Adolescent lung function associated with incense burning and other environmental exposures at home.

Incense burning is a popular cultural and religious practice, but whether exposure to incense smoke has effects on lung function is unclear. We investigated association between lung function and incense burning exposure and other household exposures in adolescents who participated in a mass asthma-screening program. Information on asthmatic status and associated factors was obtained from parent-completed questionnaires and student-completed video questionnaires. Approximately 10% of students received lung function examinations. Valid lung function data of 5010 students aged 14-16 years in northern Taiwan were analyzed. Forced vital capacity (FVC) and forced expiratory flow in 1 second (FEV1 ) were compared by incense burning status and other types of exposures for adolescents. Overall, 70.6% of students were exposed to incense smoke at home. The mean FVC and FEV1 measures were lower among adolescents with daily exposure to incense burning than those without such exposure (P<.05). Sharing bedroom was also associated with decreased FVC and FEV1 . After controlling for confounding factors, multivariable linear regression analysis with generalized estimation equation showed that FVC was negatively associated with daily exposure to incense burning, sharing a bedroom, and living in a house adjacent to a traffic road. Such associations were also observed in FEV1 . Daily exposure to incense burning is associated with impaired adolescent lung function.

Pulsar glitches: the crust is not enough.

Pulsar glitches are traditionally viewed as a manifestation of vortex dynamics associated with a neutron superfluid reservoir confined to the inner crust of the star. In this Letter we show that the nondissipative entrainment coupling between the neutron superfluid and the nuclear lattice leads to a less mobile crust superfluid, effectively reducing the moment of inertia associated with the angular momentum reservoir. Combining the latest observational data for prolific glitching pulsars with theoretical results for the crust entrainment, we find that the required superfluid reservoir exceeds that available in the crust. This challenges our understanding of the glitch phenomenon, and we discuss possible resolutions to the problem.

Inhibitory Effects of Chinese Medicinal Herbs on Plant-Pathogenic Bacteria and Identification of the Active Components from Gallnuts of Chinese Sumac.

The aqueous extracts of 30 out of 67 Chinese medicinal herbs were shown to have inhibitory effects on growth of Xanthomonas euvesicatoria by a paper disc diffusion assay. The inhibitory substances with the strongest antibacterial activity were extracted from Chinese sumac gallnut and black myrobalan. The aqueous extract of gallnut inhibited the growth of eight of the tested plant-pathogenic bacteria, and that of black myrobalan inhibited five. The gallnut extract produced at least an 8-mm inhibition zone against Acidovorax citrulli, Ralstonia solanacearum, X. citri pv. citri, and X. euvesicatoria at a 10-fold dilution, and it was still active at 800- to 1,600-fold dilutions. The aqueous extract of gallnut was more inhibitory than the acetone-water extract. To identify the inhibitory compounds in the gallnut aqueous extract, the crude extract was chromatographed over a silica column, and the primary compounds in fractions 3 and 8 were identified by nuclear magnetic resonance as gallic acid and methyl gallate, respectively. The inhibitory effect of methyl gallate on the growth of four plant-pathogenic bacteria was 10 to 80 times that of gallic acid. The minimum inhibition and minimum bactericidal concentration tests showed that the inhibition effect of the original aqueous was higher than that of methyl gallate. These results indicate that methyl gallate in gallnut is an important compound that is inhibitory to plant-pathogenic bacterial growth, and there are other unidentified compounds that are also responsible for the antibacterial effects. This is the first report regarding the antibacterial effects of gallnut extract and its chemical components on plant-pathogenic bacteria.

First Report of Leaf Blight on Calathea picturata Caused by Exserohilum rostratum in Taiwan.

Many Calathea species in the family Marantaceae are beautiful ornamental plants with variegated foliage. Among them, C. picturata 'Argentea', an evergreen perennial that has pale green leaves with dark green margins and a red underside, is a popular houseplant in Taiwan. In 2004, a new foliage disease that caused leaf blight of C. picturata 'Argentea' was first observed in a nursery in southern Taiwan. Initial symptoms were tiny, brown spots that appeared on the leaves of all ages, which quickly enlarged and coalesced. These necrotic lesions spread to cover the entire leaves in high temperature and moisture conditions and caused leaves to shrivel and eventually die. A dematiaceous hyphomycete with multicelled conidia was consistently isolated from the diseased leaves after being surfaced sterilized with 10% Clorox and placed on vegetable juice agar (10% V8 juice, 0.02% CaCO3, and 2% agar [VJA]). Pathogenicity of the isolate was tested by spraying 'Argentea' calathea leaves with a conidia suspension (1.6 × 105 conidia/ml) prepared from a culture grown on VJA at 28°C for 7 days. Plant leaves sprayed with distilled water were used as a control. Three pots of 15-cm high 'Argentea' calathea plants were inoculated with 10 ml of a conidia suspension and the experiment was conducted twice at 28°C and 90% relative humidity in a growth chamber. Tiny, brown spots started to show on all inoculated leaves 5 days after inoculation and the progression of symptom development was similar to that observed in nature. Control leaves remained asymptomatic. The same dematiaceous hyphomycete fungus was reisolated from 13 of 16 disease tissues taken from four symptomatic leaves. A colony of the calathea isolate was olive green when grown on potato dextrose agar (PDA) and conidia production was observed 7 days after incubation in darkness. The conidiophores were either branches from or the ends of normal mycelium, some of them geniculate with conidium produced at each bend measuring 142 to 602 (340) × 3 to 6 (4) µm on disease tissues and 51 to 150 (103) × 3 to 5 (4) µm on PDA. Conidia were multicelled with protruding hilum at the base, terminal cells thickened, olivaceous brown or golden brown in fusiform shape with blunt tips, 5 to 11 septate on disease tissues and 6 to 11 septate on PDA, measuring 46 to 166 (95) × 8 to 19 (13) µm on disease tissues and 58 to 145 (94) × 6 to 15 (11) µm on PDA, germinating by producing germ tubes semiaxially from each end. Morphological characteristics of the calathea isolate fit the description of the genus Exserohilum (2). Comparison of rDNA internal transcribed spacer (ITS) sequence of the calathea isolate with those in GenBank revealed that it shared 99.5% (549 of 552) similarity with a published sequence (GenBank Accession No. EU571210) (3) and Exserohilum rostratum was its closest species. ITS sequence analysis was done as previously described (1). Morphological and molecular data identified the pathogen as E. rostratum (Drechs.) Leonard & Suggs (= Bipolaris rostrata (Drechs.) Shoemaker). To our knowledge, this is the first report of leaf blight caused by E. rostratum on C. picturata in Taiwan. References: (1) L. L. Chern et al. Plant Dis. 94:1164, 2010. (2) K. J. Leonard. Mycologia 68:402, 1976. (3) R. Sappapan et al. J. Nat. Prod. 71:1657, 2008.

Left atrial enlargement induced by pure mitral regurgitation: time frame in a new swine model.

BACKGROUND: Atrial enlargement occurs in patients with significant mitral regurgitation. However, the time frame of the development of atrial enlargement induced by mitral regurgitation remains unknown. METHODS: Fourteen Lanyu miniature pigs (age = 6.6 ± 0.9 months) were studied. Mitral regurgitation was created by placing a predefined hole on the middle scallop of the posterior mitral leaflet under cardiopulmonary bypass. The parasternal long-axis atrial dimension was measured by transthoracic echocardiographic examinations. RESULTS: All animals exhibited grade 3 mitral regurgitation immediately after surgery. Seven pigs expired within 2 weeks after the operation [technical complications (n = 1), acute cardiac tamponade (n = 1), and acute and subacute heart failure (n = 5)]. Seven pigs remained alive at a mean follow-up of 7.7 ± 2.1 months. The left atrial diameter indices of the 7 pigs increased significantly at 1 month (33.1 ± 8.6 mm, p = 0.018) and 3 months (41.3 ± 12.6 mm, p = 0.018) after surgery compared with baseline values (22.8 ± 5.2 mm), and the left atrial diameter index increased significantly at 3 months compared to 1 month (p = 0.018). CONCLUSIONS: Left atrial enlargement develops rapidly and progresses after the creation of significant pure mitral regurgitation.

First Report of Root and Basal Rot of Angelica acutiloba Caused by Fusarium solani in Taiwan.

Angelica (Angelica acutiloba (Siebold. & Zucc.) Kitag.) is one of the most important traditional Chinese medicines in Taiwan. The medicinal herb has been mainly imported from China, but cultivation at a commercial scale has also been established in recent years in Hualien County, Taiwan. In September 2008, angelica plants in a field at Liou-shih-dan Mountain displayed symptoms of yellowing, stunting, rotting of roots and basal stem, and wilting. A severe brown discoloration of vascular tissue along the stems of infected plants was observed. One or more Fusarium spp. was consistently isolated from the roots and stems of diseased plants. Isolates R3, R4, and R5 were incubated for 14 days on celery tissues to produce chlamydospores, and 33 g of celery tissue with chlamydospores were mixed with 500 ml of soil per pot as inoculum. One 4-month-old angelica seedling was planted per pot. Three angelica plants were inoculated with each isolate in the first test and nine plants were inoculated with each isolate in the second test. Other seedlings were inoculated with water as checks. Pathogenicity tests were conducted twice. Incidence of diseased plants was 66, 100, and 33% in the first test, and 66, 100, and 44% in the second test for the R3, R4, and R5 isolates, respectively. Symptoms similar to those on the diseased plants in the field were produced, with leaves turning yellow starting 7 days after inoculation and wilt and discoloration of roots 14 days after inoculation. Fusarium spp. also were reisolated from the diseased plants. Genomic DNA was extracted from mycelium with a fungal genomic DNA purification kit, and the internal transcribed spacer (ITS) rDNA region was amplified and sequenced with primers ITS-4 and ITS-5. The sequence of the resulting ~550-bp amplicon was compared with those in GenBank. The ITS sequences of the R3, R4, and R5 isolates shared 98.7, 98.7, and 97.9% similarity with F. solani isolate AF129104 (3), respectively. Phylogenetic analysis also showed that the three isolates were closer to F. solani than to other Fusarium species. Both macroconidia and microconidia of the R4 isolate were produced on potato dextrose agar. Macroconidia were three to five septate and 27.2 to 37.8 × 4.4 to 6.2 µm; microconidia were zero to one septate and 9.3 to 14.7 × 2.9 to 4.8 µm. Chlamydospores produced on celery juice agar were terminal or intercalary, solitary, in pairs or in chains, and 9.3 to 12.1 µm. Morphological characteristics identified the three isolates as F. solani (Martius) Snyder & Hansen according to Fu and Chang (2) and Chung et al. (1), which agrees with the ITS comparison. To our knowledge, this is the first report of root and basal rot caused by F. solani on angelica in Taiwan. References: (1) W. C. Chung et al. Plant Prot. Bull. 40:177, 1998. (2) C. H. Fu and T. T. Chang. Taiwan J. For. Sci. 14:223, 1999. (3) H. Suga et al. Mycol. Res. 104:1175, 2000.

Modulation of in vivo migratory function of alpha 2 beta 1 integrin in mouse liver.

We report herein that expression of alpha 2 beta 1 integrin increased human erythroleukemia K562 transfectant (KX2C2) cell movement after extravasation into liver parenchyma. In contrast, a previous study demonstrated that alpha 2 beta 1 expression conferred a stationary phenotype to human rhabdomyosarcoma RD transfectant (RDX2C2) cells after extravasation into the liver. We therefore assessed the adhesive and migratory function of alpha 2 beta 1 on KX2C2 and RDX2C2 cells using a alpha 2 beta 1-specific stimulatory monoclonal antibody (mAb), JBS2, and a blocking mAb, BHA2.1. In comparison with RDX2C2 cells, KX2C2 were only weakly adherent to collagen and laminin. JBS2 stimulated alpha 2 beta 1-mediated interaction of KX2C2 cells with both collagen and laminin resulting in increases in cell movement on both matrix proteins. In the presence of Mn2+, JBS2-stimulated adhesion on collagen beyond an optimal level for cell movement. In comparison, an increase in RDX2C2 cell movement on collagen required a reduction in its adhesive strength provided by the blocking mAb BHA2.1. Consistent with these in vitro findings, in vivo videomicroscopy revealed that alpha 2 beta 1-mediated postextravasation cell movement of KX2C2 cells in the liver tissue could also be stimulated by JBS2. Thus, results demonstrate that alpha 2 beta 1 expression can modulate postextravasation cell movement by conferring either a stationary or motile phenotype to different cell types. These findings may be related to the differing metastatic activities of different tumor cell types.

First Report of Aglaonema Bacterial Blight Caused by Erwinia chrysanthemi in Taiwan.

Aglaonema (Aglaonema spp.) is a popular ornamental potted plant in Taiwan. In 2003, leaves showing soft rot symptoms were found on a number of Sithiporn aglaonema (A. marantifoloum var. tricolor × A. rotundum) plants in a nursery in southern Taiwan. The disease usually started from leaf tips or wounded sites and the affected areas appeared water soaked. The diseased tissue subsequently turned dark brown and became fragile. More than 50% of Sithiporn aglaonema plants were destroyed in the affected nursery. Bacteria isolated from the symptomatic leaves grew at 39°C, degraded pectate, caused soft rot on slices of potato tuber and petioles of Chinese cabbage, produced phosphatase and lecithinase, and utilized malonate, but did not grow in 5% NaCl or produce acid from trehalose. These characteristics were similar to those of Erwinia chrysanthemi Burkholder et al. (1,2) and the reference strain OS2 from Phalaenopsis sp. provided by K. C. Tzeng of National Chung Hsing University, Taichung, Taiwan. Polymerase chain reaction (PCR) analysis using the primer pair 5A (5' GCGGTTGTTCACCAGGTGTTTT 3') and 5B (5' ATGCACGCTACCTGGAAGTAT 3') specific for E. chrysanthemi (4) confirmed the identity of all seven isolates tested as E. chrysanthemi. The primer pair 5A/5B was designed from the sequences of pT8-1, idg (a gene for blue-pigment synthesis), and pecS (a gene for regulation of pectinase, cellulose, and pigment production). PCR products amplified from E. chrysanthemi DNA with the 5A/5B primer were 500 bp (4). Pathogenicity of isolates was confirmed by rubbing the leaf surface of Sithiporn aglaonema plants with Carborundum and spraying the wounded surface with a bacterial suspension at 1 × 108 CFU/ml in the greenhouse. Plant leaves sprayed with distilled water were used as the control. Three leaves were inoculated for each isolate, and the experiment was conducted twice. Symptoms appeared within 24 h after inoculation. All seven isolates tested were pathogenic, causing an average of 86 to 95% of inoculated leaves to show water-soaked symptoms similar to these observed in nature. Symptoms did not occur on control leaves. E. chrysanthemi was reisolated from diseased tissues of inoculated leaves. To our knowledge, this is the first report of bacterial blight caused by E. chrysanthemi on aglaonema in Taiwan and the first report of the disease on the Sithiporn cultivar of aglaonema. This disease on aglaonema was previously reported in the United States (3). References: (1) R. S. Dickey and A. Kelman. Page 44 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. N. W. Schaad, ed. The American Phytopathological Society, St. Paul, MN, 1988. (2) M. Goto and K. Matsumoto. Int. J. Syst. Bacteriol. 37:130, 1987. (3) L. A. McFadden. Plant Dis. Rep. 53:253. 1969. (4) M. G. Zhu. Ph.D. diss, National Chung Hsing University, Taichung, Taiwan, 1995.

Effect of Chinese Herb Extracts on Spore Germination of Oidium murrayae and Nature of Inhibitory Substance from Chinese Rhubarb.

More than 21% of the Chinese herbs tested contained substances in their aqueous extracts inhibitory to conidial germination of the powdery mildew fungus Oidium murrayae. Extracts from Chinese rhubarb and Japanese knotweed were very effective in controlling powdery mildew on cucumber, pumpkin, and eggplant. The inhibitory substance in Chinese rhubarb was soluble in polar solvents and less soluble in nonpolar solvents. The inhibitor in the aqueous extract was not dialyzable in the membrane tubing with molecular weight cut-off of 14,000, but was exchangeable by anion but not cation exchange resins, indicating that the inhibitor has a molecular weight larger than 14,000 and negative charge on its molecule.

Basal Petiole Rot and Plant Kill of Zamioculcas zamiifolia Caused by Phytophthora nicotianae.

Zamioculcas zamiifolia (Lodd.) Engl., commonly called 'ZZ' plant, is a monocotyledonous plant in the Araceae. It is a new introduction in the foliage plant industry worldwide and is an increasing popular ornamental foliage plant in Taiwan. In 2003, basal petiole rot and death of ZZ plants were found in two nurseries in southern Taiwan with 18% of the plants diseased at one nursery. Early symptoms were water soaking of the petiole base and a slight yellowing of the leaflets followed by browning of leaflets. As the disease progressed, the petiole base became dark brown, shriveled, collapsed, and eventually rotted. The surface of the roots and rhizomes of diseased plants were initially blackish brown followed by root rots and mortality of plants. A Phytophthora species was consistently isolated from diseased petioles, rhizomes, and roots on a selective medium (4). Two single zoospore isolates (2), each from a different nursery, were used for morphological and pathogenicity tests. The isolates were grown on vegetable juice agar (10% V8 juice, 0.02% CaCO3, and 2% agar [VJA]) at 28°C with 12-h irradiation for 10 days. Sporangia were nondeciduous, terminal or intercalary, and attached to irregularly or sympodially branched sporangiophores. Papillate sporangia were spherical to broadly ovoid or obpyriform, averaged 37.3 × 30.2 µm, and ranged from 23 to 55 µm in length by 17 to 46 µm in diameter, with a length/breadth ratio of 1.24 and a range of 1.1 to 1.4. Chlamydospores with walls 1 to 4 µm thick were terminal or intercalary, spherical, averaged 30.6 µm in diameter, and ranged from 18 to 46 µm. On the basis of the morphological characteristics above, Phytophthora nicotianae Breda de Haar. (synonym P. parasitica Dastur) was identified (1). Paired with known A1 and A2 mating types of P. cinnamomi on VJA, both P. nicotianae cultures were A2, forming oospores after 14 days in darkness at 28°C. Disease-free ZZ plants were propagated by rhizomes in 242-cm3 round pots with 500 g of sterilized potting medium (vermiculite/peat moss/perlite = 1:2:1). Plants with 30 cm long petiole were used for inoculation. For the pathogenicity test, both isolates were grown on VJA plates sealed with Parafilm at 28°C in darkness. After 10 days, aerial mycelia with sporangia were scraped off the plates, placed in 10 ml of sterile distilled water at 8°C for 15 min to release zoospores. A zoospore suspension was adjusted to 104 zoospores/ml following enumeration with a microliter pipette (3) and 200 ml of the suspension was added to each pot, or rhizomes and roots were dipped in 400 ml of the suspension for 60 min and planted immediately. Ten plants were inoculated with either method and water was added to inoculated control plants. Water soaking of the petiole bases developed in 7 days and mortality occurred in 10 days in a screenhouse after plants were inoculated with either method. Control plants remained healthy and no petiole, root, or rhizome rots developed. P. nicotianae was isolated from the advancing lesions of the inoculated plants and both experiments were repeated. To our knowledge, this is the first report of basal petiole rot and plant kill of Zamioculcas zamiifolia caused by P. nicotianae. References: (1) D. C. Erwin and O. K. Ribeiro. Phytophthora Diseases Worldwide. The American Phytopathological Society, St. Paul, MN, 1996. (2) W. C. Ho and W. H. Ko. Bot. Bull. Acad. Sin. 38:41, 1997. (3) W. H. Ko et al. Phytopathology 63:1206, 1973. (4) W. H. Ko et al. Trans. Br. Mycol. Soc. 71:496, 1978.

Movement of interphase Golgi apparatus in fused mammalian cells and its relationship to cytoskeletal elements and rearrangement of nuclei.

Virus-induced Vero cell fusion was used to analyze the rearrangement of Golgi apparatus during the development of syncytia. Individual Golgi apparatus, associated initially with the separate microtubule-organizing centers in the perinuclear area of fused cells, congregated in the center of the syncytia and formed an extended Golgi complex within 3 to 5 h. The relocation of the Golgi apparatus, but not of nuclei, depended on the presence of an intact microtubule network, since both the microtubule depolymerizing drug nocodazole and the microtubule-stabilizing drug taxol interfered with the formation of an extended Golgi complex. Depolymerization of microfilaments with cytochalasin D and the complete collapse of intermediate filaments induced by microinjected monoclonal antibodies against vimentin had no effect on these processes. Cooling cells to 20 degrees C inhibited both congregation of Golgi apparatus and relocation of nuclei. Visualization of the movement of Golgi apparatus labeled in living cells with fluorescent metabolites of C6-NBD-ceramide showed that relocation of the Golgi apparatus was a process in which congregation and coalescence of the intact organelles was seen, rather than dispersal and reassembly of smaller Golgi elements in the center of the polykaryons. Thus, movement of intact Golgi apparatus in fused interphase cells depends on an undisturbed microtubule network and occurs independently of the relocation of nuclei.

Reclustering of scattered Golgi elements occurs along microtubules.

Depolymerization of the interphase microtubules by nocodazole results in the scattering and apparent fragmentation of the Golgi apparatus in Vero fibroblast cells. Upon removal of the drug, the interphase microtubules repolymerize, and the scattered Golgi elements move back to the region around the microtubule-organizing center (MTOC) within 40 to 60 min. Using a fluorescent lipid analogue (C6-NBD-ceramide) as a vital stain for the scattered Golgi elements, their relocation was visualized by video-enhanced fluorescence microscopy in Vero cells maintained at 20 degrees C. The NBD-labeled structures were identified as Golgi elements by their colocalization with galactosyltransferase in the fixed cells. During reclustering, NBD-labeled Golgi elements were observed to move by discontinuous saltations towards the MTOC with velocities of 0.1 to 0.4 micron/s. Paths along which Golgi elements moved were super-imposable on microtubules visualized by indirect immunofluorescence. Neither the collapse of intermediate filaments caused by microinjection of antibodies to vimentin nor the disruption of microfilaments by cytochalasin D had an effect on the reclustering of Golgi elements or the positioning of the Golgi apparatus. These data show that scattered Golgi elements move along microtubules back to the region around the MTOC, while neither intact intermediate filaments nor microfilaments are involved.

Molecular cloning and nucleotide sequence determination of three envelope genes of classical swine fever virus Taiwan isolate p97.

A strain of classical swine fever virus (CSFV) has been isolated in Taiwan. The cDNA coding for three envelope glycoproteins E1, E2 and E3 were molecularly cloned from purified viral particles using the reverse transcription-polymerase chain reaction (RT-PCR) method and sequence-specific primers. The resulting PCR products (1113 bp for E1. 699 bp for E2 and 567 bp for E3) were cloned into the SmaI site of pUC19 and then subjected to DNA sequence analysis. Data showed that nucleotide sequence of the three envelope genes shared a 82-83% homology with the corresponding genes of three other strains (Alfort, Brescia and Weybridge). However, the homology of the deduced amino acid sequence was greater than 90% among the four strains. The potential asparagine-linked glycosylation sites for E1 (5 sites), E2 (7 sites) and E3 (2 sites) were conserved. This suggests that the Taiwan p97 strain is distinct from other three strains described. The variations may have implications for future vaccine development. The sequence has been submitted to GenBank. The accession numbers are U43924 and U03290.

The presence of RNA splicing signals in the cDNA construct of the E2 gene of classical swine fever virus affected its expression.

E2 is the major neutralizing antigen for classical swine fever virus (CSFV) infection. Previously, we have cloned and sequenced the E2 cDNA of Taiwan strain p97 by the reverse transcription-polymerase chain reaction (RT-PCR) method from CSFV-infected tissue. The presence of RNA splicing donor and acceptor sites were found in the cDNA sequence. In this study, transfection of E2 cDNA into mammalian cells resulted in the production of a spliced RNA. Site-directed mutagenesis of the donor and acceptor sites prevented the RNA splicing event and generated a full length transcript in COS7 cells. Although the spliced E2 transcript has not been reported in natural infection of CSFV, this study suggested that the potential splicing sites affected the E2 gene expression when the plasmid-based E2 gene was introduced into mammalian cells.

Rapid detection of hog cholera virus in tissues by the polymerase chain reaction.

A rapid method for the detection of hog cholera virus (HCV) in infected tissues, using polymerase chain reaction (PCR) was developed. Total RNA isolated from HCV-infected tissues was reverse transcribed with AMV reverse transcriptase and the resulting complementary DNA was amplified by Taq DNA polymerase in the presence of two HCV-specific primers. The amplified DNA fragment was detected by agarose gel electrophoresis. The sensitivity of this method was at 10(4) TCID50 of HCV. The sensitivity increased approximately 1000-fold when the DNA was reamplified with a set of nested primers. DNA sequencing analysis of the PCR products revealed that the HCV sequence amplified from a local field isolate was highly homologous to the HCV Alfort strain. This method may be useful for pathological and epidemiological studies of HCV in pigs.

What's new in cytoskeleton-organelle interactions? Relationship between microtubules and the Golgi-apparatus.

Several biochemical processes in animal cells are confined to distinct membrane-bounded compartments. Segregation of specialized functions into different compartments necessitates intercompartment transfer of material. This transfer is mediated by carrier vesicles which, by precise sorting and transport mechanisms, are targetted to their correct destinations. Microtubules, major constituents of the cytoskeleton, are involved both in these intracellular transport processes and in the spatial organization of cytoplasmic organelles. Accumulating evidence suggests that various classes of membranous organelles interact with microtubules. The positioning of several organelles, including the Golgi apparatus and lysosomes, depends on an intact interphase microtubule network. Furthermore, it has been shown that many of these organelles, for example Golgi elements, tubules of the endoplasmic reticulum, exocytic or secretory vesicles and lysosomes move along microtubules. In this article we will discuss the role of microtubules in the movement and positioning of elements of the Golgi complex. The first part will summarize structural and functional aspects of microtubules and the Golgi apparatus and review evidence for their interaction. In the second part, the possible physiological relevance of this interaction will be discussed and correlated with other membrane-microtubule interactions. Finally, emerging questions and perspectives in this field are outlined.

One-stage closure of the entire primary palate.

Timing of the closure of the anterior palate and alveolus is a subject of debate. Late repair of this defect is complicated by high fistula formation and subjects the patient to the problems of palate fistula for extended periods of time. We have utilized a single procedure performed when the child is 3 months of age that completely closes the anterior hard palate and alveolus along with the cleft lip. Our series consisted of 61 consecutive patients with unilateral clefts of the primary and secondary palate. Mucosal turnover flaps from the vomer along with lateral nasal mucosal flaps provide the nasal lining. A buccal sulcus flap with a Veau flap completes the oral repair. Ninety-five percent (58 of 61) of the patients had complete and stable closure of their anterior palate and alveolus after 1 year. The incidence of fistula formation in our series (3 of 61) is much lower than that reported with the utilization of other protocols. Excellent exposure of the anterior palate and alveolar defect during lip repair, early restoration of anatomic relationships, establishment of a good nostril floor and sill, and very low fistula formation are among the benefits of this procedure. The increase in operative time is considered minimal in light of aforementioned advantages.

Use of intravenous immunoglobulin in a patient with refractory myasthenia gravis associated with malignant thymoma.

We report on a case of refractory myasthenia gravis that was managed by using intravenous immunoglobulin. A 35-year-old Chinese woman with malignant thymoma-associated myasthenia gravis was treated by total thymectomy, followed by chemotherapy. Thirty months later, she developed respiratory failure and required mechanical ventilation for 2 months. A course of intravenous immunoglobulin was given and her condition improved significantly. Two weeks later, the patient became ambulatory, was prescribed oral pyridostigmine, and was discharged home.