An extensive survey of phytoviral RNA 3' uridylation identifies extreme variations and virus-specific patterns.

Viral RNAs can be uridylated in eukaryotic hosts. However, our knowledge of uridylation patterns and roles remains rudimentary for phytoviruses. Here, we report global 3' terminal RNA uridylation profiles for representatives of the main families of positive single-stranded RNA phytoviruses. We detected uridylation in all 47 viral RNAs investigated here, revealing its prevalence. Yet, uridylation levels of viral RNAs varied from 0.2% to 90%. Unexpectedly, most poly(A) tails of grapevine fanleaf virus (GFLV) RNAs, including encapsidated tails, were strictly monouridylated, which corresponds to an unidentified type of viral genomic RNA extremity. This monouridylation appears beneficial for GFLV because it became dominant when plants were infected with nonuridylated GFLV transcripts. We found that GFLV RNA monouridylation is independent of the known terminal uridylyltransferases (TUTases) HEN1 SUPPRESSOR 1 (HESO1) and UTP:RNA URIDYLYLTRANSFERASE 1 (URT1) in Arabidopsis (Arabidopsis thaliana). By contrast, both TUTases can uridylate other viral RNAs like turnip crinkle virus (TCV) and turnip mosaic virus (TuMV) RNAs. Interestingly, TCV and TuMV degradation intermediates were differentially uridylated by HESO1 and URT1. Although the lack of both TUTases did not prevent viral infection, we detected degradation intermediates of TCV RNA at higher levels in an Arabidopsis heso1 urt1 mutant, suggesting that uridylation participates in clearing viral RNA. Collectively, our work unveils an extreme diversity of uridylation patterns across phytoviruses and constitutes a valuable resource to further decipher pro- and antiviral roles of uridylation.

CRISPR/Cas9 editing of Downy mildew resistant 6 (DMR6-1) in grapevine leads to reduced susceptibility to Plasmopara viticola.

Downy mildew of grapevine (Vitis vinifera), caused by the oomycete Plasmopara viticola, is an important disease that is present in cultivation areas worldwide, and using resistant varieties provides an environmentally friendly alternative to fungicides. DOWNY MILDEW RESISTANT 6 (DMR6) from Arabidopsis is a negative regulator of plant immunity and its loss of function confers resistance to downy mildew. In grapevine, DMR6 is present in two copies, named VvDMR6-1 and VvDMR6-2. Here, we describe the editing of VvDMR6-1 in embryogenic calli using CRISPR/Cas9 and the regeneration of the edited plants. All edited plants were found to be biallelic and chimeric, and whilst they all showed reduced growth compared with non-transformed control plants, they also had reduced susceptibility to P. viticola. Comparison between mock-inoculated genotypes showed that all edited lines presented higher levels of salicylic acid than controls, and lines subjected to transformation presented higher levels of cis-resveratrol than controls. Our results identify VvDMR6-1 as a promising target for breeding grapevine cultivars with improved resistance to downy mildew.

Structural basis of nanobody recognition of grapevine fanleaf virus and of virus resistance loss.

Grapevine fanleaf virus (GFLV) is a picorna-like plant virus transmitted by nematodes that affects vineyards worldwide. Nanobody (Nb)-mediated resistance against GFLV has been created recently, and shown to be highly effective in plants, including grapevine, but the underlying mechanism is unknown. Here we present the high-resolution cryo electron microscopy structure of the GFLV-Nb23 complex, which provides the basis for molecular recognition by the Nb. The structure reveals a composite binding site bridging over three domains of one capsid protein (CP) monomer. The structure provides a precise mapping of the Nb23 epitope on the GFLV capsid in which the antigen loop is accommodated through an induced-fit mechanism. Moreover, we uncover and characterize several resistance-breaking GFLV isolates with amino acids mapping within this epitope, including C-terminal extensions of the CP, which would sterically interfere with Nb binding. Escape variants with such extended CP fail to be transmitted by nematodes linking Nb-mediated resistance to vector transmission. Together, these data provide insights into the molecular mechanism of Nb23-mediated recognition of GFLV and of virus resistance loss.

Bioelectrocatalytic CO2 Reduction by Mo-Dependent Formylmethanofuran Dehydrogenase.

Massive efforts are invested in developing innovative CO2 -sequestration strategies to counter climate change and transform CO2 into higher-value products. CO2 -capture by reduction is a chemical challenge, and attention is turned toward biological systems that selectively and efficiently catalyse this reaction under mild conditions and in aqueous solvents. While a few reports have evaluated the effectiveness of isolated bacterial formate dehydrogenases as catalysts for the reversible electrochemical reduction of CO2 , it is imperative to explore other enzymes among the natural reservoir of potential models that might exhibit higher turnover rates or preferential directionality for the reductive reaction. Here, we present electroenzymatic catalysis of formylmethanofuran dehydrogenase, a CO2 -reducing-and-fixing biomachinery isolated from a thermophilic methanogen, which was deposited on a graphite rod electrode to enable direct electron transfer for electroenzymatic CO2 reduction. The gas is reduced with a high Faradaic efficiency (109±1 %), where a low affinity for formate prevents its electrochemical reoxidation and favours formate accumulation. These properties make the enzyme an excellent tool for electroenzymatic CO2 -fixation and inspiration for protein engineering that would be beneficial for biotechnological purposes to convert the greenhouse gas into stable formate that can subsequently be safely stored, transported, and used for power generation without energy loss.

A Structural View of Alkyl-Coenzyme M Reductases, the First Step of Alkane Anaerobic Oxidation Catalyzed by Archaea.

Microbial anaerobic oxidation of alkanes intrigues the scientific community by way of its impact on the global carbon cycle, and its biotechnological applications. Archaea are proposed to degrade short- and long-chain alkanes to CO2 by reversing methanogenesis, a theoretically reversible process. The pathway would start with alkane activation, an endergonic step catalyzed by methyl-coenzyme M reductase (MCR) homologues that would generate alkyl-thiols carried by coenzyme M. While the methane-generating MCR found in methanogens has been well characterized, the enzymatic activity of the putative alkane-fixing counterparts has not been validated so far. Such an absence of biochemical investigations contrasts with the current explosion of metagenomics data, which draws new potential alkane-oxidizing pathways in various archaeal phyla. Therefore, validating the physiological function of these putative alkane-fixing machines and investigating how their structures, catalytic mechanisms, and cofactors vary depending on the targeted alkane have become urgent needs. The first structural insights into the methane- and ethane-capturing MCRs highlighted unsuspected differences and proposed some explanations for their substrate specificity. This Perspective reviews the current physiological, biochemical, and structural knowledge of alkyl-CoM reductases and offers fresh ideas about the expected mechanistic and chemical differences among members of this broad family. We conclude with the challenges of the investigation of these particular enzymes, which might one day generate biofuels for our modern society.

Comparative Metabolomic Analysis of Four Fabaceae and Relationship to In Vitro Nematicidal Activity against Xiphinema index.

The grapevine fanleaf virus (GFLV), responsible for fanleaf degeneration, is spread in vineyards by the soil nematode Xiphinema index. Nematicide molecules were used to limit the spread of the disease until they were banned due to negative environmental impacts. Therefore, there is a growing interest in alternative methods, including plant-derived products with antagonistic effects to X. index. In this work, we evaluated the nematicidal potential of the aerial parts and roots of four Fabaceae: sainfoin (Onobrychis viciifolia), birdsfoot trefoil (Lotus corniculatus), sweet clover (Melilotus albus), and red clover (Trifolium pratense), as well as that of sainfoin-based commercial pellets. For all tested plants, either aerial or root parts, or both of them, exhibited a nematicidal effect on X. index in vitro, pellets being as effective as freshly harvested plants. Comparative metabolomic analyses did not reveal molecules or molecule families specifically associated with antagonistic properties toward X. index, suggesting that the nematicidal effect is the result of a combination of different molecules rather than associated with a single compound. Finally, scanning electron microscope observations did not reveal the visible impact of O. viciifolia extract on X. index cuticle, suggesting that alteration of the cuticle may not be the primary cause of their nematicidal effect.

First report of Grapevine enamovirus 1 in Vitis vinifera cultivar 'Meunier' in France.

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera 'Meunier' leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5' untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3'-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected 'Meunier' grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the 'Meunier' grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5' untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3'-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected 'Meunier' grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the 'aphid transmission protein' producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was found positive for GEV-1 in gapevine in France.

Correction: Structural Insights into Viral Determinants of Nematode Mediated Grapevine fanleaf virus Transmission.

[This corrects the article DOI: 10.1371/journal.ppat.1002034.].

Shewanella decolorationis LDS1 Chromate Resistance.

The genus Shewanella is well known for its genetic diversity, its outstanding respiratory capacity, and its high potential for bioremediation. Here, a novel strain isolated from sediments of the Indian Ocean was characterized. A 16S rRNA analysis indicated that it belongs to the species Shewanella decolorationis It was named Shewanella decolorationis LDS1. This strain presented an unusual ability to grow efficiently at temperatures from 24°C to 40°C without apparent modifications of its metabolism, as shown by testing respiratory activities or carbon assimilation, and in a wide range of salt concentrations. Moreover, S. decolorationis LDS1 tolerates high chromate concentrations. Indeed, it was able to grow in the presence of 4 mM chromate at 28°C and 3 mM chromate at 40°C. Interestingly, whatever the temperature, when the culture reached the stationary phase, the strain reduced the chromate present in the growth medium. In addition, S. decolorationis LDS1 degrades different toxic dyes, including anthraquinone, triarylmethane, and azo dyes. Thus, compared to Shewanella oneidensis, this strain presented better capacity to cope with various abiotic stresses, particularly at high temperatures. The analysis of genome sequence preliminary data indicated that, in contrast to S. oneidensis and S. decolorationis S12, S. decolorationis LDS1 possesses the phosphorothioate modification machinery that has been described as participating in survival against various abiotic stresses by protecting DNA. We demonstrate that its heterologous production in S. oneidensis allows it to resist higher concentrations of chromate.IMPORTANCEShewanella species have long been described as interesting microorganisms in regard to their ability to reduce many organic and inorganic compounds, including metals. However, members of the Shewanella genus are often depicted as cold-water microorganisms, although their optimal growth temperature usually ranges from 25 to 28°C under laboratory growth conditions. Shewanella decolorationis LDS1 is highly attractive, since its metabolism allows it to develop efficiently at temperatures from 24 to 40°C, conserving its ability to respire alternative substrates and to reduce toxic compounds such as chromate or toxic dyes. Our results clearly indicate that this novel strain has the potential to be a powerful tool for bioremediation and unveil one of the mechanisms involved in its chromate resistance.

Trans-species synthetic gene design allows resistance pyramiding and broad-spectrum engineering of virus resistance in plants.

To infect plants, viruses rely heavily on their host's machinery. Plant genetic resistances based on host factor modifications can be found among existing natural variability and are widely used for some but not all crops. While biotechnology can supply for the lack of natural resistance alleles, new strategies need to be developed to increase resistance spectra and durability without impairing plant development. Here, we assess how the targeted allele modification of the Arabidopsis thaliana translation initiation factor eIF4E1 can lead to broad and efficient resistance to the major group of potyviruses. A synthetic Arabidopsis thaliana eIF4E1 allele was designed by introducing multiple amino acid changes associated with resistance to potyvirus in naturally occurring Pisum sativum alleles. This new allele encodes a functional protein while maintaining plant resistance to a potyvirus isolate that usually hijacks eIF4E1. Due to its biological functionality, this synthetic allele allows, at no developmental cost, the pyramiding of resistances to potyviruses that selectively use the two major translation initiation factors, eIF4E1 or its isoform eIFiso4E. Moreover, this combination extends the resistance spectrum to potyvirus isolates for which no efficient resistance has so far been found, including resistance-breaking isolates and an unrelated virus belonging to the Luteoviridae family. This study is a proof-of-concept for the efficiency of gene engineering combined with knowledge of natural variation to generate trans-species virus resistance at no developmental cost to the plant. This has implications for breeding of crops with broad-spectrum and high durability resistance using recent genome editing techniques.

Metagenomic-based impact study of transgenic grapevine rootstock on its associated virome and soil bacteriome.

For some crops, the only possible approach to gain a specific trait requires genome modification. The development of virus-resistant transgenic plants based on the pathogen-derived resistance strategy has been a success story for over three decades. However, potential risks associated with the technology, such as horizontal gene transfer (HGT) of any part of the transgene to an existing gene pool, have been raised. Here, we report no evidence of any undesirable impacts of genetically modified (GM) grapevine rootstock on its biotic environment. Using state of the art metagenomics, we analysed two compartments in depth, the targeted Grapevine fanleaf virus (GFLV) populations and nontargeted root-associated microbiota. Our results reveal no statistically significant differences in the genetic diversity of bacteria that can be linked to the GM trait. In addition, no novel virus or bacteria recombinants of biosafety concern can be associated with transgenic grapevine rootstocks cultivated in commercial vineyard soil under greenhouse conditions for over 6 years.

Nanobody-mediated resistance to Grapevine fanleaf virus in plants.

Since their discovery, single-domain antigen-binding fragments of camelid-derived heavy-chain-only antibodies, also known as nanobodies (Nbs), have proven to be of outstanding interest as therapeutics against human diseases and pathogens including viruses, but their use against phytopathogens remains limited. Many plant viruses including Grapevine fanleaf virus (GFLV), a nematode-transmitted icosahedral virus and causal agent of fanleaf degenerative disease, have worldwide distribution and huge burden on crop yields representing billions of US dollars of losses annually, yet solutions to combat these viruses are often limited or inefficient. Here, we identified a Nb specific to GFLV that confers strong resistance to GFLV upon stable expression in the model plant Nicotiana benthamiana and also in grapevine rootstock, the natural host of the virus. We showed that resistance was effective against a broad range of GFLV isolates independently of the inoculation method including upon nematode transmission but not against its close relative, Arabis mosaic virus. We also demonstrated that virus neutralization occurs at an early step of the virus life cycle, prior to cell-to-cell movement. Our findings will not only be instrumental to confer resistance to GFLV in grapevine, but more generally they pave the way for the generation of novel antiviral strategies in plants based on Nbs.

A genome-wide diversity study of grapevine rupestris stem pitting-associated virus.

Over the last decade, many scientific disciplines have been impacted by the dawn of new sequencing techniques (HTS: high throughput sequencing). Plant pathology and more specifically virology have been greatly transformed by this 'metagenomics' paradigm shift. Such tools significantly facilitate disease diagnostics with tremendous sensitivity, providing invaluable information such as an exhaustive list of viruses being present in a sample as well as their relative concentration. In addition, many new plant viruses have been discovered. Using RNAseq technology, in silico reconstruction of complete viral genome sequences is easily attainable. This step is of importance for taxonomy, population structure analyses, phylogeography and viral evolution studies. Here, after assembling 81 new near-complete genome sequences of grapevine rupestris stem pitting-associated virus (GRSPaV), we performed a genome-wide diversity study of this ubiquitous virus of grapevine worldwide.

Virus preparations from the mixed-infected P70 Pinot Noir accession exhibit GLRaV-1/GVA 'end-to-end' particles.

P70 is a Pinot Noir grapevine accession that displays strong leafroll disease symptoms. A high-throughput sequencing (HTS)-based analysis established that P70 was mixed-infected by two variants of grapevine leafroll-associated virus 1 (GLRaV-1, genus Ampelovirus) and one of grapevine virus A (GVA, genus Vitivirus) as well as by two viroids (hop stunt viroid [HSVd] and grapevine yellow speckle viroid 1 [GYSVd1]) and four variants of grapevine rupestris stem pitting-associated virus (GRSPaV). Immunogold labelling using gold particles of two different diameters revealed the existence of 'hybrid' particles labelled at one end as GLRaV-1, with the rest labelled as GVA. In this work, we suggest that immunogold labelling can provide information about the biology of the viruses, going deeper than just genomic information provided by HTS, from which no recombinant or 'chimeric' GLRaV-1/GVA sequences had been identified in the dataset. Our observations suggest an unknown interaction between members of two different viral species that are often encountered together in a single grapevine, highlighting potential consequences in the vector biology and epidemiology of leafroll and rugose-wood diseases.

A complex virome unveiled by deep sequencing analysis of RNAs from a French Pinot Noir grapevine exhibiting strong leafroll symptoms.

We have characterized the virome of a grapevine Pinot Noir accession (P70) that displayed, over the year, very stable and strong leafroll symptoms. For this, we have used two extraction methods (dsRNA and total RNA) coupled with the high throughput sequencing (HTS) Illumina technique. While a great disparity in viral sequences were observed, both approaches gave similar results, revealing a very complex infection status. Five virus and viroid isolates [Grapevine leafroll-associated viruse-1 (GLRaV-1), Grapevine virus A (GVA), Grapevine rupestris stem pitting-associated virus (GRSPaV), Hop stunt viroid (HSVd) and Grapevine yellow speckle viroid 1 (GYSVd1)] were detected in P70 with a grand total of eleven variants being identified and de novo assembled. A comparison between both extraction methods regarding their power to detect viruses and the ease of genome assembly is also provided.

Display of whole proteins on inner and outer surfaces of grapevine fanleaf virus-like particles.

Virus-like particles (VLPs) derived from nonenveloped viruses result from the self-assembly of capsid proteins (CPs). They generally show similar structural features to viral particles but are noninfectious and their inner cavity and outer surface can potentially be adapted to serve as nanocarriers of great biotechnological interest. While a VLP outer surface is generally amenable to chemical or genetic modifications, encaging a cargo within particles can be more complex and is often limited to small molecules or peptides. Examples where both inner cavity and outer surface have been used to simultaneously encapsulate and expose entire proteins remain scarce. Here, we describe the production of spherical VLPs exposing fluorescent proteins at either their outer surface or inner cavity as a result of the self-assembly of a single genetically modified viral structural protein, the CP of grapevine fanleaf virus (GFLV). We found that the N- and C-terminal ends of the GFLV CP allow the genetic fusion of proteins as large as 27 kDa and the plant-based production of nucleic acid-free VLPs. Remarkably, expression of N- or C-terminal CP fusions resulted in the production of VLPs with recombinant proteins exposed to either the inner cavity or the outer surface, respectively, while coexpression of both fusion proteins led to the formation hybrid VLP, although rather inefficiently. Such properties are rather unique for a single viral structural protein and open new potential avenues for the design of safe and versatile nanocarriers, particularly for the targeted delivery of bioactive molecules.

Structural and surface coverage effects on CO oxidation reaction over carbon-supported Pt nanoparticles studied by quadrupole mass spectrometry and diffuse reflectance FTIR spectroscopy.

The CO oxidation reaction on carbon-supported Pt nanoparticles (average size of 2.8 to 7.7 nm) was studied under flowing conditions at atmospheric pressure and temperatures between 300 and 353 K by coupling quadrupole mass spectrometry (QMS) and diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS). The Pt loading was varied between 20 and 60 wt%. Gases diluted in He (0.5 mol%) were used together with Ar as a tracer. Reactions with CO and O2 introduced separately onto the samples were studied by QMS, applying successive step changes of the reaction mixtures. Variations in the rate of the reactions were observed and correlated with changes of the calculated coverage of the Pt surface by CO and/or O adspecies at varying steps of the experiment. The transient reaction of CO(g) with adsorbed O (Oad) was fast and mass transport-limited while that of O2(g) with adsorbed CO (COad) was sluggish. Following the same experimental procedures, FTIR spectra of adsorbed CO after varying steps were recorded, confirming the variations of COad and Oad as determined by QMS and indicating changes in the CO distribution over varying types of Pt surface sites. The influence of the adlayer composition (co-adsorption of COad and Oad), the particle size/structure and some possible surface reconstruction effects on the CO oxidation rate were evidenced and discussed. The structure of the Pt nanoparticles supported on carbon appears as an important factor for the efficiency of the so-called O2 bleeding as a CO mitigation strategy in polymer electrolyte membrane fuel cells.

Phylogenetic relationships and the occurrence of interspecific recombination between beet chlorosis virus (BChV) and Beet mild yellowing virus (BMYV).

Samples containing two viruses belonging to the genus Polerovirus, beet chlorosis virus (BChV) and beet mild yellowing virus (BMYV), were collected from French and Polish sugar beet fields. The molecular properties of 24 isolates of BChV and BMYV were investigated, and their genetic diversity was examined in the coat protein (CP)- and P0-encoding genes. For the first time, we have demonstrated that beet polerovirus populations include recombinants between BChV and BMYV containing breakpoints within the CP gene. Moreover, a partial correlation between geographic origin and phylogenetic clustering was observed for BMYV isolates.

Ethane-oxidising archaea couple CO2 generation to F420 reduction.

The anaerobic oxidation of alkanes is a microbial process that mitigates the flux of hydrocarbon seeps into the oceans. In marine archaea, the process depends on sulphate-reducing bacterial partners to exhaust electrons, and it is generally assumed that the archaeal CO2-forming enzymes (CO dehydrogenase and formylmethanofuran dehydrogenase) are coupled to ferredoxin reduction. Here, we study the molecular basis of the CO2-generating steps of anaerobic ethane oxidation by characterising native enzymes of the thermophile Candidatus Ethanoperedens thermophilum obtained from microbial enrichment. We perform biochemical assays and solve crystal structures of the CO dehydrogenase and formylmethanofuran dehydrogenase complexes, showing that both enzymes deliver electrons to the F420 cofactor. Both multi-metalloenzyme harbour electronic bridges connecting CO and formylmethanofuran oxidation centres to a bound flavin-dependent F420 reductase. Accordingly, both systems exhibit robust coupled F420-reductase activities, which are not detected in the cell extract of related methanogens and anaerobic methane oxidisers. Based on the crystal structures, enzymatic activities, and metagenome mining, we propose a model in which the catabolic oxidising steps would wire electron delivery to F420 in this organism. Via this specific adaptation, the indirect electron transfer from reduced F420 to the sulphate-reducing partner would fuel energy conservation and represent the driving force of ethanotrophy.

Differences in regulation mechanisms of glutamine synthetases from methanogenic archaea unveiled by structural investigations.

Glutamine synthetases (GS) catalyze the ATP-dependent ammonium assimilation, the initial step of nitrogen acquisition that must be under tight control to fit cellular needs. While their catalytic mechanisms and regulations are well-characterized in bacteria and eukaryotes, only limited knowledge exists in archaea. Here, we solved two archaeal GS structures and unveiled unexpected differences in their regulatory mechanisms. GS from Methanothermococcus thermolithotrophicus is inactive in its resting state and switched on by 2-oxoglutarate, a sensor of cellular nitrogen deficiency. The enzyme activation overlays remarkably well with the reported cellular concentration for 2-oxoglutarate. Its binding to an allosteric pocket reconfigures the active site through long-range conformational changes. The homolog from Methermicoccus shengliensis does not harbor the 2-oxoglutarate binding motif and, consequently, is 2-oxoglutarate insensitive. Instead, it is directly feedback-inhibited through glutamine recognition by the catalytic Asp50'-loop, a mechanism common to bacterial homologs, but absent in M. thermolithotrophicus due to residue substitution. Analyses of residue conservation in archaeal GS suggest that both regulations are widespread and not mutually exclusive. While the effectors and their binding sites are surprisingly different, the molecular mechanisms underlying their mode of action on GS activity operate on the same molecular determinants in the active site.