Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Cytosolic DNA sensor activation inhibits HIV infection of macrophages.

Cytosolic recognition of microbial DNA in macrophages results in the activation of the interferon (IFN)-dependent antiviral innate immunity. Here, we examined whether activating DNA sensors in peripheral blood monocyte-derived macrophages (MDMs) can inhibit human immunodeficiency virus (HIV). We observed that the stimulation of MDMs with poly(dA:dT) or poly(dG:dC) (synthetic ligands for the DNA sensors) inhibited HIV infection and replication. MDMs treated with poly(dA:dT) or poly(dG:dC) expressed higher levels of both type I and type III IFNs than untreated cells. Activation of the DNA sensors in MDMs also induced the expression of the multiple intracellular anti-HIV factors, including IFN-stimulated genes (ISGs: ISG15, ISG56, Viperin, OAS2, GBP5, MxB, and Tetherin) and the HIV restriction microRNAs (miR-29c, miR-138, miR-146a, miR-155, miR-198, and miR-223). In addition, the DNA sensor activation of MDM upregulated the expression of the CC chemokines (RANTES, MIP-1α, MIP-1ß), the ligands for HIV entry coreceptor CCR5. These observations indicate that the cytosolic DNA sensors have a protective role in the macrophage intracellular immunity against HIV and that targeting the DNA sensors has therapeutic potential for immune activation-based anti-HIV treatment.

Activation of Toll-like receptor 3 inhibits HIV infection of human iPSC-derived microglia.

As a key immune cell in the brain, microglia are essential for protecting the central nervous system (CNS) from viral infections, including HIV. Microglia possess functional Toll-like receptor 3 (TLR3), a key viral sensor for activating interferon (IFN) signaling pathway-mediated antiviral immunity. We, therefore, studied the effect of poly (I:C), a synthetic ligand of TLR3, on the activation of the intracellular innate immunity against HIV in human iPSC-derived microglia (iMg). We found that poly (I:C) treatment of iMg effectively inhibits HIV infection/replication at both mRNA and protein levels. Investigations of the mechanisms revealed that TLR3 activation of iMg by poly (I:C) induced the expression of both type I and type III IFNs. Compared with untreated cells, the poly (I:C)-treated iMg expressed significantly higher levels of IFN-stimulated genes (ISGs) with known anti-HIV activities (ISG15, MxB, Viperin, MxA, and OAS-1). In addition, TLR3 activation elicited the expression of the HIV entry coreceptor CCR5 ligands (CC chemokines) in iMg. Furthermore, the transcriptional profile analysis showed that poly (I:C)-treated cells had the upregulated IFN signaling genes (ISG15, ISG20, IFITM1, IFITM2, IFITM3, IFITM10, APOBEC3A, OAS-2, MxA, and MxB) and the increased CC chemokine signaling genes (CCL1, CCL2, CCL3, CCL4, and CCL15). These observations indicate that TLR3 is a potential therapy target for activating the intracellular innate immunity against HIV infection/replication in human microglial cells. Therefore, further studies with animal models and clinical specimens are necessary to determine the role of TLR3 activation-driven antiviral response in the control and elimination of HIV in infected host cells.

HIV infection suppresses TLR3 activation-mediated antiviral immunity in microglia and macrophages.

Monocytic-lineage cells in the central nervous system (CNS), including microglia and brain resident macrophages, are the key players in the CNS innate immunity against viral infections, including human immunodeficiency virus (HIV). However, these cells also serve as the major targets and reservoirs for HIV in the CNS. To address the question of how HIV can establish persistent infection in the target cells in the CNS, we examined whether HIV has the ability to counteract Toll-like receptor 3 (TLR3) activation-mediated antiviral immunity in microglia and macrophages. We observed that HIV latently infected microglial cells (HC69·5) expressed reduced levels of TLR3 and TLR3 activation-mediated interferons (IFN-α/ß and IFN-λ) as compared with the uninfected control cells (C20). In addition, HIV infection of primary human macrophages suppressed the expression of TLR3 and the IFNs. HIV infection also inhibited the expression of the antiviral IFN-stimulated genes (ISGs) and the HIV-restriction miRNAs. Mechanistically, HIV infection inhibited the phosphorylation of IFN regulatory factors (IRF3 and IRF7) and signal transducer and activator of transcription proteins (STAT1 and STAT3) in both HIV latently infected microglia and acutely infected macrophages. These findings provide previously unrecognized and sound mechanisms for HIV infection and persistence in the primary target and reservoir cells in the brain.

IL-22 suppresses HSV-2 replication in human cervical epithelial cells.

Interleukin (IL)-22, a member of the IL-10 family, plays a role in antiviral immune responses to a number of viral infections. However, it is unclear whether IL-22 is involved in the mucosal immunity against herpes simplex virus 2 (HSV-2) infection in the female reproductive tract (FRT). In this study, we studied whether IL-22 could inhibit HSV-2 infection of human cervical epithelial cells (End1/E6E7 cells). We showed that End1/E6E7 cells express the functional IL-22 receptor complex (IL-22R1 and IL-10R2). When treated with IL-22, End1/E6E7 cells expressed the higher levels of IFN-stimulated genes (ISGs: ISG15, ISG56, OAS-1, OAS-2, and Mx2) than untreated cells. In addition, IL-22-treated cells produced higher levels of the tight junction proteins (ZO-1 and Occludin) than untreated cells. Mechanistically, IL-22 could activate the JAK/STAT signaling pathway by inducing the phosphorylation of STAT1 and STAT3. These observations indicate the potential of IL-22 as an anti-HSV-2 agent in the FRT mucosal innate immunity against HSV-2 infection.

IFN-λ4 inhibits HIV infection of macrophages through signalling of IFN-λR1/IL-10R2 receptor complex.

The recently discovered IFN-λ4 has been found to have antiviral activity against several viruses. However, it's unknown whether IFN-λ4 can inhibit HIV infection. Here, we show that IFN-λ4 could suppress HIV infection of macrophages. This IFN-λ4-mediated HIV inhibition was compromised by the antibodies against IFN-λ receptor complex, IFN-λR1/IL-10R2. IFN-λ4 enhanced the phosphorylation of STAT1, and induced antiviral interferon-stimulated genes. These findings indicated that IFN-λ4 can inhibit HIV via JAK/STAT signalling pathway.

Toll-like receptor 3-activated macrophages confer anti-HCV activity to hepatocytes through exosomes.

Exosomes are a class of cell-released small vesicles that mediate intercellular communication by delivering functional factors to recipient cells. During hepatitis C virus (HCV) infection, the interaction between liver resident macrophages and hepatocytes is a key component in liver innate immunity. In this study, we explored the role of exosomes in the delivery of innate anti-HCV factors to hepatocytes from macrophages. We showed that supernatant from TLR3-activated macrophage cultures could efficiently inhibit HCV replication in Huh7 cells. This macrophage-mediated anti-HCV activity was through exosomes because inhibiting exosomes could abrogate the action of macrophages. Further analyses demonstrated that TLR3-activated macrophages release exosomes that contain anti-HCV microRNA (miRNA)-29 family members. Inhibiting miRNA29 could restore HCV replication. These findings suggest a novel antiviral mechanism in liver innate immunity against HCV infection and provide insights to support further studies on developing exosome-based delivery system for disease treatment.-Zhou, Y., Wang, X., Sun, L., Zhou, L., Ma, T.-C., Song, L., Wu, J.-G., Li, J.-L., Ho, W.-Z. Toll-like receptor 3-activated macrophages confer anti-HCV activity to hepatocytes through exosomes.

Activation of TLR3/interferon signaling pathway by bluetongue virus results in HIV inhibition in macrophages.

Bluetongue virus (BTV), a nonenveloped double-stranded RNA virus, is a potent inducer of type Ι interferons in multiple cell systems. In this study, we report that BTV16 treatment of primary human macrophages induced both type I and III IFN expression, resulting in the production of multiple antiviral factors, including myxovirus resistance protein A, 2',5'-oligoadenylate synthetase, and the IFN-stimulated gene 56. Additionally, BTV-treated macrophages expressed increased HIV restriction factors (apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3 G/F/H) and CC chemokines (macrophage inflammatory protein 1-α, macrophage inflammatory protein 1-ß, regulated on activation of normal T cell expressed and secreted), the ligands for HIV entry coreceptor CC chemokine receptor type 5. BTV16 also induced the expression of tetherin, which restricts HIV release from infected cells. Furthermore, TLR3 signaling of macrophages by BTV16 resulted in the induction of several anti-HIV microRNAs (miRNA-28, -29a, -125b, -150, -223, and -382). More importantly, the induction of antiviral responses by BTV resulted in significant suppression of HIV in macrophages. These findings demonstrate the potential of BTV-mediated TLR3 activation in macrophage innate immunity against HIV.

Monkey models of tuberculosis: lessons learned.

The use of animal models has been invaluable for studying the pathogenesis of Mycobacterium tuberculosis infection, as well as for testing the efficacy of vaccines and drug regimens for tuberculosis. Among the applied animal models, nonhuman primates, particularly macaques, share the greatest anatomical and physiological similarities with humans. As such, macaque models have been used for investigating tuberculosis pathogenesis and preclinical testing of drugs and vaccines. This review focuses on published major studies which illustrate how the rhesus and cynomolgus macaques have enriched and may continue to advance the field of global tuberculosis research.

Induction of interferon-λ contributes to TLR3 and RIG-I activation-mediated inhibition of herpes simplex virus type 2 replication in human cervical epithelial cells.

STUDY HYPOTHESIS: Is it possible to immunologically activate human cervical epithelial cells to produce antiviral factors that inhibit herpes simplex virus type 2 (HSV-2) replication? STUDY FINDING: Our results indicate that human cervical epithelial cells possess a functional TLR3/RIG-I signaling system, the activation of which can mount an Interferon-λ (IFN-λ)-mediated anti-HSV-2 response. WHAT IS KNOWN ALREADY: There is limited information about the role of cervical epithelial cells in genital innate immunity against HSV-2 infection. STUDY DESIGN, SAMPLES/MATERIALS, METHODS: We examined the expression of toll-like receptors (TLRs) and retinoic acid-inducible I (RIG-I) in End1/E6E7 cells by real-time PCR. The IFN-λ induced by TLR3 and RIG-I activation of End1/E6E7 cells was also examined by real-time PCR and ELISA. HSV-2 infection of End1/E6E7 cells was evaluated by the real-time PCR detection of HSV-2 gD expression. The antibody to IL-10Rß was used to determine whether IFN-λ contributes to TLR3/RIG-I mediated HSV-2 inhibition. Expression of interferon regulatory factor 3 (IRF3), IRF7, IFN-stimulated gene 56 (ISG56), 2'-5'-oligoadenylate synthetase I (OAS-1) and myxovirus resistance A (MxA) were determined by the real-time PCR and western blot. End1/E6E7 cells were transfected with shRNA to knockdown the IRF3, IRF7 or RIG-I expression. Student's t-test and post Newman-Keuls test were used to analyze stabilized differences in the immunological parameters above between TLR3/RIG-I-activated cells and control cells. MAIN RESULTS AND THE ROLE OF CHANCE: Human cervical epithelial cells expressed functional TLR3 and RIG-I, which could be activated by poly I:C and 5'ppp double-strand RNAs (5'ppp dsRNA), resulting in the induction of endogenous interferon lambda (IFN-λ). The induced IFN-λ contributed to TLR3/RIG-I-mediated inhibition of HSV-2 replication in human cervical epithelial cells, as an antibody to IL-10Rß, an IFN-λ receptor subunit, could compromise TLR3/RIG-I-mediated inhibition of HSV-2. Further studies showed that TLR3/RIG-I signaling in the cervical epithelial cells by dsRNA induced the expression of the IFN-stimulated genes (ISGs), ISG56, 2'-5'-oligoadenylate synthetase I (OAS-1) and myxovirus resistance A (MxA), the key antiviral elements in the IFN signaling pathway. In addition, we observed that the topical treatment of genital mucosa with poly I:C could protect mice from genital HSV-2 infection. LIMITATIONS, REASONS FOR CAUTION: Future prospective studies with primary cells and suitable animal models are needed in order to confirm these outcomes. WIDER IMPLICATIONS OF THE FINDINGS: The findings provide direct and compelling evidence that there is intracellular expression and regulation of IFN-λ in human cervical epithelial cells, which may have a key role in the innate genital protection against viral infections. LARGE SCALE DATA: Not applicable. STUDY FUNDING AND COMPETING INTERESTS: This work was supported by the National Natural Science Foundation of China (81301428 to L.Z. and 81271334 to W.-Z.H.), the Fundamental Research Funds for the Central Universities (2042015kf0188 to L.Z.), the China Postdoctoral Science Foundation (2013M531745 to L.Z.), the Development Program of China ('973', 2012CB518900 to W.-Z.H.) from the Ministry of Science and Technology of the People's Republic of China, grants (DA12815 and DA022177 to W.-Z.H.) from the National Institute on Drug Abuse (NIDA) and the open project of Hubei Key Laboratory of Wudang Local Chinese Medicine Research (WDCM005 to M.S.). The authors declare no competing financial interests.

Cytosolic DNA sensors activation of human astrocytes inhibits herpes simplex virus through IRF1 induction.

Introduction: While astrocytes participate in the CNS innate immunity against herpes simplex virus type 1 (HSV-1) infection, they are the major target for the virus. Therefore, it is of importance to understand the interplay between the astrocyte-mediated immunity and HSV-1 infection. Methods: Both primary human astrocytes and the astrocyte line (U373) were used in this study. RT-qPCR and Western blot assay were used to measure IFNs, the antiviral IFN-stimulated genes (ISGs), IFN regulatory factors (IRFs) and HSV-1 DNA. IRF1 knockout or knockdown was performed with CRISPR/Cas9 and siRNA transfection techniques. Results: Poly(dA:dT) could inhibit HSV-1 replication and induce IFN-ß/IFN-λs production in human astrocytes. Poly(dA:dT) treatment of astrocytes also induced the expression of the antiviral ISGs (Viperin, ISG56 and MxA). Among IRFs members examined, poly(dA:dT) selectively unregulated IRF1 and IRF9, particularly IRF1 in human astrocytes. The inductive effects of poly(dA:dT) on IFNs and ISGs were diminished in the IRF1 knockout cells. In addition, IRF1 knockout attenuated poly(dA:dT)-mediated HSV-1 inhibition in the cells. Conclusion: The DNA sensors activation induces astrocyte intracellular innate immunity against HSV-1. Therefore, targeting the DNA sensors has potential for immune activation-based HSV-1 therapy.

KDM5A/B contribute to HIV-1 latent infection and survival of HIV-1 infected cells.

Combinational antiretroviral therapy (cART) suppresses human immunodeficiency virus type 1 (HIV-1) viral replication and pathogenesis in acquired immunodeficiency syndrome (AIDS) patients. However, HIV-1 remains in the latent stage of infection by suppressing viral transcription, which hinders an HIV-1 cure. One approach for an HIV-1 cure is the "shock and kill" strategy. The strategy focuses on reactivating latent HIV-1, inducing the viral cytopathic effect and facilitating the immune clearance for the elimination of latent HIV-1 reservoirs. Here, we reported that the H3K4 trimethylation (H3K4me3)-specific demethylase KDM5A/B play a role in suppressing HIV-1 Tat/LTR-mediated viral transcription in HIV-1 latent cells. Furthermore, we evaluated the potential of KDM5-specific inhibitor JQKD82 as an HIV-1 "shock and kill" agent. Our results showed that JQKD82 increases the H3K4me3 level at HIV-1 5' LTR promoter regions, HIV-1 reactivation, and the cytopathic effects in an HIV-1-latent T cell model. In addition, we identified that the combination of JQKD82 and AZD5582, a non-canonical NF-κB activator, generates a synergistic impact on inducing HIV-1 lytic reactivation and cell death in the T cell. The latency-reversing potency of the JQKD82 and AZD5582 pair was also confirmed in peripheral blood mononuclear cells (PBMCs) isolated from HIV-1 aviremic patients and in an HIV-1 latent monocyte. In latently infected microglia (HC69) of the brain, either deletion or inhibition of KDM5A/B results in a reversal of the HIV-1 latency. Overall, we concluded that KDM5A/B function as a host repressor of the HIV-1 lytic reactivation and thus promote the latency and the survival of HIV-1 infected reservoirs.

SIV infection of rhesus macaques of Chinese origin: a suitable model for HIV infection in humans.

Simian immunodeficiency virus (SIV) infection of Indian-origin rhesus macaques (RM) has been widely used as a well-established nonhuman primate (NHP) model for HIV/AIDS research. However, there have been a growing number of studies using Chinese RM to evaluate immunopathogenesis of SIV infection. In this paper, we have for the first time reviewed and discussed the major publications related to SIV or SHIV infection of Chinese RM in the past decades. We have compared the differences in the pathogenesis of SIV infection between Chinese RM and Indian RM with regard to viral infection, immunological response, and host genetic background. Given AIDS is a disease that affects humans of diverse origins, it is of importance to study animals with different geographical background. Therefore, to examine and compare results obtained from RM models of Indian and Chinese origins should lead to further validation and improvement of these animal models for HIV/AIDS research.

Human iPSC-derived brain organoids: A 3D mini-brain model for studying HIV infection.

The brain is one of the important reservoir sites for HIV persistent/latent infection that often leads to HIV-associated neurocognitive disorders (HAND). However, HIV dynamics in the brain is an understudied area and little is known about mechanisms underlying the development and progression of HAND. This issue is mainly due to the lack of suitable in vitro models that can recapitulate the cellular and molecular complexity of the human brain. Hence, there is an urgent need for such models to study HIV neuropathogenesis and to develop therapeutics for HAND. The emergence of three-dimensional (3D) brain organoids generated from induced pluripotent stem cells (iPSCs) has now provided a clinically relevant in vitro model to study HIV brain infection and neuropathogenesis. Recently, there have been a noticeable number of publications that demonstrate the feasibility and advantages of this model for studies of neurobiology and brain disorders as well as HIV infection. Here, we describe the development of iPSC-derived human microglia-containing brain organoids, including advantages/challenges, and focus on their applicability for modeling HIV brain infection.

Inhibition of anti-HIV microRNA expression: a mechanism for opioid-mediated enhancement of HIV infection of monocytes.

Several micro RNAs (miRNAs) have the ability to inhibit HIV replication in target cells. Thus, we investigated the impact of opioids (morphine and heroin), widely abused drugs among people infected with HIV, on the expression of cellular anti-HIV miRNAs in monocytes. We found that morphine-treated monocytes expressed lower levels of cellular anti-HIV miRNAs than untreated cells. In addition, morphine treatment of monocytes compromised type I interferon (IFN)-induced anti-HIV miRNA expression. These findings paralleled the observation that morphine treatment of monocytes enhanced HIV replication. These morphine-mediated actions on the anti-HIV miRNAs and HIV could be antagonized by the opioid receptor antagonists (naltrexone or Cys2, Tyr3, Arg5, Pen7-amide). Furthermore, the in vitro impact of morphine on miRNA expression was confirmed by the in vivo observation that heroin-dependent subjects had significantly lower levels of anti-HIV miRNAs (miRNA-28, 125b, 150, and 382) in peripheral blood mononuclear cells than the healthy subjects. These in vitro and in vivo findings indicate that opioid use impairs intracellular innate anti-HIV mechanism(s) in monocytes, contributing to cell susceptibility to HIV infection.

Comparison of BNT162b2-, mRNA-1273- and Ad26.COV2.S-Elicited IgG and Neutralizing Titers against SARS-CoV-2 and Its Variants.

Because the vaccine-elicited antibody and neutralizing activity against spike protein of SARS-CoV-2 are associated with protection from COVID-19, it is important to determine the levels of specific IgG and neutralization titers against SARS-CoV-2 elicited by the vaccines. While three widely used vaccine brands (Pfizer-BNT162b2, Moderna-mRNA-1273 and Johnson-Ad26.COV2.S) are effective in preventing SARS-CoV-2 infection and alleviating COVID-19 illness, they have different efficacy against COVID-19. It is unclear whether the differences are due to varying ability of the vaccines to elicit a specific IgG antibody response and neutralization activity against spike protein of the virus. In this study, we compared the plasma IgG and neutralization titers against spike proteins of wild-type SARS-CoV-2 and eight variants in healthy subjects who received the mRNA-1273, BNT162b2 or Ad26.COV2.S vaccine. We demonstrated that subjects vaccinated with Ad26.COV2.S vaccine had significantly lower levels of IgG and neutralizing titers as compared to those who received the mRNA vaccines. While the linear regression analysis showed a positive correlation between IgG levels and neutralizing activities against SARS-CoV-2 WT and the variants, there was an overall reduction in neutralizing titers against the variants in subjects across the three groups. These findings suggest that people who received one dose of Ad26.COV2.S vaccine have a more limited IgG response and lower neutralization activity against SARS-CoV-2 WT and its variants than recipients of the mRNA vaccines. Thus, monitoring the plasma or serum levels of anti-SARS-CoV-2 spike IgG titer and neutralization activity is necessary for the selection of suitable vaccines, vaccine dosage and regimens.

Soybean-derived Bowman-Birk inhibitor inhibits neurotoxicity of LPS-activated macrophages.

BACKGROUND: Lipopolysaccharide (LPS), the major component of the outer membrane of gram-negative bacteria, can activate immune cells including macrophages. Activation of macrophages in the central nervous system (CNS) contributes to neuronal injury. Bowman-Birk inhibitor (BBI), a soybean-derived protease inhibitor, has anti-inflammatory properties. In this study, we examined whether BBI has the ability to inhibit LPS-mediated macrophage activation, reducing the release of pro-inflammatory cytokines and subsequent neurotoxicity in primary cortical neural cultures. METHODS: Mixed cortical neural cultures from rat were used as target cells for testing neurotoxicity induced by LPS-treated macrophage supernatant. Neuronal survival was measured using a cell-based ELISA method for expression of the neuronal marker MAP-2. Intracellular reactive oxygen species (ROS) production in macrophages was measured via 2', 7'-dichlorofluorescin diacetate (DCFH2DA) oxidation. Cytokine expression was determined by quantitative real-time PCR. RESULTS: LPS treatment of macrophages induced expression of proinflammatory cytokines (IL-1ß, IL-6 and TNF-α) and of ROS. In contrast, BBI pretreatment (1-100 µg/ml) of macrophages significantly inhibited LPS-mediated induction of these cytokines and ROS. Further, supernatant from BBI-pretreated and LPS-activated macrophage cultures was found to be less cytotoxic to neurons than that from non-BBI-pretreated and LPS-activated macrophage cultures. BBI, when directly added to the neuronal cultures (1-100 µg/ml), had no protective effect on neurons with or without LPS-activated macrophage supernatant treatment. In addition, BBI (100 µg/ml) had no effect on N-methyl-D-aspartic acid (NMDA)-mediated neurotoxicity. CONCLUSIONS: These findings demonstrate that BBI, through its anti-inflammatory properties, protects neurons from neurotoxicity mediated by activated macrophages.

Cellular microRNA expression correlates with susceptibility of monocytes/macrophages to HIV-1 infection.

Although both monocytes and macrophages possess essential requirements for HIV-1 entry, peripheral blood monocytes are infrequently infected with HIV-1 in vivo and in vitro. In contrast, tissue macrophages and monocyte-derived macrophages in vitro are highly susceptible to infection with HIV-1 R5 tropic strains. We investigated intracellular anti-HIV-1 factors that contribute to differential susceptibility of monocytes/macrophages to HIV-1 infection. Freshly isolated monocytes from peripheral blood had significantly higher levels of the anti-HIV-1 microRNAs (miRNA, miRNA-28, miRNA-150, miRNA-223, and miRNA-382) than monocyte-derived macrophages. The suppression of these anti-HIV-1 miRNAs in monocytes facilitates HIV-1 infectivity, whereas increase of the anti-HIV-1 miRNA expression in macrophages inhibited HIV-1 replication. These findings provide compelling and direct evidence at the molecular level to support the notion that intracellular anti-HIV-1 miRNA-mediated innate immunity may have a key role in protecting monocytes/macrophages from HIV-1 infection.

Methamphetamine facilitates HIV infection of primary human monocytes through inhibiting cellular viral restriction factors.

BACKGROUND: Methamphetamine (METH), a potent addictive psychostimulant, is highly prevalent in HIV-infected individuals. Clinically, METH use is implicated in alteration of immune system and increase of HIV spread/replication. Therefore, it is of importance to examine whether METH has direct effect on HIV infection of monocytes, the major target and reservoir cells for the virus. RESULTS: METH-treated monocytes were more susceptible to HIV infection as evidenced by increased levels of viral proteins (p24 and Pr55Gag) and expression of viral GAG gene. In addition, using HIV Bal with luciferase reporter gene (HIV Bal-eLuc), we showed that METH-treated cells expressed higher luciferase activities than untreated monocytes. Mechanistically, METH inhibited the expression of IFN-λ1, IRF7, STAT1, and the antiviral IFN-stimulated genes (ISGs: OAS2, GBP5, ISG56, Viperin and ISG15). In addition, METH down-regulated the expression of the HIV restriction microRNAs (miR-28, miR-29a, miR-125b, miR-146a, miR-155, miR-223, and miR-382). CONCLUSIONS: METH compromises the intracellular anti-HIV immunity and facilitates HIV replication in primary human monocytes.

TLR7 Activation of Macrophages by Imiquimod Inhibits HIV Infection through Modulation of Viral Entry Cellular Factors.

The Toll-like receptor (TLR) 7 is a viral sensor for detecting single-stranded ribonucleic acid (ssRNA), the activation of which can induce intracellular innate immunity against viral infections. Imiquimod, a synthetic ligand for TLR7, has been successfully used for the topical treatment of genital/perianal warts in immunocompetent individuals. We studied the effect of imiquimod on the human immunodeficiency virus (HIV) infection of primary human macrophages and demonstrated that the treatment of cells with imiquimod effectively inhibited infection with multiple strains (Bal, YU2, and Jago) of HIV. This anti-HIV activity of imiquimod was the most potent when macrophages were treated prior to infection. Infection of macrophages with pseudotyped HIV NL4-3-ΔEnv-eGFP-Bal showed that imiquimod could block the viral entry. Further mechanistic studies revealed that while imiquimod had little effect on the interferons (IFNs) expression, its treatment of macrophages resulted in the increased production of the CC chemokines (human macrophage inflammatory protein-1 alpha (MIP-1α), MIP-1ß, and upon activation regulated normal T cells expressed and secreted (RANTES)), the natural ligands of HIV entry co-receptor CCR5, and decreased the expression of CD4 and CCR5. The addition of the antibodies against the CC chemokines to macrophage cultures could block imiquimod-mediated HIV inhibition. These findings provide experimental evidence to support the notion that TLR7 participates in the intracellular immunity against HIV in macrophages, suggesting the further clinical evaluation of imiquimod for its additional benefit of treating genital/perianal warts in people infected with HIV.