Early recruitment of PARP-dependent m8A RNA methylation at DNA lesions is subsequently accompanied by active DNA demethylation.

RNA methylation, especially 6-methyladenosine (m6A)-modified RNAs, plays a specific role in DNA damage response (DDR). Here, we also observe that RNA modified at 8-methyladenosine (m8A) is recruited to UVA-damaged chromatin immediately after microirradiation. Interestingly, the level of m8A RNA at genomic lesions was reduced after inhibition of histone deacetylases and DNA methyltransferases. It appears in later phases of DNA damage response, accompanied by active DNA demethylation. Also, PARP inhibitor (PARPi), Olaparib, prevented adenosine methylation at microirradiated chromatin. PARPi abrogated not only m6A and m8A RNA positivity at genomic lesions, but also XRCC1, the factor of base excision repair (BER), did not recognize lesions in DNA. To this effect, Olaparib enhanced the genome-wide level of γH2AX. This histone modification interacted with m8A RNAs to a similar extent as m8A RNAs with DNA. Pronounced interaction properties we did not observe for m6A RNAs and DNA; however, m6A RNA interacted with XRCC1 with the highest efficiency, especially in microirradiated cells. Together, we show that the recruitment of m6A RNA and m8A RNA to DNA lesions is PARP dependent. We suggest that modified RNAs likely play a role in the BER mechanism accompanied by active DNA demethylation. In this process, γH2AX stabilizes m6A/m8A-positive RNA-DNA hybrid loops via its interaction with m8A RNAs. R-loops could represent basic three-stranded structures recognized by PARP-dependent non-canonical m6A/m8A-mediated DNA repair pathway.

A device for investigation of natural cell mobility and deformability.

A microfluidic device made of polydimethylsiloxane was developed for continuous evaluation of natural migration mobility of many eukaryotic cells in relaxed and deformed state. The device was fabricated by standard photolithography and soft lithography techniques using the SU-8 3010 negative photoresist on a glass wafer as the master mold. The simple flow-free device exploits the chemotactic movement of cells through a set of mechanical barriers in the direction of concentration gradients of attractants. The barriers are formed by arrays of circular cross-section pillars with decreasing spacing 7, 5, and 3 µm. To pass through the obstacles, the cells are deformed and change their cytoskeletal architecture. The instantaneous migration velocities of cells are monitored in a time-lapse setup of the scanning confocal microscope. Thus, the cellular deformability and migratory activity can easily be evaluated. The functionality of the device was tested with model HeLa cells stably transfected with fluorescent Premo FUCCI Cell Cycle Sensor. The designed device has the potential to be implemented for testing the tendency of patients' tumors to metastasis.

HDAC1 and HDAC3 underlie dynamic H3K9 acetylation during embryonic neurogenesis and in schizophrenia-like animals.

Although histone acetylation is one of the most widely studied epigenetic modifications, there is still a lack of information regarding how the acetylome is regulated during brain development and pathophysiological processes. We demonstrate that the embryonic brain (E15) is characterized by an increase in H3K9 acetylation as well as decreases in the levels of HDAC1 and HDAC3. Moreover, experimental induction of H3K9 hyperacetylation led to the overexpression of NCAM in the embryonic cortex and depletion of Sox2 in the subventricular ependyma, which mimicked the differentiation processes. Inducing differentiation in HDAC1-deficient mouse ESCs resulted in early H3K9 deacetylation, Sox2 downregulation, and enhanced astrogliogenesis, whereas neuro-differentiation was almost suppressed. Neuro-differentiation of (wt) ESCs was characterized by H3K9 hyperacetylation that was associated with HDAC1 and HDAC3 depletion. Conversely, the hippocampi of schizophrenia-like animals showed H3K9 deacetylation that was regulated by an increase in both HDAC1 and HDAC3. The hippocampi of schizophrenia-like brains that were treated with the cannabinoid receptor-1 inverse antagonist AM251 expressed H3K9ac at the level observed in normal brains. Together, the results indicate that co-regulation of H3K9ac by HDAC1 and HDAC3 is important to both embryonic brain development and neuro-differentiation as well as the pathophysiology of a schizophrenia-like phenotype.

Depletion of A-type lamins and Lap2α reduces 53BP1 accumulation at UV-induced DNA lesions and Lap2α protein is responsible for compactness of irradiated chromatin.

We studied how deficiency in lamins A/C and lamina-associated polypeptide 2α (Lap2α) affects DNA repair after irradiation. A-type lamins and Lap2α were not recruited to local DNA lesions and did not accumulate to γ-irradiation-induced foci (IRIF), as it is generally observed for well-known marker of DNA lesions, 53BP1 protein. At micro-irradiated chromatin of lmna double knockout (dn) and Lap2α dn cells, 53BP1 protein levels were reduced, compared to locally irradiated wild-type counterpart. Decreased levels of 53BP1 we also observed in whole populations of lmna dn and Lap2α dn cells, irradiated by UV light. We also studied distribution pattern of 53BP1 protein in a genome outside micro-irradiated region. In Lap2α deficient cells, identical fluorescence of mCherry-tagged 53BP1 protein was found at both microirradiated region and surrounding chromatin. However, a well-known marker of double strand breaks, γH2AX, was highly abundant in the lesion-surrounding genome of Lap2α deficient cells. Described changes, induced by irradiation in Lap2α dn cells, were not accompanied by cell cycle changes. In Lap2α dn cells, we additionally performed analysis by FLIM (Fluorescence Lifetime Imaging Microscopy) that showed different dynamic behavior of mCherry-tagged 53BP1 protein pools when it was compared with wild-type (wt) fibroblasts. This analysis revealed three different fractions of mCherry-53BP1 protein. Two of them showed identical exponential decay times (τ1 and τ3), but the decay rate of τ2 and amplitudes of fluorescence decays (A1-A3) were statistically different in wt and Lap2α dn fibroblasts. Moreover, γ-irradiation weakened an interaction between A-type lamins and Lap2α. Together, our results demonstrate how depletion of Lap2α affects DNA damage response (DDR) and how chromatin compactness is changed in Lap2α deficient cells exposed to radiation.

Mutations in the TP53 gene affected recruitment of 53BP1 protein to DNA lesions, but level of 53BP1 was stable after γ-irradiation that depleted MDC1 protein in specific TP53 mutants.

53BP1 is a very well-known protein that is recruited to DNA lesions. The focal accumulation of p53 binding protein, 53BP1, is a main feature indicating the repair of spontaneous or irradiation-induced foci (IRIF). Thus, here, we addressed the question of whether mutations in the TP53 gene, which often affect the level of p53 protein, can change the recruitment of 53BP1 to γ- or UVA-irradiated chromatin. In various TP53 mutants, we observed a distinct accumulation of 53BP1 protein to UV-induced DNA lesions: in R273C mutants, 53BP1 appeared transiently at DNA lesions, during 10-30 min after irradiation; the mutation R282W was responsible for accumulation of 53BP1 immediately after UVA-damage; and in L194F mutants, the first appearance of 53BP1 protein at the lesions occurred during 60-70 min. These results showed that specific mutations in the TP53 gene stand behind not only different levels of p53 protein, but also affect the localized kinetics of 53BP1 protein in UVA-damaged chromatin. However, after γ-irradiation, only G245S mutation in TP53 gene was associated with surprisingly decreased level of 53BP1 protein. In other mutant cell lines, levels of 53BP1 were not affected by γ-rays. To these effects, we conversely found a distinct number of 53BP1-positive irradiation-induced foci in various TP53 mutants. The R280K, G245S, L194F mutations, or TP53 deletion were also characterized by radiation-induced depletion in MDC1 protein. Moreover, in mutant cells, an interaction between MDC1 and 53BP1 proteins was abrogated when compared with wild-type counterpart. Together, the kinetics of 53BP1 accumulation at UV-induced DNA lesions is different in various TP53 mutant cells. After γ-irradiation, despite changes in a number and a volume of 53BP1-positive foci, levels of 53BP1 protein were relatively stable. Here, we showed a link between the status of MDC1 protein and TP53 gene, which specific mutations caused radiation-induced MDC1 down-regulation. This observation is significant, especially with regard to radiotherapy of tumors with abrogated function of TP53 gene.

Localized Movement and Levels of 53BP1 Protein Are Changed by γ-irradiation in PML Deficient Cells.

We studied epigenetics, distribution pattern, kinetics, and diffusion of proteins recruited to spontaneous and γ-radiation-induced DNA lesions. We showed that PML deficiency leads to an increased number of DNA lesions, which was accompanied by changes in histone signature. In PML wt cells, we observed two mobile fractions of 53BP1 protein with distinct diffusion in spontaneous lesions. These protein fractions were not detected in PML-deficient cells, characterized by slow-diffusion of 53BP1. Single particle tracking analysis revealed limited local motion of 53BP1 foci in PML double null cells and local motion 53BP1 foci was even more reduced after γ-irradiation. However, radiation did not change co-localization between 53BP1 nuclear bodies and interchromatin granule-associated zones (IGAZs), nuclear speckles, or chromocenters. This newly observed interaction pattern imply that 53BP1 protein could be a part of not only DNA repair, but also process mediated via components accumulated in IGAZs, nuclear speckles, or paraspeckles. Together, PML deficiency affected local motion of 53BP1 nuclear bodies and changed composition and a number of irradiation-induced foci. J. Cell. Biochem. 117: 2583-2596, 2016. © 2016 Wiley Periodicals, Inc.

The level and distribution pattern of HP1ß in the embryonic brain correspond to those of H3K9me1/me2 but not of H3K9me3.

We studied the histone signature of embryonic and adult brains to strengthen existing evidence of the importance of the histone code in mouse brain development. We analyzed the levels and distribution patterns of H3K9me1, H3K9me2, H3K9me3, and HP1ß in both embryonic and adult brains. Western blotting showed that during mouse brain development, the levels of H3K9me1, H3K9me2, and HP1ß exhibited almost identical trends, with the highest protein levels occurring at E15 stage. These trends differed from the relatively stable level of H3K9me3 at developmental stages E8, E13, E15, and E18. Compared with embryonic brains, adult brains were characterized by very low levels of H3K9me1/me2/me3 and HP1ß. Manipulation of the embryonic epigenome through histone deacetylase inhibitor treatment did not affect the distribution patterns of the studied histone markers in embryonic ventricular ependyma. Similarly, Hdac3 depletion in adult animals had no effect on histone methylation in the adult hippocampus. Our results indicate that the distribution of HP1ß in the embryonic mouse brain is related to that of H3K9me1/me2 but not to that of H3K9me3. The unique status of H3K9me3 in the brain was confirmed by its pronounced accumulation in the granular layer of the adult olfactory bulb. Moreover, among the studied proteins, H3K9me3 was the only posttranslational histone modification that was highly abundant at clusters of centromeric heterochromatin, called chromocenters. When we focused on the hippocampus, we found this region to be rich in H3K9me1 and H3K9me3, whereas H3K9me2 and HP1ß were present at a very low level or even absent in the hippocampal blade. Taken together, these results revealed differences in the epigenome of the embryonic and adult mouse brain and showed that the adult hippocampus, the granular layer of the adult olfactory bulb, and the ventricular ependyma of the embryonic brain are colonized by specific epigenetic marks.

Distinct kinetics of DNA repair protein accumulation at DNA lesions and cell cycle-dependent formation of γH2AX- and NBS1-positive repair foci.

BACKGROUND INFORMATION: The DNA damage response is a fundamental, well-regulated process that occurs in the genome to recognise DNA lesions. Here, we studied kinetics of proteins involved in DNA repair pathways and their recruitment to DNA lesions during the cell cycle. In non-irradiated and irradiated cells, we analysed the distribution pattern and spatiotemporal dynamics of γH2AX, 53BP1, BMI1, MDC1, NBS1, PCNA, coilin and BRCA1 proteins. RESULTS: We observed that spontaneous and irradiation-induced foci (IRIF) demonstrated a high abundance of phosphorylated H2AX, which was consistent with 53BP1 and BMI1 protein accumulation. However, NBS1 and MDC1 proteins were recruited to nuclear bodies (NBs) to a lesser extent. Irradiation by γ-rays significantly increased the number of 53BP1- and γH2AX-positive IRIF, but cell cycle-dependent differences were only observed for γH2AX-positive foci in both non-irradiated and γ-irradiated cells. In non-irradiated cells, the G2 phase was characterised by an increased number of spontaneous γH2AX-foci; this increase was more pronounced after γ-irradiation. Cells in G2 phase had the highest number of γH2AX-positive foci. Similarly, γ-irradiation increased the number of NBS1-positive NBs only in G2 phase. Moreover, NBS1 accumulated in nucleoli after γ-irradiation showed the slowest recovery after photobleaching. Analysis of protein accumulation kinetics at locally induced DNA lesions showed that in HeLa cells, BMI1, PCNA and coilin were rapidly recruited to the lesions, 10-15 s after UVA-irradiation, whereas among the other proteins studied, BRCA1 demonstrated the slowest recruitment: BRCA1 appeared at the lesion 20 min after local micro-irradiation by UVA laser. CONCLUSION: We show that the kinetics of the accumulation of selected DNA repair-related proteins is protein specific at locally induced DNA lesions, and that the formation of γH2AX- and NBS1-positive foci, but not 53BP1-positive NBs, is cell cycle dependent in HeLa cells. Moreover, γH2AX is the most striking protein present not only at DNA lesions, but also spreading out in their vicinity. SIGNIFICANCE: Our conclusions highlight the significant role of the spatiotemporal dynamics of DNA repair-related proteins and their specific assembly/disassembly at DNA lesions, which can be cell type- and cell cycle dependent.

Advanced Image Acquisition and Analytical Techniques for Studies of Living Cells and Tissue Sections.

Studies on fixed samples or genome-wide analyses of nuclear processes are useful for generating snapshots of a cell population at a particular time point. However, these experimental approaches do not provide information at the single-cell level. Genome-wide studies cannot assess variability between individual cells that are cultured in vitro or originate from different pathological stages. Immunohistochemistry and immunofluorescence are fundamental experimental approaches in clinical laboratories and are also widely used in basic research. However, the fixation procedure may generate artifacts and prevents monitoring of the dynamics of nuclear processes. Therefore, live-cell imaging is critical for studying the kinetics of basic nuclear events, such as DNA replication, transcription, splicing, and DNA repair. This review is focused on the advanced microscopy analyses of the cells, with a particular focus on live cells. We note some methodological innovations and new options for microscope systems that can also be used to study tissue sections. Cornerstone methods for the biophysical research of living cells, such as fluorescence recovery after photobleaching and fluorescence resonance energy transfer, are also discussed, as are studies on the effects of radiation at the individual cellular level.

Post-Translational Modifications of Histones in Human Sperm.

We examined the levels and distribution of post-translationally modified histones and protamines in human sperm. Using western blot immunoassay, immunofluorescence, mass spectrometry (MS), and FLIM-FRET approaches, we analyzed the status of histone modifications and the protamine P2. Among individual samples, we observed variability in the levels of H3K9me1, H3K9me2, H3K27me3, H3K36me3, and H3K79me1, but the level of acetylated (ac) histones H4 was relatively stable in the sperm head fractions, as demonstrated by western blot analysis. Sperm heads with lower levels of P2 exhibited lower levels of H3K9ac, H3K9me1, H3K27me3, H3K36me3, and H3K79me1. A very strong correlation was observed between the levels of P2 and H3K9me2. FLIM-FRET analysis additionally revealed that acetylated histones H4 are not only parts of sperm chromatin but also appear in a non-integrated form. Intriguingly, H4ac and H3K27me3 were detected in sperm tail fractions via western blot analysis. An appearance of specific histone H3 and H4 acetylation and H3 methylation in sperm tail fractions was also confirmed by both LC-MS/MS and MALDI-TOF MS analysis. Taken together, these data indicate that particular post-translational modifications of histones are uniquely distributed in human sperm, and this distribution varies among individuals and among the sperm of a single individual.

Recruitment of HP1ß to UVA-induced DNA lesions is independent of radiation-induced changes in A-type lamins.

BACKGROUND INFORMATION: The optimal repair of DNA lesions is fundamental for physiological processes. We asked whether the recruitment of HP1ß, 53BP1 and BMI1 proteins to ultraviolet (UVA)-induced DNA lesions requires functional A-type lamins. RESULTS: We found that UVA irradiation of nuclear lamina abolished the fluorescence of mCherry-tagged A-type lamins and destroyed the nuclear lamina as also observed by electron microscopy studies. Similarly, an absence of endogenous A- and B-type lamins was found in irradiated regions by UVA. However, irradiation did not affect the recruitment of HP1ß, 53BP1 and BMI1 to DNA lesions. The UVA-induced shrinkage of the nuclear lamina, which anchors chromatin, explains why UVA-micro-irradiated chromatin is relaxed. Conversely, additional experiments with γ-irradiation showed that the nuclear lamina remained intact and the genome-wide level of HP1ß was stable. Fluorescence intensity of HP1ß and BMI1 in UVA-induced DNA lesions and level of HP1ß after γ-irradiation were unaffected by deficiency in A-type lamins, whereas those parameters of 53BP1 were changed. CONCLUSIONS: We conclude that only the 53BP1 status in DNA lesions, induced by UVA or γ-rays, is affected by A-type lamin deficiency, which was not observed for heterochromatin-related proteins HP1ß and BMI1.

Nuclear structures surrounding internal lamin invaginations.

A- and C-type lamins are intermediate filament proteins responsible for the maintenance of nuclear shape and most likely nuclear architecture. Here, we propose that pronounced invaginations of A/C-type lamins into the nuclear interior represent channels for the transport of regulatory molecules to and from nuclear and nucleolar regions. Using fluorescent protein technology and immunofluorescence, we show that A-type lamin channels interact with several nuclear components, including fibrillarin- and UBF-positive regions of nucleoli, foci of heterochromatin protein 1 ß, polycomb group bodies, and genomic regions associated with DNA repair. Similar associations were observed between A/C-type lamin channels and nuclear pores, lamin-associated protein LAP2α, and promyelocytic leukemia nuclear bodies. Interestingly, regions with high levels of A/C-type lamins had low levels of B-type lamins, and vice versa. These characteristics were observed in primary and immortalized mouse embryonic fibroblasts as well as human and mouse embryonic stem cell colonies exhibiting stem cell-specific lamin positivity. Our findings indicate that internal channels formed by nuclear lamins likely contribute to normal cellular processes through association with various nuclear and nucleolar structures.

Cell differentiation along multiple pathways accompanied by changes in histone acetylation status.

Post-translational modification of histones is fundamental to the regulation of basic nuclear processes and subsequent cellular events, including differentiation. In this study, we analyzed acetylated forms of histones H2A, H2B, and H4 during induced differentiation in mouse (mESCs) and human (hESCs) embryonic stem cells and during induced enterocytic differentiation of colon cancer cells in vitro. Endoderm-like differentiation of mESCs induced by retinoic acid and enterocytic differentiation induced by histone deacetylase inhibitor sodium butyrate were accompanied by increased mono-, di-, and tri-acetylation of histone H2B and a pronounced increase in di- and tri-acetylation of histone H4. In enterocytes, mono-acetylation of histone H2A also increased and tetra-acetylation of histone H4 appeared only after induction of this differentiation pathway. During differentiation of hESCs, we observed increased mono-acetylation and decreased tri-acetylation of H2B. Mono-, di-, and tri-acetylation of H4 were reduced, manifested by a significant increase in nonacetylated H4 histones. Levels of acetylated histones increased during induced differentiation in mESCs and during histone deacetylase (HDAC) inhibitor-induced enterocytic differentiation, whereas differentiation of human ESCs was associated with reduced acetylation of histones H2B and H4.

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene.

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

Acetylation-dependent nuclear arrangement and recruitment of BMI1 protein to UV-damaged chromatin.

Polycomb group (PcG) proteins, organized into Polycomb bodies, are important regulatory components of epigenetic processes involved in the heritable transcriptional repression of target genes. Here, we asked whether acetylation can influence the nuclear arrangement and function of the BMI1 protein, a core component of the Polycomb group complex, PRC1. We used time-lapse confocal microscopy, micro-irradiation by UV laser (355 nm) and GFP technology to study the dynamics and function of the BMI1 protein. We observed that BMI1 was recruited to UV-damaged chromatin simultaneously with decreased lysine acetylation, followed by the recruitment of heterochromatin protein HP1ß to micro-irradiated regions. Pronounced recruitment of BMI1 was rapid, with half-time τ = 15 sec; thus, BMI1 is likely involved in the initiation step leading to the recognition of UV-damaged sites. Histone hyperacetylation, stimulated by HDAC inhibitor TSA, suppression of transcription by actinomycin D, and ATP-depletion prevented increased accumulation of BMI1 to γH2AX-positive irradiated chromatin. Moreover, BMI1 had slight ability to recognize spontaneously occurring DNA breaks caused by other pathophysiological processes. Taken together, our data indicate that the dynamics of recognition of UV-damaged chromatin, and the nuclear arrangement of BMI1 protein can be influenced by acetylation and occur as an early event prior to the recruitment of HPß to UV-irradiated chromatin.

Arrangement of nuclear structures is not transmitted through mitosis but is identical in sister cells.

Although it is well known that chromosomes are non-randomly organized during interphase, it is not completely clear whether higher-order chromatin structure is transmitted from mother to daughter cells. Therefore, we addressed the question of how chromatin is rearranged during interphase and whether heterochromatin pattern is transmitted after mitosis. We additionally tested the similarity of chromatin arrangement in sister interphase nuclei. We noticed a very active cell rotation during interphase, especially when histone hyperacetylation was induced or transcription was inhibited. This natural phenomenon can influence the analysis of nuclear arrangement. Using photoconversion of Dendra2-tagged core histone H4 we showed that the distribution of chromatin in daughter interphase nuclei differed from that in mother cells. Similarly, the nuclear distribution of heterochromatin protein 1ß (HP1ß) was not completely identical in mother and daughter cells. However, identity between mother and daughter cells was in many cases evidenced by nucleolar composition. Moreover, morphology of nucleoli, HP1ß protein, Cajal bodies, chromosome territories, and gene transcripts were identical in sister cell nuclei. We conclude that the arrangement of interphase chromatin is not transmitted through mitosis, but the nuclear pattern is identical in naturally synchronized sister cells. It is also necessary to take into account the possibility that cell rotation and the degree of chromatin condensation during functionally specific cell cycle phases might influence our view of nuclear architecture.

The Highest Density of Phosphorylated Histone H1 Appeared in Prophase and Prometaphase in Parallel with Reduced H3K9me3, and HDAC1 Depletion Increased H1.2/H1.3 and H1.4 Serine 38 Phosphorylation.

BACKGROUND: Variants of linker histone H1 are tissue-specific and are responsible for chromatin compaction accompanying cell differentiation, mitotic chromosome condensation, and apoptosis. Heterochromatinization, as the main feature of these processes, is also associated with pronounced trimethylation of histones H3 at the lysine 9 position (H3K9me3). METHODS: By confocal microscopy, we analyzed cell cycle-dependent levels and distribution of phosphorylated histone H1 (H1ph) and H3K9me3. By mass spectrometry, we studied post-translational modifications of linker histones. RESULTS: Phosphorylated histone H1, similarly to H3K9me3, has a comparable level in the G1, S, and G2 phases of the cell cycle. A high density of phosphorylated H1 was inside nucleoli of mouse embryonic stem cells (ESCs). H1ph was also abundant in prophase and prometaphase, while H1ph was absent in anaphase and telophase. H3K9me3 surrounded chromosomal DNA in telophase. This histone modification was barely detectable in the early phases of mitosis. Mass spectrometry revealed several ESC-specific phosphorylation sites of H1. HDAC1 depletion did not change H1 acetylation but potentiated phosphorylation of H1.2/H1.3 and H1.4 at serine 38 positions. CONCLUSIONS: Differences in the level and distribution of H1ph and H3K9me3 were revealed during mitotic phases. ESC-specific phosphorylation sites were identified in a linker histone.

Effects of epigenetic-based anti-cancer drugs in leukaemia and multiple myeloma cells.

Here, we focus on epigenetic changes in leukaemia and MM (multiple myeloma) cells. We show how the histone signature, DNA methylation and levels of select tumour-suppressor proteins can be affected by inhibitors of HDACs (histone deacetylases) and Dnmts (DNA methyltransferases). Both inhibitors, TSA (trichostatin A) and 5-AZA (5-azacytidine), have the ability to change the histone signature in a tumour-specific manner. In MM cells, we observed changes in H3K4 methylation, while in leukaemia cells, H3K9 methylation was especially affected by select inhibitors. Compared with normal peripheral blood lymphocytes, tumour cell samples were characterized by increased H3K9 acetylation, increased H3K4me2, H3K9me2 and HP1α (heterochromatin protein 1α) levels and specific changes were also observed for DNA methylation. Additionally, we showed that the tumour suppressor pRb1 (retinoblastoma protein) is more sensitive to epigenetic-based anti-cancer stimuli than p53. We have found significant decrease in the levels of pRb1 and p53 in both myeloma and leukaemia cells after HDAC inhibition.

The SC-35 Splicing Factor Interacts with RNA Pol II and A-Type Lamin Depletion Weakens This Interaction.

The essential components of splicing are the splicing factors accumulated in nuclear speckles; thus, we studied how DNA damaging agents and A-type lamin depletion affect the properties of these regions, positive on the SC-35 protein. We observed that inhibitor of PARP (poly (ADP-ribose) polymerase), and more pronouncedly inhibitors of RNA polymerases, caused DNA damage and increased the SC35 protein level. Interestingly, nuclear blebs, induced by PARP inhibitor and observed in A-type lamin-depleted or senescent cells, were positive on both the SC-35 protein and another component of the spliceosome, SRRM2. In the interphase cell nuclei, SC-35 interacted with the phosphorylated form of RNAP II, which was A-type lamin-dependent. In mitotic cells, especially in telophase, the SC35 protein formed a well-visible ring in the cytoplasmic fraction and colocalized with ß-catenin, associated with the plasma membrane. The antibody against the SRRM2 protein showed that nuclear speckles are already established in the cytoplasm of the late telophase and at the stage of early cytokinesis. In addition, we observed the occurrence of splicing factors in the nuclear blebs and micronuclei, which are also sites of both transcription and splicing. This conclusion supports the fact that splicing proceeds transcriptionally. According to our data, this process is A-type lamin-dependent. Lamin depletion also reduces the interaction between SC35 and ß-catenin in mitotic cells.

Chromocentre integrity and epigenetic marks.

The epigenetic modification of histones dictates the formation of euchromatin and heterochromatin domains. We studied the effects of a deficiency of histone methyltransferase, SUV39h, and trichostatin A-dependent hyperacetylation on the structural stability of centromeric clusters, called chromocentres. We did not observe the expected disintegration of chromocentres, but both SUV39h deficiency and hyperacetylation in SUV39h+/+ cells induced the re-positioning of chromocentres closer to the nuclear periphery. Conversely, TSA treatment of SUV39h-/- cells re-established normal nuclear radial positioning of chromocentres. This structural re-arrangement was likely caused by several epigenetic events at centromeric heterochromatin. In particular, reciprocal exchanges between H3K9me1, H3K9me2, H3K9me3, DNA methylation, and HP1 protein levels influenced chromocentre nuclear composition. For example, H3K9me1 likely substituted for the function of H3K9me3 in chromocentre nuclear arrangement and compaction. Our results illustrate the important and interchangeable roles of epigenetic marks for chromocentre integrity. Therefore, we propose a model for epigenetic regulation of nuclear stability of centromeric heterochromatin in the mouse genome.