Development of a Lateral Flow Strip Membrane Assay for Rapid and Sensitive Detection of the SARS-CoV-2.

The infection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) that causes the coronavirus disease 2019 (COVID-19) has threatened public health worldwide. The easy human-to-human transmission of this virus has rapidly evolved into a global pandemic. Therefore, to control the community spread of the virus, it is crucial to identify the infected individuals, including asymptomatic people. Hence, a specific and rapid assay is crucial for the early diagnosis and active monitoring of individuals potentially exposed to SARS-CoV-2 for controlling the COVID-19 outbreak. In this study, we have developed the novel lateral flow strip membrane (LFSM) assay that allows the simultaneous detection of RdRp, ORF3a, and N genes using the PCR product obtained by using the single-tube reverse transcription polymerase chain reaction (RT-PCR). The LFSM assay allows detection of SARS-CoV-2 in 30 min at 25 °C after the RT-PCR with the detection limit of 10 copies/test for each gene. The clinical performance of the LFSM assay for the detection of SARS-Cov-2 was evaluated using 162 clinical samples previously detected by using the commercial assay. The percent positive agreement, percent negative agreement, and overall percent agreement of the LFSM assay with the commercial assay were 100% (94.2-100%), 99.0% (94.6-100%), and 99.4% (96.6-100%), respectively. Therefore, the results of the LFSM assay showed significantly high concordance with the commercial assay for the detection of SARS-CoV-2 in clinical specimens. Therefore, we conclude that the developed LFSM assay can be used alone or complementary to the RT-PCR or other methods for the diagnosis and monitoring of the patients to curb community transmission and the pandemic.

Performance of 6 HCV genotyping 9G test for HCV genotyping in clinical samples.

BACKGROUND: A treatment of HCV infection depends on the genotype and sub-genotype. Therefore, accurate HCV genotyping is critical for selecting the appropriate treatment regimen. METHOD: This study included 280 plasma samples to evaluate the performance of 6 HCV Genotyping 9G test. The performance of 6 HCV Genotyping 9G test for accurate detection of HCV 1a, 1b, 2, 3, 4, and 6 genotypes was evaluated by comparing it with LiPA 2.0 assay and sequencing. RESULTS: 6 HCV Genotyping 9G test and LiPA 2.0 assay demonstrated 83.9% (n = 235) agreement. 39/45 samples that showed discrepant results between the two tests were analyzed by sequencing. Sequencing genotyped 39 discrepant samples as 0 (HCV 1a), 24 (HCV 1b), 1 (HCV 6f), 12 (HCV 6i), and 2 (HCV-negative). Results of 6 HCV Genotyping 9G test were very similar to the sequencing as it detected 1, 23, 1, 12, and 2 samples as HCV 1a, 1b, 3 & 6a or 6f, 6i or 6n, and negative, respectively. However, LiPA 2.0 assay showed complete disagreement with sequencing, as it did not detect any of these 39 samples correctly. These results indicate that LiPA 2.0 assay has limitations in identifying HCV genotypes 1b, and 6. The sensitivity, specificity, PPV, and NPV of 6 HCV Genotyping 9G test were 99.5, 98.8, 99.5, and 98.8%, respectively. It is important to note that HCV Genotyping 9G test showed 98.3 and 100% sensitivity for HCV 1b and 6 genotyping, respectively. However, LiPA 2.0 assay demonstrated 57.9 and 71.7% sensitivity for these genotypes. CONCLUSIONS: 6 HCV Genotyping 9G test identifies HCV 1a, 1b, 2, 3, and 6 with good agreement with sequencing. Hence, 6 HCV Genotyping 9G test has a high clinical value because it can provide critical information to physicians and assist them to use the correct drug for efficient hepatitis C treatment.

HCV Detection, Discrimination, and Genotyping Technologies.

According to the World Health Organization (WHO), 71 million people were living with Hepatitis C virus (HCV) infection worldwide in 2015. Each year, about 399,000 HCV-infected people succumb to cirrhosis, hepatocellular carcinoma, and liver failure. Therefore, screening of HCV infection with simple, rapid, but highly sensitive and specific methods can help to curb the global burden on HCV healthcare. Apart from the determination of viral load/viral clearance, the identification of specific HCV genotype is also critical for successful treatment of hepatitis C. This critical review focuses on the technologies used for the detection, discrimination, and genotyping of HCV in clinical samples. This article also focuses on advantages and disadvantages of the reported methods used for HCV detection, quantification, and genotyping.

A glass fibre membrane platform for ultra-sensitive detection of cardiac troponin T.

A glass fibre membrane platform that allows quantification of circulating cTnT with a LoD of 0.87 pg mL-1 is described. The proposed platform uses a glass fibre membrane, DNA-guided detection method, and antibody-conjugated fluorescent beads for the quantification of cTnT in the analytical detection range of 1-120 pg mL-1 at room temperature in 30 min. Glass fibre membranes were chemically modified to immobilize the oligonucleotide probes that catch a biomolecular complex (FB-dAB-cTnT-cAB-DNA) containing complementary oligonucleotides. There were no interferences from human cTnI, cTnC, skTnT, biotin, and hemoglobin (each 1 µg mL-1). The linearity in the serial dilution test of plasma samples indicates that this platform is highly applicable for regular health check-up to assess the risk of AMI and HF.

Ultra-Sensitive NT-proBNP Quantification for Early Detection of Risk Factors Leading to Heart Failure.

Cardiovascular diseases such as acute myocardial infarction and heart failure accounted for the death of 17.5 million people (31% of all global deaths) in 2015. Monitoring the level of circulating N-terminal proBNP (NT-proBNP) is crucial for the detection of people at risk of heart failure. In this article, we describe a novel ultra-sensitive NT-proBNP test (us-NT-proBNP) that allows the quantification of circulating NT-proBNP in 30 min at 25 °C in the linear detection range of 7.0-600 pg/mL. It is a first report on the application of a fluorescence bead labeled detection antibody, DNA-guided detection method, and glass fiber membrane platform for the quantification of NT-proBNP in clinical samples. Limit of blank, limit of detection, and limit of quantification were 2.0 pg/mL, 3.7 pg/mL, and 7 pg/mL, respectively. The coefficient of variation was found to be less than 10% in the entire detection range of 7-600 pg/mL. The test demonstrated specificity for NT-proBNP without interferences from bilirubin, intra-lipid, biotin, and hemoglobin. The serial dilution test for plasma samples containing various NT-proBNP levels showed the linear decrement in concentration with the regression coefficient of 0.980-0.998. These results indicate that us-NT-proBNP test does not suffer from the interference of the plasma components for the measurement of NT-proBNP in clinical samples.

Biomarker detection technologies and future directions.

Biomarkers play a vital role in disease detection and treatment follow-up. It is important to note that diseases in the early stage are typically treated with the greatest probability of success. However, due to various technical difficulties in current technologies for the detection of biomarkers, the potential of biomarkers is not explored completely. Therefore, the developments of technologies, which can enable the accurate detection of prostate cancer at an early stage with simple, experimental protocols are highly inevitable. This critical review evaluates the current methods and technologies used in the detection of biomarkers. The aim of this article is to provide a comprehensive review covering the advantages and disadvantages of the biomarker detection methods. Future directions for the development of technologies to achieve highly selective and sensitive detection of biomarkers for point-of-care applications are also commented on.

Accurate Detection of Rifampicin-Resistant Mycobacterium Tuberculosis Strains.

In 2013 alone, the death rate among the 9.0 million people infected with Mycobacterium tuberculosis (TB) worldwide was around 14%, which is unacceptably high. An empiric treatment of patients infected with TB or drug-resistant Mycobacterium tuberculosis (MDR-TB) strain can also result in the spread of MDR-TB. The diagnostic tools which are rapid, reliable, and have simple experimental protocols can significantly help in decreasing the prevalence rate of MDR-TB strain. We report the evaluation of the 9G technology based 9G DNAChips that allow accurate detection and discrimination of TB and MDR-TB-RIF. One hundred and thirteen known cultured samples were used to evaluate the ability of 9G DNAChip in the detection and discrimination of TB and MDR-TB-RIF strains. Hybridization of immobilized probes with the PCR products of TB and MDR-TB-RIF strains allow their detection and discrimination. The accuracy of 9G DNAChip was determined by comparing its results with sequencing analysis and drug susceptibility testing. Sequencing analysis showed 100% agreement with the results of 9G DNAChip. The 9G DNAChip showed very high sensitivity (95.4%) and specificity (100%).

MTB-DR-RIF 9G membrane: a platform for multiplex SNP detection of multidrug-resistant TB.

The MTB-DR-RIF 9G membrane can detect by detecting multiple mutations in multiple codons. The MTB-DR-RIF 9G membrane possesses clinical applicability in point-of-care settings for the following reasons: (i) 100% similar results with that of the sequencing analysis for clinical samples, (ii) discrimination of the multiple mutations in multiple codons, (iii) a specific/non-specific hybridization ratio higher than 350:1, and (iv) the sensitivity was found to be 1-10 copies/test for detection and discrimination of the wild and mutant TB strains. Graphical abstract Schematic illustration of the effect of controller DNA on the hybridization of the immobilized probes (corresponding to the wild TB strain) with the PCR product of (a) wild TB strain and (b) mutant TB strain.

Biological applications of functionalized calixarenes.

The functionalized calixarene derivatives exhibit remarkable properties towards organic and bioorganic molecules. However, the ability of calixarene derivatives to form stable complexes with biomolecules allows them to be applied for the development of biosensors and in the field of biology, biotechnology, and drug discovery. The applications of the functionalized calixarenes are summarized in this review, and an outlook for the future developments is discussed. A brief survey (of the last 10 years) on their biological application in various fields is also considered (199 references).

HPV genotyping 9G membrane test: a point-of-care diagnostic platform.

The results of HPV detection in 550 cervical samples by cervical cytology were compared with the sequencing analysis and HPV genotyping 9G membrane test. The HPV genotyping 9G membrane test can efficiently identify and discriminate five HR-HPV genotypes. The 100% identical results of HPV genotyping 9G membrane tests with the sequencing results in 550 clinical samples ensure its wide clinical applicability. The simple handling steps and the portable scanning device make the HPV genotyping 9G membrane test applicable in point-of-care settings. Moreover, the HPV genotyping 9G membrane test allows one to obtain final results in 30 min at 25 °C by simply loading the hybridization and washing solution and scanning the membranes without any drying steps or special handling. The clinical sensitivity and specificity of the HPV genotyping 9G membrane test was found to be 100%, which is much higher than cervical cytology.

Immobilization techniques for microarray: challenges and applications.

The highly programmable positioning of molecules (biomolecules, nanoparticles, nanobeads, nanocomposites materials) on surfaces has potential applications in the fields of biosensors, biomolecular electronics, and nanodevices. However, the conventional techniques including self-assembled monolayers fail to position the molecules on the nanometer scale to produce highly organized monolayers on the surface. The present article elaborates different techniques for the immobilization of the biomolecules on the surface to produce microarrays and their diagnostic applications. The advantages and the drawbacks of various methods are compared. This article also sheds light on the applications of the different technologies for the detection and discrimination of viral/bacterial genotypes and the detection of the biomarkers. A brief survey with 115 references covering the last 10 years on the biological applications of microarrays in various fields is also provided.

Development of a DNA-Based Lateral Flow Strip Membrane Assay for Rapid Screening and Genotyping of Six High-Incidence STD Pathogens.

Sexually transmitted diseases (STDs) are a global concern because approximately 1 million new cases emerge daily. Most STDs are curable, but if left untreated, they can cause severe long-term health implications, including infertility and even death. Therefore, a test enabling rapid and accurate screening and genotyping of STD pathogens is highly awaited. Herein, we present the development of the DNA-based 6STD Genotyping 9G Membrane test, a lateral flow strip membrane assay, for the detection and genotyping of six STD pathogens, including Trichomonas vaginalis, Ureaplasma urealyticum, Neisseria gonorrhoeae, Chlamydia trachomatis, Mycoplasma hominis, and Mycoplasma genitalium. Here, we developed a multiplex PCR primer set that allows PCR amplification of genomic materials for these six STD pathogens. We also developed the six ssDNA probes that allow highly efficient detection of the six STD pathogens. The 6STD Genotyping 9G Membrane test lets us obtain the final detection and genotyping results in less than 30 m after PCR at 25 °C. The accuracy of the 6STD Genotyping 9G membrane test in STD genotyping was confirmed by its 100% concordance with the sequencing results of 120 clinical samples. Therefore, the 6STD Genotyping 9G Membrane test emerges as a promising diagnostic tool for precise STD genotyping, facilitating informed decision-making in clinical practice.

9G DNAChip Technology: Self-Assembled Monolayer (SAM) of ssDNA for Ultra-Sensitive Detection of Biomarkers.

A 9G DNAChip obtained by allowing the formation of a self-assembled monolayer (SAM) of oligonucleotides appended with nine consecutive guanines on the chip surface has been applied in the detection of biomarkers. Using a 9G DNAChip, biomarker in the concentration range of 4 pg/mL to 40 fg/mL can be easily differentiated in the buffer matrix. Moreover, it is the first time that a biomarker with a concentration of 40 fg/mL has been detected in a mixture of proteins without use of any signal amplification technique.

Not all benzimidazole derivatives are microtubule destabilizing agents.

In recent years, microtubule-targeting agents (MTAs) have gained considerable interest in developing novel small-molecule anticancer drugs. MTAs demonstrate anticancer activity either as microtubule-stabilizing agents (paclitaxel) or microtubule-destabilizing agents (nocodazole). FDA-approved drugs containing a benzimidazole ring (nocodazole, albendazole, mebendazole, etc.) are well-known microtubule-destabilizing agents. Thus, most recent research on benzimidazole scaffold-based MTAs focuses on developing microtubule-destabilizing agents. However, there is no report on the benzimidazole scaffold-based microtubule-stabilizing agent. Here, we present the benzimidazole derivatives NI-11 and NI-18 that showed a profound anticancer activity as microtubule-stabilization agents. About twenty benzimidazole analogues were synthesized with excellent yield (80.0% ∼ 98.0%) and tested for their anticancer activity using two cancer cell lines (A549, MCF-7) and one normal cell line (MRC-5). NI-11 showed IC50 values of 2.90, 7.17, and 16.9 µM in A549, MCF-7, and MRC-5 cell lines. NI-18 showed IC50 values of 2.33, 6.10, and 12.1 µM in A549, MCF-7, and MRC-5 cell lines. Thus, NI-11 and NI-18 demonstrated selectivity indexes of 5.81 and 5.20, respectively, which are much higher than the currently available anticancer agents. NI-11 and NI-18 inhibited the cancer cell motility and migration, induced the early phase apoptosis. Both of these comounds were found to show an upregulation of DeY-α-tubulin and downregulation of Ac-α-tubulin expressions in cancer cells. Eventhough the reported benzimidazole scaffold-based commercially available drugs are known to be microtubule-destabilizing agents, the analogues NI-11 and NI-18 were found to have microtubule-stabilizing activity. The in vitro tubulin polymerization assay and the immunofluorescence assay results indicate that the NI-11 and NI-18 exhibit anticancer activity by stabilizing the microtubule network.

HPV 9G DNA chip: 100% clinical sensitivity and specificity.

We describe a novel HPV 9G DNA chip test for the accurate and reliable genotyping of human papillomavirus (HPV). The HPV 9G DNA chip test established its efficiency in terms of a signal-to-background ratio (SBR) of 200, which is 50 times superior to commercial HPV DNA chips, and 100% target-specific hybridization at 25°C. We compared the genotyping results for the 439 clinical samples by the HPV 9G DNA chip test with the sequencing results for the MY11/GP6+ (M2) primer set-mediated PCR products. The discrimination of HPV genotypes in the 151 HPV-positive clinical samples by the HPV 9G DNA chip test were 100% identical with the sequencing analysis. The clinical sensitivities of HPV genotyping by the HPV 9G DNA chip test and a commercial HPV DNA chip test were 100% and 88%, respectively. However, the clinical specificities of HPV genotyping by the HPV 9G DNA chip test and the commercial HPV DNA chip test were 100% and 94%, respectively. The 100% clinical sensitivity and specificity of the HPV 9G DNA chip test make it a promising diagnostic tool for HPV genotyping.

ID-Checker Technology for the Highly Selective Macroscale Delivery of Anticancer Agents to the Cancer Cells.

Cancer cells deploy several glucose transport protein (GLUT) channels on the cell membranes to increase glucose uptake. Cancer cells die within 24 h in the absence of glucose. Thus, preventing the deployment of GLUT channels can deprive them of glucose, resulting in apoptosis within 24 h. Herein, we developed the ID-Checker with a glucose tag that ensures its highly specific macroscale delivery of anticancer agents to the cancer cells through the GLUT channels. ID-Checker presented here showed IC50 values of 0.17-0.27 and 3.34 µM in cancer and normal cell lines, respectively. ID-Checker showed a selectivity index of 12.5-20.2, which is about 10-20 times higher than that of known anticancer agents such as colchicine. ID-Checker inhibits the microtubule formation, which results in the prevention of the deployment of GLUT channels in 6 h and kills the cancer cells within 24 h without any damage to normal cells.

Detection and Quantification of Tp53 and p53-Anti-p53 Autoantibody Immune Complex: Promising Biomarkers in Early Stage Lung Cancer Diagnosis.

Lung cancer is a leading cause of death worldwide, claiming nearly 1.80 million lives in 2020. Screening with low-dose computed tomography (LDCT) reduces lung cancer mortality by about 20% compared to standard chest X-rays among current or heavy smokers. However, several reports indicate that LDCT has a high false-positive rate. In this regard, methods based on biomarker detection offer excellent potential for developing noninvasive cancer diagnostic tests to complement LDCT for detecting stage 0∼IV lung cancers. Herein, we have developed a method for detecting and quantifying a p53-anti-p53 autoantibody complex and the total p53 antigen (wild and mutant). The LOD for detecting Tp53 and PIC were 7.41 pg/mL and 5.74 pg/mL, respectively. The detection ranges for both biomarkers were 0-7500 pg/mL. The known interfering agents in immunoassays such as biotin, bilirubin, intra-lipid, and hemoglobin did not detect Tp53 and PIC, even at levels that were several folds higher levels than their normal levels. Furthermore, the present study provides a unique report on this preliminary investigation using the PIC/Tp53 ratio to detect stage I-IV lung cancers. The presented method detects lung cancers with 81.6% sensitivity and 93.3% specificity. These results indicate that the presented method has high applicability for the identification of lung cancer patients from the healthy population.

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

A Novel Method That Allows SNP Discrimination with 160:1 Ratio for Biosensors Based on DNA-DNA Hybridization.

Highly sensitive (high SBR) and highly specific (high SNP discrimination ratio) DNA hybridization is essential for a biosensor with clinical application. Herein, we propose a method that allows detecting multiple pathogens on a single platform with the SNP discrimination ratios over 160:1 in the dynamic range of 101 to 104 copies per test. The newly developed SWAT method allows achieving highly sensitive and highly specific DNA hybridizations. The detection and discrimination of the MTB and NTM strain in the clinical samples with the SBR and SNP discrimination ratios higher than 160:1 indicate the high clinical applicability of the SWAT.

Development of a Method for Screening and Genotyping of HCV 1a, 1b, 2, 3, 4, and 6 Genotypes.

The World Health Organization and the World Health Assembly recommended eradicating hepatitis as a public threat by 2030. The accurate genotyping of hepatitis C virus (HCV) is crucial to achieving this goal because it is vital for the selection of anti-HCV therapy required for complete cure of HCV infection. We report the development of a method for accurate genotyping of HCV 1a, 1b, 2, 3, 4, and 6 genotypes. The merits of the developed method for HCV genotyping include (i) requirement of a single polymerase chain reaction (PCR) primer set, (ii) room-temperature detection in 30 min after the PCR, (iii) no need of highly trained professionals, (iv) highly accurate HCV genotyping results afforded by highly specific DNA-DNA hybridization, and (v) probe sequences that can be used on other platforms.