A hot Jupiter orbiting a 2-million-year-old solar-mass T Tauri star.

Hot Jupiters are giant Jupiter-like exoplanets that orbit their host stars 100 times more closely than Jupiter orbits the Sun. These planets presumably form in the outer part of the primordial disk from which both the central star and surrounding planets are born, then migrate inwards and yet avoid falling into their host star. It is, however, unclear whether this occurs early in the lives of hot Jupiters, when they are still embedded within protoplanetary disks, or later, once multiple planets are formed and interact. Although numerous hot Jupiters have been detected around mature Sun-like stars, their existence has not yet been firmly demonstrated for young stars, whose magnetic activity is so intense that it overshadows the radial velocity signal that close-in giant planets can induce. Here we report that the radial velocities of the young star V830 Tau exhibit a sine wave of period 4.93 days and semi-amplitude 75 metres per second, detected with a false-alarm probability of less than 0.03 per cent, after filtering out the magnetic activity plaguing the spectra. We find that this signal is unrelated to the 2.741-day rotation period of V830 Tau and we attribute it to the presence of a planet of mass 0.77 times that of Jupiter, orbiting at a distance of 0.057 astronomical units from the host star. Our result demonstrates that hot Jupiters can migrate inwards in less than two million years, probably as a result of planet­disk interactions.

First Report of Rice yellow mottle virus on Rice in the Democratic Republic of Congo.

Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5'CTCCCCCACCCATCCCGAGAATT3' and 5'CAAAGATGGCCAGGAA3' (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) I. Ndikumana et al. Plant Dis. 96:1230, 2012. (3) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

First Report of Rice yellow mottle virus on Rice in Burundi.

Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5'CGCTCAACATCCTTTTCAGGGTAG3' and 5'CAAAGATGGCCAGGAA3' (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.

Pattern Recognition of Chemical Waves: Finding the Activation Energy of the Autocatalytic Step in the Belousov-Zhabotinsky Reaction.

The Belousov-Zhabotinsky (BZ) reaction is an example of a homogeneous, nonequilibrium reaction used commonly as a model for the study of biological structure and morphogenesis. We report the experimental effects of temperature on spontaneously nucleated trigger waves in a quasi-two-dimensional BZ reaction-diffusion system, conducted isothermally at temperatures between 9.9 and 43.3 °C. Novel application of filter-coupled circle finding and localized pattern analysis is shown to allow the highly accurate extraction of average radial wave velocity and nucleation period. Using this, it is possible to verify a strong Arrhenius dependence of average wave velocity with temperature, which is used to find the effective activation energy of the reaction in accordance with predictions elaborated from the widely used Oregonator model of the BZ reaction. On the basis of our experimental results and existing theoretical models, the value for activation energy of the important self-catalyzed step in the Oregonator model is determined to be 86.58 ± 4.86 kJ mol-1, within range of previous theoretical prediction.

Near-Complete Genome Sequences of Rice Yellow Mottle Virus Isolates from Senegal.

Rice yellow mottle virus in Senegal is reported here for the first time. The near-complete genomic sequences of two isolates (Se1 and Se5) were obtained. A comparison with 18 sequences from West Africa revealed a new cluster with an isolate from Gambia, located at a basal position in the phylogenetic tree.

Rice yellow mottle virus, an RNA plant virus, evolves as rapidly as most RNA animal viruses.

The rate of evolution of an RNA plant virus has never been estimated using temporally spaced sequence data, by contrast to the information available on an increasing range of animal viruses. Accordingly, the evolution rate of Rice yellow mottle virus (RYMV) was calculated from sequences of the coat protein gene of isolates collected from rice over a 40-year period in different parts of Africa. The evolution rate of RYMV was estimated by pairwise distance linear regression on five phylogeographically defined groups comprising a total of 135 isolates. It was further assessed from 253 isolates collected all over Africa by Bayesian coalescent methods under strict and relaxed molecular clock models and under constant size and skyline population genetic models. Consistent estimates of the evolution rate between 4 x 10(-4) and 8 x 10(-4) nucleotides (nt)/site/year were obtained whatever method and model were applied. The synonymous evolution rate was between 8 x 10(-4) and 11 x 10(-4) nt/site/year. The overall and synonymous evolution rates of RYMV were within the range of the rates of 50 RNA animal viruses, below the average but above the distribution median. Experimentally, in host change studies, substitutions accumulated at an even higher rate. The results show that an RNA plant virus such as RYMV evolves as rapidly as most RNA animal viruses. Knowledge of the molecular clock of plant viruses provides methods for testing a wide range of biological hypotheses.

How measurements of rate coefficients at low temperature increase the predictivity of photochemical models of Titan's atmosphere.

The predictivity of photochemical models of Titan's atmosphere depends strongly on the precision and accuracy of reaction rates. For many reactions, large uncertainty results from the extrapolation of rate laws to low temperatures. A few reactions have been measured directly at temperatures relevant to Titan's atmosphere. In the present study, we observed the consequences of the reduced uncertainty attributed to these reactions. The global predictivity of the model was improved, i.e., most species are predicted with lower uncertainty factors. Nevertheless, high uncertainty factors are still observed, and a new list of key reactions has been established.

Processes of diversification and dispersion of rice yellow mottle virus inferred from large-scale and high-resolution phylogeographical studies.

Phylogeography of Rice yellow mottle virus (RYMV) was reconstructed from the coat protein gene sequences of a selection of 173 isolates from the 14 countries of mainland Africa where the disease occurred and from the full sequences of 16 representative isolates. Genetic variation was linked to geographical distribution and not to host species as isolates from wild rice always clustered with isolates from cultivated rice of the same region. Genetic variation was not associated to agro-ecology, viral interference and insect vector species. Distinct RYMV lineages occurred in East, Central and West Africa, although the Central African lineage included isolates from Benin, Togo and Niger at the west, adjacent to countries of the West African lineage. Genetic subdivision at finer geographical scales was apparent within lineages of Central and West Africa, although less pronounced than in East Africa. Physical obstacles, but also habitat fragmentation, as exemplified by the small low-lying island of Pemba offshore Tanzania mainland, explained strain localization. Three new highly divergent strains were found in eastern Tanzania. By contrast, intensive surveys in Cote d'Ivoire and Guinea at the west of Africa did not reveal any new variant. Altogether, this supported the view that the Eastern Arc Mountains biodiversity hotspot was the centre of origin of RYMV and that the virus spread subsequently from east to west across Africa. In West Africa, specific strains occurred in the Inner Niger Delta and suggested it was a secondary centre of diversification. Processes for diversification and dispersion of RYMV are proposed.

Biochemical characterization of the helper component of Cauliflower mosaic virus.

The helper component of Cauliflower mosaic virus is encoded by viral gene II. This protein (P2) is dispensable for virus replication but required for aphid transmission. The purification of P2 has never been reported, and hence its biochemical properties are largely unknown. We produced the P2 protein via a recombinant baculovirus with a His tag fused at the N terminus. The fusion protein was purified by affinity chromatography in a soluble and biologically active form. Matrix-assisted laser desorption time-of-flight mass spectrometry demonstrated that P2 is not posttranslationally modified. UV circular dichroism revealed the secondary structure of P2 to be 23% alpha-helical. Most alpha-helices are suggested to be located in the C-terminal domain. Using size exclusion chromatography and aphid transmission testing, we established that the active form of P2 assembles as a huge soluble oligomer containing 200 to 300 subunits. We further showed that P2 can also polymerize as long paracrystalline filaments. We mapped P2 domains involved in P2 self-interaction, presumably through coiled-coil structures, one of which is proposed to form a parallel trimer. These regions have previously been reported to also interact with viral P3, another protein involved in aphid transmission. Possible interference between the two types of interaction is discussed with regard to the biological activity of P2.