. We confirmed cell cycle-synchronization using human cervical cancer HeLa cells expressing a fluorescent ubiquitination-based cell cycle indicator (FUCCI) as a cell cycle-monitoring probe. Cells synchronized in the G1 and G2 phases were irradiated with X rays at 0.5-2 Gy. Each cell was identified using Cellpose, a deep learning-based algorithm for cellular segmentation, and the velocity and direction of migration were analyzed using the TrackMate plugin in Fiji ImageJ. G1 phase synchronized cells showed a dose-dependent decrease in velocity after irradiation, while G2 cells tended to increase their velocity. The migration pattern of all cells appeared to be a random walk model, regardless of the exposure dose. In addition, we used cisplatin to arrest the cell cycle. HeLa-FUCCI cells arrested at the G2 phase via cisplatin treatment showed enhanced cell migration after X-ray exposure. These results indicated that anticancer agents that arrest the cell cycle of cancer cells in a specific phase may enhance cell migration after radiotherapy. Our approach, using cellular segmentation and tracking algorithms, could enhance the radiobiological assessment of cell cycle-specific migration after irradiation to aid in optimizing radiotherapy using cell cycle-targeting agents.

Reply to comment on 'Modeling for predicting survival fraction of cells after ultra-high dose rate irradiation'.

Liew and Mairani commented on our paper 'Modeling for predicting survival fraction of cells after ultra-high dose rate irradiation' (Shiraishiet al2024aPhys. Med. Biol.69015017), which proposed a biophysical model to predict the dose-response curve of surviving cell fractions after ultra-high dose rate irradiation following conventional dose rate irradiation by considering DNA damage yields. They suggested the need to consider oxygen concentration in our prediction model and possible issues related to the data selection process used for the benchmarking test in our paper. In this reply, we discuss the limitations of both the present model and the available experimental data for determining the model's parameters. We also demonstrate that our proposed model can reproduce the experimental survival data even when using only the experimental DNA damage data measured reliably under normoxic conditions.

Possible mechanisms and simulation modeling of FLASH radiotherapy.

FLASH radiotherapy (FLASH-RT) has great potential to improve patient outcomes. It delivers radiation doses at an ultra-high dose rate (UHDR: ≥ 40 Gy/s) in a single instant or a few pulses. Much higher irradiation doses can be administered to tumors with FLASH-RT than with conventional dose rate (0.01-0.40 Gy/s) radiotherapy. UHDR irradiation can suppress toxicity in normal tissues while sustaining antitumor efficiency, which is referred to as the FLASH effect. However, the mechanisms underlying the effects of the FLASH remain unclear. To clarify these mechanisms, the development of simulation models that can contribute to treatment planning for FLASH-RT is still underway. Previous studies indicated that transient oxygen depletion or augmented reactions between secondary reactive species produced by irradiation may be involved in this process. To discuss the possible mechanisms of the FLASH effect and its clinical potential, we summarized the physicochemical, chemical, and biological perspectives as well as the development of simulation modeling for FLASH-RT.

Cell cycle dependence of cell survival following exposure to X-rays in synchronous HeLa cells expressing fluorescent ubiquitination-based cell cycle indicators.

The cell cycle dependence of radiosensitivity has yet to be fully determined, as it is technically difficult to achieve a high degree of cell cycle synchronization in cultured cell systems and accurately detect the cell cycle phase of individual cells simultaneously. We used human cervical carcinoma HeLa cells expressing fluorescent ubiquitination-based cell cycle indicators (FUCCI), and employed the mitotic harvesting method that is one of the cell cycle synchronization methods. The imaging analysis confirmed that the cell cycle is highly synchronized after mitotic cell harvesting until 18-20 h of the doubling time has elapsed. Also, flow cytometry analysis revealed that the S and G2 phases peak at approximately 12 and 14-16 h, respectively, after mitotic harvesting. In addition, the clonogenic assay showed the changes in surviving fractions following exposure to X-rays according to the progress through the cell cycle. These results indicate that HeLa-FUCCI cells become radioresistant in the G1 phase, become radiosensitive in the early S phase, rapidly become radioresistant in the late S phase, and become radiosensitive again in the G2 phase. Our findings may contribute to the further development of combinations of radiation and cell cycle-specific anticancer agents.

Validation of mitotic harvesting method with human cervical carcinoma HeLa cells expressing fluorescent ubiquitination-based cell cycle indicators for radiation research.

The cell cycle is a series of events in the process of one cell giving rise to two daughter cells. The mitotic harvesting method, established by Terasima and Tolmach in the 1960s, causes minimal physiological stress on the cells and achieves a high degree of cell cycle synchrony by collecting only mitotic cells from a cultured cell system. The purpose of the present study is to validate the versatility of the mitotic harvesting method using human cervical cell line HeLa cells expressing Fluorescent Ubiquitination-based Cell Cycle Indicators (FUCCI) and to estimate the cell cycle-dependent changes in radiosensitivity in HeLa-FUCCI cells. The image analysis showed that cell cycle synchrony was maintained for at least 24 hours after mitotic cell collection. Also, the clonogenic assay demonstrated changes in radiosensitivity that were cell cycle dependent. These results indicate that the mitotic harvesting method using FUCCI-expressing cells has high versatility in the field of radiation cell biology.

Modeling for predicting survival fraction of cells after ultra-high dose rate irradiation.

Objective. FLASH radiotherapy (FLASH-RT) with ultra-high dose rate (UHDR) irradiation (i.e. > 40 Gy s-1) spares the function of normal tissues while preserving antitumor efficacy, known as the FLASH effect. The biological effects after conventional dose rate-radiotherapy (CONV-RT) with ≤0.1 Gy s-1have been well modeled by considering microdosimetry and DNA repair processes, meanwhile modeling of radiosensitivities under UHDR irradiation is insufficient. Here, we developed anintegrated microdosimetric-kinetic(IMK)model for UHDR-irradiationenabling the prediction of surviving fraction after UHDR irradiation.Approach.TheIMK model for UHDR-irradiationconsiders the initial DNA damage yields by the modification of indirect effects under UHDR compared to CONV dose rate. The developed model is based on the linear-quadratic (LQ) nature with the dose and dose square coefficients, considering the reduction of DNA damage yields as a function of dose rate.Main results.The estimate by the developed model could successfully reproduce thein vitroexperimental dose-response curve for various cell line types and dose rates.Significance.The developed model would be useful for predicting the biological effects under the UHDR irradiation.

How does formal and informal industry contribute to lead exposure? A narrative review from Vietnam, Uruguay, and Malaysia.

INTRODUCTION: Lead industries are one of the major sources of environmental pollution and can affect human through different activities, including industrial processes, metal plating, mining, battery recycling, etc. Although different studies have documented the various sources of lead exposure, studies highlighting different types of industries as sources of environmental contamination are limited. Therefore, this narrative review aims to focus mainly on lead industries as significant sources of environmental and human contamination. CONTENT: Based on the keywords searched in bibliographic databases we found 44 relevant articles that provided information on lead present in soil, water, and blood or all components among participants living near high-risk areas. We presented three case scenarios to highlight how lead industries have affected the health of citizens in Vietnam, Uruguay, and Malaysia. SUMMARY AND OUTLOOK: Factories conducting mining, e-waste processing, used lead-acid battery recycling, electronic repair, and toxic waste sites were the primary industries for lead exposure. Our study has shown lead exposure due to industrial activities in Vietnam, Uruguay, Malaysia and calls for attention to the gaps in strategic and epidemiologic efforts to understand sources of environmental exposure to lead fully. Developing strategies and guidelines to regulate industrial activities, finding alternatives to reduce lead toxicity and exposure, and empowering the public through various community awareness programs can play a crucial role in controlling exposure to lead.

A brief overview of the registration system of radiation exposure doses for decontamination workers and their occupational health management.

Following the Fukushima nuclear accident in March 2011, decontamination and related works have been carried out over a wide area, mainly in Fukushima Prefecture. In November 2013, the Radiation Dose Registration and Management System for Decontamination Workers was established to manage the occupational exposure doses of workers engaged in such work. The Radiation Effects Association mainly operates the registration system. This paper summarizes existing reports on this system and occupational health issues among decontamination workers. We collected previous reports and related regulatory laws on occupational health management for decontamination workers working in Fukushima Prefecture, summarized the outline of the radiation dose registration and management system for these decontamination workers, and discussed future issues related to their health management. Approximately 100 000 decontamination workers were registered in the system as of 2020, but none showed radiation doses that exceeded the dose limit. To our knowledge, there have been no reports of decontamination workers presenting physical symptoms suspected to be related to radiation exposure. On the other hand, heatstroke countermeasures and anxiety about radiation exposure have been reported as possible issues in the occupational health management of decontamination workers. Although decontamination workers are unlikely to experience biological effects from radiation exposure, epidemiological studies are needed to examine this evidence. Further analysis is also needed on non-radiation effects, which pose occupational health concerns for decontamination workers. The registration system would allow for tracking decontamination workers, providing data for analyzing radiological and non-radiological effects.