TRIM24 Up-Regulates ORM2 to Alleviate Abnormal Lipid Metabolism, Inflammation, and Oxidative Stress in Mice with Obstructive Sleep Apnea Syndrome and Metabolic Dysfunction-Associated Steatotic Liver Disease.

Obstructive sleep apnea syndrome (OSAS) is associated with the development and progression of metabolic dysfunction-associated steatotic liver disease (MASLD). Tripartite motif containing 24 (TRIM24) deficiency was reported to cause hepatic lipid accumulation and hepatitis. However, the expression, function, and mechanism of TRIM24 in OSAS and MASLD remain unclear. OSAS and MASLD mouse model was established by intermittent hypoxia (IH) and high-fat diet. IH- and 1% free fatty acid-induced mouse liver cells served as an in vitro model. TRIM24 and HIF-1α were up-regulated under the IH condition. HIF-1α enhanced the transcriptional activity of TRIM24. Overexpression of TRIM24 reduced hepatic lipid accumulation, decreased serum levels of total cholesterol, triglyceride, and low-density lipoprotein cholesterol, and increased serum levels of high-density lipoprotein cholesterol in OSAS and MASLD mice. Additionally, overexpression of TRIM24 alleviated inflammation and oxidative stress, and modulated aberrant lipid metabolism. Mechanically, TRIM24 up-regulated the expression of ORM2, a key regulator of hepatic lipogenesis, by binding to H3K27ac and recruiting retinoic acid receptor-α to ORM2 promoter. The cell rescue model verified that ORM2 mediated the hepatoprotective effects of TRIM24. Our evidence reveals the important role of TRIM24 as an epigenetic coregulator of transcription in OSAS and MASLD, providing additional insights into understanding the pathogenesis and preventing the development of OSAS and MASLD.

Disaster Plant Pathology: Smart Solutions for Threats to Global Plant Health from Natural and Human-Driven Disasters.

Disaster plant pathology addresses how natural and human-driven disasters impact plant diseases and the requirements for smart management solutions. Local to global drivers of plant disease change in response to disasters, often creating environments more conducive to plant disease. Most disasters have indirect effects on plant health through factors such as disrupted supply chains and damaged infrastructure. There is also the potential for direct effects from disasters, such as pathogen or vector dispersal due to floods, hurricanes, and human migration driven by war. Pulse stressors such as hurricanes and war require rapid responses, whereas press stressors such as climate change leave more time for management adaptation but may ultimately cause broader challenges. Smart solutions for the effects of disasters can be deployed through digital agriculture and decision support systems supporting disaster preparedness and optimized humanitarian aid across scales. Here, we use the disaster plant pathology framework to synthesize the effects of disasters in plant pathology and outline solutions to maintain food security and plant health in catastrophic scenarios. We recommend actions for improving food security before and following disasters, including (i) strengthening regional and global cooperation, (ii) capacity building for rapid implementation of new technologies, (iii) effective clean seed systems that can act quickly to replace seed lost in disasters, (iv) resilient biosecurity infrastructure and risk assessment ready for rapid implementation, and (v) decision support systems that can adapt rapidly to unexpected scenarios. [Formula: see text] Copyright © 2024 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.

The effect of individualized ocular refraction customized spectacle lenses on myopia control in schoolchildren: A 1-year randomised clinical trial.

PURPOSE: The aim of this study was to investigate the effect of individualized ocular refraction customized (IORC) spectacle lenses with different actual amounts of peripheral myopic defocus (MD) on myopia control over 1 year. These lenses compensate for the original peripheral refraction via the free-form surface on the back of the lens. METHODS: This 1-year, double-masked randomised clinical trial included 184 myopic schoolchildren aged 8-12 years. Participants were randomised to receive IORC lenses with high (IORC-H group, +4.50 D), medium (IORC-M group, +3.50 D) or low (IORC-L group, +2.50 D) MD or single-vision (SV) lenses. The spherical equivalent refractive error (SER) and axial length (AL) were measured at baseline and 6-monthly intervals. RESULTS: After 1 year, the mean (SD) changes in SER were -0.18 (0.37), -0.36 (0.37), -0.52 (0.39) and -0.60 (0.42) D for the IORC-H, IORC-M, IORC-L and SV groups, respectively. Compared with the SV group, the effects of slowing myopia progression were 70%, 40% and 13% for the IORC-H (difference of 0.47 D, p < 0.001), IORC-M (difference of 0.32 D, p = 0.001) and IORC-L (difference of 0.15 D, p > 0.05) groups, respectively. The mean (SD) changes in AL were 0.12 (0.16), 0.23 (0.17), 0.29 (0.17) and 0.36 (0.17) mm for the IORC-H, IORC-M, IORC-L and SV groups, respectively. The axial elongation was 67%, 36% and 19% lower in the IORC-H (difference of 0.25 mm, p < 0.001), IORC-M (difference of 0.15 mm, p < 0.001) and IORC-L (difference of 0.10 mm, p = 0.04) groups, respectively, compared with the SV group. The IORC-H group exhibited significantly less axial elongation than the IORC-M and IORC-L groups (p = 0.01 and p < 0.001, respectively). CONCLUSION: Compared with the IORC-M and IORC-L lenses, the IORC-H lens was found to have superior efficacy in inhibiting myopic progression and slowing eye growth in schoolchildren, with better myopia control efficacy in younger children.

[Analysis of clinical research features and outcome indexes of traditional Chinese medicine intervention in septic kidney injury].

This study aims to systematically review the clinical features and outcome indicators in randomized controlled trial(RCT) of traditional Chinese medicine(TCM) intervention in septic kidney injury and provide a reference for optimizing clinical study design and building the core outcome set(COS) of TCM treatment of septic kidney injury. Computer searches were conducted on PubMed, Cochrane Library, EMbase, Web of Science, CNKI, Wanfang, VIP, and SinoMed to find published RCT of TCM intervention in septic kidney injury in the past five years, extract the basic characteristics, intervention measures, outcome indicators, and other data of included studies, and conduct descriptive analysis. 53 RCTs were included, and the sample size was mostly concentrated in 60-80 cases, with abdominal infection being the most common(15 articles, 83.3%) and the TCM syndrome of blood stasis being the most frequent(9 articles, 50.0%). The frequency of intervention methods from high to low were TCM decoction(28 articles, 52.8%), Chinese patent medicine(22 articles, 41.5%), and combined TCM therapy(3 articles, 7.5%); the intervention time of the trial was more than 7 d(34 articles, 69.4%). The risk of bias in included studies was unclear. A total of 84 outcome indicators were involved, which were divided into 9 fields, including 63 physical and chemical tests(305 times, 72.2%), 4 kinds of disease degree(48 times, 11.6%), 4 kinds of clinical effective rate(15 times, 3.6%), 1 kind of quality of life(1 time, 0.2%), 2 kinds of economic evaluation(14 times, 3.3%), 1 kind of TCM disease(9 times, 2.1%), 2 kinds of long-term prognosis(16 times, 3.8%), 2 kinds of safety events(6 times, 1.4%), and 5 other indicators(8 times, 0.7%). The cumulative frequency was 422 times, among which the outcome indicators with higher frequency were inflammatory factors(42 articles, 79.2%) and markers of renal function and kidney injury(40 articles, 75.5%). Only 1(1.9%) of the included articles mentioned primary and secondary outcome indicators, and 6 articles(11.3%) mentioned safety events, 13 articles(24.5%) mentioned economic assessment. The RCT quality of TCM intervention in septic renal injury was generally low, and the reference standards for sepsis, kidney injury, and TCM syndrome diagnosis were not uniform. There are some problems in outcome indicators, such as unclear distinction between primary and secondary indicators, neglect of endpoint indicators, lack of application of TCM characteristic indicators, and insufficient attention to safety events and economic assessment. It is suggested that the quality of clinical research methodology should be improved in the future, and the COS should be constructed to provide high-level evidence-based evidence for TCM intervention in septic kidney injury.

Clinical efficacy and safety of the self-developed Zangsiwei Qingfei Mixture combined with conventional treatment in patients with acute exacerbation of chronic obstructive pulmonary disease. / è‡ªä¸»ç ”å‘çš„è—å››å‘³æ¸ è‚ºåˆå‰‚è”åˆå¸¸è§„æ²»ç–—å¯¹æ ¢æ€§é˜»å¡žæ€§è‚ºç–¾ç— æ€¥æ€§åŠ é‡æœŸæ‚£è€ çš„ä¸´åºŠç–—æ•ˆå’Œå®‰å ¨æ€§.

OBJECTIVES: Chronic obstructive pulmonary disease (COPD) is a significant global public health issue. Modern medical treatments have both benefits and limitations, prompting increasing attention from scholars worldwide on traditional ethnic medicine, and the Zangsiwei Qingfei Mixture is a newly developed formula derived from the effective components of classical Tibetan medicine to treat chronic respiratory diseases. This study aims to investigate the clinical efficacy and safety of the Zangsiwei Qingfei Mixture combined with conventional treatment in patients with acute exacerbation of chronic obstructive pulmonary disease (AECOPD). METHODS: Sixty AECOPD patients admitted to the Second Xiangya Hospital of Central South University from May 2021 to May 2023 were enrolled and randomly divided into 2 groups, with 30 patients in each group. The control group received conventional treatment, including bronchodilators, anti-infection agents, expectorants, and oxygen therapy. The experimental group received the Zangsiwei Qingfei Mixture in addition to conventional treatment. The treatment duration was 7 d for both groups. Baseline data such as gender, age, body mass index (BMI), smoking status, Global Initiative for Chronic Obstructive Lung Disease (GOLD) classification, COPD course, and the number of COPD exacerbations in the past year were collected. The primary efficacy indicators were assessed using the modified Medical Research Council (mMRC) dyspnea scale and the modified Borg scale. Secondary indicators included arterial lactic acid (LAC) and serum tumor necrosis factor alpha (TNF-α) levels. Safety indicators included liver and kidney function [alanine transaminase (ALT), aspartate transaminase (AST), serum creatinine (SCr), serum uric acid (SUA)], coagulation function [activated partial thromboplastin time (APTT), prothrombin time (PT), fibrinogen (FIB), and D-dimer]. The generalized linear mixed model (GLMM) was used to evaluate the clinical efficacy and safety of the Zangsiwei Qingfei Mixture. RESULTS: Before treatment, there were no statistically significant differences in general baseline data, grading of mMRC dyspnea scale, score of modified Borg scale, arterial LAC, ALT, AST, SCr, SUA, APTT, FIB, and D-dimer between the 2 groups (all P>0.05). However, serum TNF-α and PT levels in the experimental group were significantly lower than those in the control group (both P<0.05). GLMM analysis showed that after adjusting for pre- and post-treatment, gender, age, BMI, smoking status, GOLD classification, COPD course, and the number of COPD exacerbations in the past year, the experimental group demonstrated significantly lower grading of mMRC dyspnea scale (coefficient=-0.329, P=0.036), score of modified Borg scale (coefficient=-1.077, P=0.001), serum TNF-α level (coefficient=-14.378, P<0.001), and arterial LAC level (coefficient=-0.409, P=0.012) compared to the control group. The Zangsiwei Qingfei Mixture had no significant effect on liver, kidney, or coagulation function indicators (all P>0.05). CONCLUSIONS: The Zangsiwei Qingfei Mixture combined with conventional treatment can improve clinical symptoms and promote homeostasis in AECOPD patients, demonstrating safety and reliability. Combining modern medicine with traditional ethnic medicine offers a feasible approach to treating chronic respiratory diseases in the future.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Operationally defining physical literacy in Chinese culture: Results of a meta-narrative synthesis and the Panel's recommendations.

Purpose: The definition of physical literacy (PL) needs to be explored by researchers from educational, public health, and sports organisations in Chinese culture; an adequate definition and theoretical framework of PL can then be embraced within different contexts and according to cultural influences. Methods: This meta-narrative synthesis of literature in this area included a series of planning, search, mapping, appraisal, synthesis, and recommendation phases. The literature was translated into English and circulated among international experts to seek suggestions. A total of 74 articles were included in the PL definition synthesis and 28 were included for philosophical synthesis in this study. Results: Based on three rounds of discussions, the final agreement was reached among panel members regarding the defining statements and practical and theoretical models of PL in Chinese culture. According to consensus, PL is the integration of physical, perceptual, cognitive, psychological, and behavioural capabilities, echoing with the need for an active, healthy, and fulfilling lifestyle, which involves continuous positive interactions with the environment and embodied engagement in physical activities for life. The framework addressed five domains (physical, sensory-perceptual, cognitive, psychological, and behavioural) and one important overlapping factor (dynamic environment). A further explanation was provided in the defining statement to assist in understanding the concept. Conclusion: It is suggested that the cultural interpretation and historical background of PL in Chinese discourse should be addressed and respected. The development of a specific cultural definition statement of PL in one country could provide implications for PL researchers worldwide.

LncRNA PAXIP1-AS1 fosters the pathogenesis of pulmonary arterial hypertension via ETS1/WIPF1/RhoA axis.

Pulmonary arterial hypertension (PAH) is a life-threatening disease featured with elevated pulmonary vascular resistance and progressive pulmonary vascular remodelling. It has been demonstrated that lncRNA PAXIP1-AS1 could influence the transcriptome in PAH. However, the exact molecular mechanism of PAXIP1-AS1 in PAH pathogenesis remains largely unknown. In this study, in vivo rat PAH model was established by monocrotaline (MCT) induction and hypoxia was used to induce in vitro PAH model using human pulmonary artery smooth muscle cells (hPASMCs). Histological examinations including H&E, Masson's trichrome staining and immunohistochemistry were subjected to evaluate the pathological changes of lung tissues. Expression patterns of PAXIP1-AS1 and RhoA were assessed using qRT-PCR and Western blotting, respectively. CCK-8, BrdU assay and immunofluorescence of Ki67 were performed to measure the cell proliferation. Wound healing and transwell assays were employed to evaluate the capacity of cell migration. Dual-luciferase reporter assay, co-immunoprecipitation, RIP and CHIP assays were employed to verify the PAXIP1-AS1/ETS1/WIPF1/RhoA regulatory network. It was found that the expression of PAXIP1-AS1 and RhoA was remarkably higher in both lung tissues and serum of MCT-induced PAH rats, as well as in hypoxia-induced hPASMCs. PAXIP1-AS1 knockdown remarkably suppressed hypoxia-induced cell viability and migration of hPASMCs. PAXIP1-AS1 positively regulated WIPF1 via recruiting transcriptional factor ETS1, of which knockdown reversed PAXIP1-AS1-mediated biological functions. Co-immunoprecipitation validated the WIPF1/RhoA interaction. In vivo experiments further revealed the role of PAXIP1-AS1 in PAH pathogenesis. In summary, lncRNA PAXIP1-AS1 promoted cell viability and migration of hPASMCs via ETS1/WIPF1/RhoA, which might provide a potential therapeutic target for PAH treatment.

[Content determination of five flavonoids in Tibetan medicine Rhododendron anthopogonoides by quantitative analysis of multi-components by single marker (QAMS)].

To establish a quantitative analysis of multi-components by single marker(QAMS) method for five flavonoids in Rhododendron anthopogonoides and verify its feasibility and applicability in the medicinal materials of R. anthopogonoides. With hyperoside as the internal reference, relative correction factors(RCF) of rutin, quercetin, quercitrin and kaempferol were established by high-performance liquid chromatography(HPLC) analysis. RCFs were used to calculate the content of each component, system durability and relative retention time. Simultaneously, QAMS and external standard method(ESM) were used to determine the content of five flavonoids in 12 batches of R. anthopogonoides from different origins. The results were statistically analyzed to verify the accuracy and feasibility. The fingerprints and cluster analysis data of R. anthopogonoides analyzed and discussed differences among the batches. According to the results, the RCFs of rutin, quercetin, quercetin and kaempferol in R. anthopogonoides were 1.242 6, 0.990 5, 0.535 0, and 0.781 3, respectively. The RCFs represented a good reproducibility under different experimental conditions. Besides, there was no significant difference between QAMS and ESM. Besides, the fingerprint and cluster analysis data showed the consistency between the classification and with the origin distribution of the herbs. In conclusion, the QAMS method shows a good stability and accuracy in the quality control of R. anthopogonoides.

Pathogenic New World Relapsing Fever Borrelia in a Myotis Bat, Eastern China, 2015.

We identified Candidatus Borrelia fainii, a human pathogenic bacterium causing New World relapsing fever in a Myotis bat in eastern China. This finding expands knowledge about the geographic distribution of Borrelia spp. and the potential for infection with New World relapsing fever in China.

LncRNA-SMILR modulates RhoA/ROCK signaling by targeting miR-141 to regulate vascular remodeling in pulmonary arterial hypertension.

Pulmonary arterial hypertension (PAH) is a fatal progressive disease characterized by an increased blood pressure in the pulmonary arteries. RhoA/Rho-kinase (RhoA/ROCK) signaling activation is often associated with PAH. The purpose of this study is to investigate the role and mechanisms of long noncoding RNA (lncRNA) smooth muscle-induced lncRNA (SMILR) to activate the RhoA/ROCK pathway in PAH. SMILR, microRNA-141 (miR-141), and RhoA were identified by qRT-PCR in PAH patients' serum. 3-(4,5-Dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT), wound-healing assay, cell counting kit-8 (CCK-8) assay, and flow cytometry were performed to determine cell viability, migration, proliferation, and cell cycle in human pulmonary arterial smooth muscle cells (hPASMCs) and primary PASMCs from PAH patients. We also performed bioinformatical prediction, luciferase reporter assay, and RNA-binding protein immunoprecipitation (RIP) to assess the interaction among SMILR, miR-141, and RhoA. The RhoA/ROCK pathway and proliferation-related proteins were measured by Western blotting. Finally, we introduced the small hairpin (sh)SMILR to monocrotaline-induced PAH rat model and used the hemodynamic measurement, qRT-PCR, and immunohistochemistry to examine the therapeutic effects of shSMILR. SMILR and RhoA expression were upregulated, while miR-141 expression was downregulated in PAH patients. SMILR directly interacted with miR-141 and negatively regulated its expression. Knockdown of SMILR suppressed PASMC proliferation and migration induced by hypoxia. Furthermore, overexpression of miR-141 could inhibit the RhoA/ROCK pathway by binding to RhoA, thereby repressing cell proliferation-related signals. Knockdown of SMILR significantly inhibited the Rho/ROCK activation and vascular remodeling in monocrotaline-induced rats. Knockdown of SMILR effectively elevated miR-141 expression and in turn inhibited the RhoA/ROCK pathway to regulate vascular remodeling and reduce blood pressure in PAH.NEW & NOTEWORTHY Smooth muscle enriched long noncoding RNA (SMILR), as a long noncoding RNA (lncRNA), was increased in pulmonary arterial hypertension (PAH) patients and in vitro and in vivo models. SMILR activated RhoA/ROCK signaling by targeting miR-141 to disinhibit its downstream target RhoA. SMILR knockdown or miR-141 overexpression inhibited hypoxia-induced cell proliferation and migration via repressing RhoA/ROCK signaling in pulmonary arterial smooth muscle cells (PASMCs), which was confirmed in vivo experiments that knockdown of SMILR inhibited vascular remodeling and alleviated PAH in rats. SMILR may be a promising and novel therapeutic target for the treatment and drug development of PAH.

Effect of beam mode of partially Gaussian Schell-model beam on a heterodyne detection system in turbulence.

A mathematical model considering the transmission of a partially coherent Gaussian Schell-model (GSM) beam in slant turbulence atmosphere of heterodyne detection was established. A closed-form expression of the weighting factor for the partially GSM beam at the receiving end was derived. The effect of the beam mode on the performance of the proposed detection system was theoretically investigated. The results show that the proportion of the fundamental mode and heterodyne efficiency can be optimized by controlling the waist radius of the signal and local oscillator beams. The inner scale of turbulence significantly affects the heterodyne efficiency and normalized M2. With a larger mode order, the proportion of the fundamental mode and heterodyne efficiency are lowered.

Targeting the RhoA-ROCK pathway to regulate T-cell homeostasis in hypoxia-induced pulmonary arterial hypertension.

BACKGROUND: Hypoxic pulmonary arterial hypertension (PAH) is a crippling disease with limited therapeutic methods. The imbalance of T helper 17 cell (Th17)/regulatory T cell (Treg) plays an important role in the development of Hypoxic PAH. However, whether targeting the ras homolog family member A-Rho kinase (RhoA-ROCK) pathway (activation and inhibition) by lysophosphatidic acid (LPA) and fasudil (FSD) regulate T-cell homeostasis in Hypoxic PAH remain unknown. OBJECTIVE: To examine the effects of LPA and FSD on hypoxic pulmonary vascular remodeling and homeostasis of Th17/Treg cells in Hypoxic PAH. METHODS: Rats were exposed to hypoxia (10 ±â€¯0.5% O2) to induce Hypoxic PAH. The experiments consists of two parts. Forty rats were randomly divided into four groups (n = 10): normoxia group, normoxia + LPA group, hypoxia group and hypoxia + LPA group. Thirty rats were randomly divided into another three groups (n = 10): normoxia group, hypoxia group, and hypoxia + FSD group. Rats in normoxia + LPA group and hypoxia + LPA group were intraperitoneally injected 40 µg/kg LPA daily. Rats in hypoxia + FSD group were intraperitoneally injected 30 mg/kg fasudil daily. The effects of LPA and FSD on the development of hypoxic PAH and right ventricle (RV) hypertrophy, on pulmonary vascular remodeling, and on changes of Th17/Treg cells and levels of interleukin-17 (IL-17) and IL-10 were examined. RESULTS: PAH and RV hypertrophy occurred in rats exposed to hypoxia. LPA exacerbated hypoxic pulmonary vascular remodeling and FSD inhibited it. LPA increased Th17/Treg imbalance in peripheral blood and spleen. However, after treatment with FSD, hypoxic PAH rats showed an obvious reduction of Th17 cells as well as an increase of Treg cells. LPA increased the expression of phosphorylated-signal transducer and activator of transcription 3 (p-STAT3) and reduced the p-STAT5 in peripheral blood and spleen in hypoxic PAH rats. The expression of p-STAT3 and p-STAT5 in hypoxic PAH rats treated with FSD showed opposite changes. LPA increased the expression of IL-17 and reduced the IL-10 in small intrapulmonary arteries and serum in hypoxic PAH. However, the expression of IL-17 and IL-10 in hypoxic PAH rats treated with FSD showed opposite changes. CONCLUSIONS: Activation and inhibition of RhoA-ROCK pathway by LPA and FSD modulated the homeostasis of Th17/Treg cells via regulating STAT3/STAT5 phosphorylation in hypoxic PAH. Thus, Apart from influence of pulmonary vascular remodeling, regulation of Th17/Treg homeostasis by RhoA-ROCK pathway play a key role in hypoxic PAH.

Immune cells and autoantibodies in pulmonary arterial hypertension.

Analyses of immunity in pulmonary arterial hypertension (PAH) support the notion that maladaptation of the immune response exists. Altered immunity is an increasingly recognized feature of PAH. Indeed, a delicate balance between immunity and tolerance exists and any disturbance may result in chronic inflammation or autoimmunity. This is suggested by infiltration of various immune cells (e.g. macrophages, T and B lymphocytes) in remodeled pulmonary vessels. In addition, several types of autoantibodies directed against antinuclear antigens, endothelial cells (ECs) and fibroblasts have been found in idiopathic and systemic sclerosis-associated PAH. These autoantibodies may play an important role in EC apoptosis and in the expression of cell adhesion molecules. This review article provides an overview of immunity pathways highlighting their potential roles in pulmonary vascular remodeling in PAH and the possibility of future targeted therapy.

[Analyzing crude/processed root of Polygonum multiflorum from different habitats by UPLC fingerprint and mode identification methods].

To establish a content determination method for 2,3,5,4'-tetrahydroxy stilbene-2-O-ß-D-glucoside (TSG) of the crude/processed root of Polygonum multiflorum from different habitats in China and set up the fingerprint by using UPLC. Various samples were pretreated by macro-porous resin. Then UPLC analysis was performed on Waters ACQUITY UPLC@BEH C18 chromatographic column (2.1 mm×50 mm, 1.7 µm) at (25±5) ℃. A binary gradient elution system was composed of acetonitrile (phase A) and 0.5% acetic acid solution (phase B). Detection was performed at the wavelength of 254 nm, and the mobile flow rate was set at 0.3 mL•min⁻¹. Results showed that the yield of extraction of the 2,3,5,4'-tetrahydroxy stilbene-2-O-ß-D-glucoside from root of P. multiflorum was all over 25.0% after macro-porous resin separation; an exclusive UPLC fingerprint method of the crude/processed root of P. multiflorum from different habitats was successfully set up and 17 chromatographic peaks were calibrated. Cluster analysis can not entirely distinguish the crude one from the processed one, while principal component analysis absolutely can. 2,3,5,4'-tetrahydroxy stilbene-2-O-ß-D-glucoside is the composition that has largest differences in variable importance in projection (VIP) between crude and processed root of P. multiflorum. The separating method can gain high-purity 2,3,5,4'-tetrahydroxy stilbene-2-O-ß-D-glucoside, and the determination method is simple, sensitive, reliable and can be used in fast identifying the crude/processed root of P. multiflorum or as a method for overall quality control of root of P. multiflorum.

[Investigation and analysis for current situation and pathogenesis relevant to pulmonary hypertension].

OBJECTIVE: To investigate the demographic characteristics and the causes for pulmonary hypertension (PH) in adult patients.
 Methods: A total of 2 508 adult patients diagnosed as PH, who came from the Second Xiangya Hospital of Central South University from January 2010 to December 2014, were retrospectively investigated. All subjects underwent the clinical diagnosis, or the echocardiographic diagnosis, or thetraditional hemodynamic criteria by right heart catheterization (RHC). The patient's data including hospital numbers, gender, ages, primary diseases, etc, are collected and analyzed.
 Results: In this study, the number of patients diagnosed as PH was increased year by year. The median age of 2 508 patients was 47 (18-93) years old, and there were 933 males (37.2%), the ratio of male to female was 1:1.69 (P<0.05). Female was more common in Class I PH (pulmonary arterial hypertension) and Class II PH (pulmonary hypertension due to left heart disease)(>70%), but there were more male patients (74.5%) in Class III PH (pulmonary hypertension due to lung diseases and/or hypoxia). In our study, 896 cases (35.73%) were the Class I PH, 1 163 cases was the Class II PH (46.37%), 411 cases was the Class III PH (16.39%), and the Class IV PH (chronic thromboembolic pulmonary hypertension) and the Class V PH (PH with unclear and/or multifactorial mechanisms) were diagnosed in 32(1.27%) and 6 patients (0.24%), respectively.The diseases with largest number of patients for the top 7 primary PH were rheumatic heart disease (1 090, 43.48%), congenital heart disease (692, 27.60%), chronic obstructive pulmonary disease (358, 14.28%), connective tissue related disease(156, 6.22%), valvular heart disease (66, 2.63%), idiopathic PH (46, 1.83%) and pulmonary embolism (27, 1.08%).
 Conclusion: Adult PH patients' peak incidence age is 41-50 years old. This disease is more common among women, and the Class I/II PH are common in women while the Class III is more common in men. Rheumatic heart disease and congenital heart disease may be the most common cause for pulmonary hypertension in China, and chronic obstructive pulmonary disease is the most common cause for the Class III PH, in which the patients are old.

[Familial male-limited precocious puberty due to Asp578His mutations in the LHCGR gene: clinical characteristics and gene analysis in an infant].

The aim of the study was to provide a descriptive analysis of familial male-limited precocious puberty (FMPP), which is a rare inherited disease caused by heterozygous constitutively activating mutations of the luteinizing hormone/choriogonadotropin receptor gene (LHCGR). The patient was a ten-month-old boy, presenting with penile enlargement, pubic hair formation, and spontaneous erections. Based on the clinical manifestations and laboratory data, including sexual characteristics, serum testosterone levels, GnRH stimulation test, and bone age, this boy was diagnosed with peripheral precocious puberty. Subsequently the precocious puberty-related genes were analyzed by direct DNA sequencing of amplified PCR products from the patient and his parents. Genetic analysis revealed a novel heterozygous missense mutation c.1732G>C (Asp578His) of the LHCGR gene exon11 in the patient, which had never been reported. His parents had no mutations. After combined treatment with aromatase inhibitor letrozole and anti-androgen spironolactone for six months, the patient's symptoms were controlled. The findings in this study expand the mutation spectrum of the LHCGR gene, and provide molecular evidence for the etiologic diagnosis as well as for the genetic counseling and prenatal diagnosis in the family.

Cytoprotection of baicalein against oxidative stress-induced cardiomyocytes injury through the Nrf2/Keap1 pathway.

Baicalein is one of the major flavonoids found in the root of Scutellaria baicalensis Georgi. Previous studies suggest that baicalein displays protective effect on experimental cardiac models in vitro and in vivo. However, the mode of action remains unclear. Here, we showed that baicalein conferred cardioprotective effect against oxidative stress-induced cell injury in H9c2 cells and human embryonic stem cells-derived cardiomyocytes. Immunoprecipitation with anti-NF-E2-related factor 2 (Nrf2) antibody in baicalein-treated cells demonstrated that baicalein effectively disrupted the association between Nrf2 and Kelch-like epichlorohydrin-associated protein 1 (Keap1). In addition, the unbounded Nrf2 translocated from cytoplasm to nucleus and increased Nrf2/heme oxygenase-1 (HO-1) content in a time-dependent manner. Moreover, antioxidant response element transcriptional activity was enhanced by baicalein treatment, and the Nrf2 siRNA transfection could block the cytoprotective effect of baicalein. Taken together, these results demonstrate that baicalein protected cardiomyocytes against oxidative stress-induced cell injury through the Nrf2/Keap1 pathway.

Running improves muscle mass by activating autophagic flux and inhibiting ubiquitination degradation in mdx mice.

BACKGROUND: Exercise therapy can improve muscle mass, strengthen muscle and cardiorespiratory function, and may be an excellent adjunctive treatment option for Duchenne muscular dystrophy. METHODS: This article investigates the effects of 10 weeks of treadmill training on skeletal muscle in control and mdx mice. Hematoxylin and eosin (H&E) staining was used to detect the morphometry of skeletal muscle; the grip strength test, suspension test, and rotarod test were used to detect limb muscle strength of mice, and Aurora Scientific Instruments were used to detect in vivo Muscle Stimulation Measuring Maximum Force of pre-fatigue and post-fatigue. The expression levels of myogenic proteins, ubiquitination markers, autophagy pathway proteins, and the proportion of different muscle fiber types were detected. RESULTS: The experimental results show that running exercise can significantly improve the muscle mass of mdx mice, promote muscle strength, endurance, and anti-fatigue ability, reverse the pathological state of skeletal muscle destruction in mdx mice, and promote muscle regeneration. WB experiments showed that running inhibited the ubiquitination and degradation of muscle protein in mdx mice, inhibited AKT activation, decreased phosphorylated FoxO1 and FoxO3a, and restored the suppressed autophagic flux. Running enhances muscle strength and endurance by comprehensively promoting the expression of Myh1/2/4/7 fast and slow muscle fibers in mdx mice. CONCLUSIONS: Running can inhibit the degradation of muscle protein in mdx mice, and promote the reuse and accumulation of proteins, thereby slowing down muscle loss. Running improves skeletal muscle mass by activating autophagic flux and inhibiting ubiquitination degradation in mdx mice.

Effect of Individualized Ocular Refraction Customization Spectacle Lens Wear on Visual Performance in Myopic Chinese Children.

Purpose: Individualized ocular refraction customization (IORC) lenses can be individually adjusted depending on the initial relative peripheral refraction to determine the myopic defocus (MD). We aimed to compare visual performance of children wearing IORC lenses with different amounts of MD to determine whether higher MD resulted in greater visual compromise. Methods: This study included 184 myopic children aged eight to 12 years, and 172 completed the trial. The participants were randomly assigned to wear IORC lenses with low (IORC-L, 2.50 D), medium (IORC-M, 3.50 D), or high (IORC-H, 4.50 D) MD or single-vision spectacle lenses (SVL). Distance and near best-corrected visual acuity (BCVA), contrast sensitivity function (CSF) and questionnaires were evaluated at baseline and after six and 12 months. Results: CSF over all frequencies and distance and near BCVA were not affected by lens design (all P > 0.05). The SVL group outperformed the three IORC lens groups in terms of ghosting images at baseline, and IORC-H and IORC-M groups outperformed IORC-L group (all P < 0.001); however, no differences were observed at the six- or 12-month visit. There were no significant differences among the four groups for any other subjective variables at any of the follow-up visits regarding vision clarity, vision stability, eyestrain, dizziness, headache, or overall vision satisfaction (all P > 0.05). Conclusions: The IORC lenses with an actual MD of 4.50 D provided acceptable objective and subjective visual performance and were well tolerated by children. Translational Relevance: IORC lenses with an actual MD of 4.50 D provided acceptable visual performance.