A cysteine-rich secretory protein involves in phytohormone melatonin mediated plant resistance to CGMMV.

BACKGROUND: Melatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown. RESULTS: In this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 µM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection. CONCLUSIONS: Together, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.

Pratylenchus zeae a causative agent of Corn Root Rot in Jiangsu Province of China.

Corn (Zea mays L.) plays an important role in China's cash crops, not only as food, but a vital raw material for animal husbandry and industry (Li et al. 2022). Pratylenchus zeae is one of the most damaging root-lesion nematodes (RLN) that can result in decreased yield and quality of crops (Liu et al. 2017). In September 2020, five root/soil samples were collected from the rhizosphere of corn (cv. Zhengdan 958), which had weak growth and root brown lesions in Chenzhou Village, Taolin Town, Donghai County, Lianyungang City, Jiangsu Province of China. Nematodes were extracted from the collected samples using the modified Baermann funnel method (Hooper et al. 2005). RLN were found in all samples, an average of 46 RLN per gram of root and 138 RLN per 100 cm3 of soil. The obtained RLN females were sterilized with 0.3% streptomycin sulfate and then inoculated on each carrot disks individually to obtain the purified population. RLN were examined by morphological and molecular characteristics to confirm the species indentification. The main morphological measurements of adult (n = 15) included body length = 524.7 µm (mean) ± 15.1 (standard deviation) (range = 490.7 to 543.6 µm), stylet = 15.2 µm ± 0.8 (14.2 to 16.8 µm), tail length = 30.3 µm ± 2.5 (26.3 to 35.3 µm), a = 25.6 ± 1.3 (24.4 to 29.3), b = 5.3 ± 0.3 (4.7 to 5.8), c = 17.4 ± 1.4 (14.9 to 19.3), two annules on the lip region. No males were found in the specimens. The morphological characters of this population are consistent with the description of P. zeae (Castillo and Vovlas, 2007). Furthermore, DNA was extracted from individual nematodes. The primers of TW81/AB28 and D2A/D3B (Subbotin et al. 2006) were used to amplified the rDNA-ITS region and rDNA 28S D2-D3 region, respectively. The purified PCR products were ligated into One step ZTOPO-Blunt/TA vector and transformed to Escherichia coli strain DH5α, and then sequenced by Sunya Biotechnology Co., Ltd (Henan, China). The obtained seqences were submitted to NCBI. The rDNA-ITS sequences (669 bp, GenBank Accession No: OP456372 and OP466367) exhibited 95.0% to 97.1% of identity with P. zeae sequences (KU198980 and KU198975). The obtained D2-D3 region of the 28S rDNA sequences (782 bp, OP441397 and OP448675) exhibited 99.7% to 100% identity with P. zeae sequences (EU130893 and KY424269). Consequently, both morphological and molecular data confirmed the identity of P. zeae. To further confirm reproduction on corn, single corn seeds (cv. Zhengdan 958) were sown in eight 2-liter pots filled with 1.8-liter of sterilized soil in greenhouse at 28°C. About 15 days after sowing, each pot with one corn plant with the same growth status was selected to inoculate with 1,000 mixed stage nematodes of P. zeae , Eight pots of uninoculated corn plants were used as controls. After 60 days, the inoculated plants were harvested and brown lesions were observed on roots. No symptoms and nematodes was detected in the control. An average number of RLN per pot was 3,752 in soil and 1,183 in roots were extracted, the reproduction factor (final population/initial population) was 4.94, indicating that P. zeae infects and reproduces well on this corn cultivar. P. zeae has only been reported on corn in Guangxi Province, southern in China(Fang et al. 1994). To our knowledge, this is the fist report of P. zeae infecting corn in Jiangsu Province, eastern in China. As P. zeae can cause great damage to corn, necessary measures should be taken to prevent the spread of P. zeae to other areas.

Tau acetylates and stabilizes ß-catenin thereby promoting cell survival.

Overexpressing Tau counteracts apoptosis and increases dephosphorylated ß-catenin levels, but the underlying mechanisms are elusive. Here, we show that Tau can directly and robustly acetylate ß-catenin at K49 in a concentration-, time-, and pH-dependent manner. ß-catenin K49 acetylation inhibits its phosphorylation and its ubiquitination-associated proteolysis, thus increasing ß-catenin protein levels. K49 acetylation further promotes nuclear translocation and the transcriptional activity of ß-catenin, and increases the expression of survival-promoting genes (bcl2 and survivin), counteracting apoptosis. Mutation of Tau's acetyltransferase domain or co-expressing non-acetylatable ß-catenin-K49R prevents increased ß-catenin signaling and abolishes the anti-apoptotic function of Tau. Our data reveal that Tau preserves ß-catenin by acetylating K49, and upregulated ß-catenin/survival signaling in turn mediates the anti-apoptotic effect of Tau.

Occurrence of Root-Lesion Nematode Pratylenchus coffeae on Corn in Xinjiang Uygur Autonomous Region, China.

Pratylenchus coffeae Filipjev & Schuurmans Stekhoven, 1941, is one of the most important root-lesion nematodes (RLN) parasitizing many agronomic and industrial crops (Wang et al. 2021). Corn (Zea mays L.) is one economically important crop in China, with 35 million hectares cultivated annually (Li et al. 2019). In July 2019, a survey of RLN was carried out in corn field planting with cultivar Heyu 187 in Chuanba village in Qitai County, Xinjiang Uygur Autonomous Region, China. Five root/soil samples were collected from poor growing plants with distinct brown lesions. Nematodes were extracted from the collected root/soil samples with the modified Baermann funnel method (Hooper et al. 2005). The average of 157 RLN per 100 cm3 of soil and 43 RLN per gram of fresh root were extracted. The obtained RLN were sterilized with 0.3% streptomycin sulfate and cultured on carrot disks at 25°C. Twenty petri dishes with carrot disks, each inoculated with one female. The morphological and molecular characteristics of RLN cultured on carrot disks were examined for species identification. Morphological measurements of adult females (n=15) included body length (range = 529.0 to 658.0 µm, mean = 571.0 µm), head with two lip annuli, stylet (15.5 to 17.0 µm, 16.0 µm), tail length (27.5 to 32.5 µm, 30.5 µm), a (23.8 to 32.9, 28.5), b (5.8 to 7.1, 6.5), c (16.5 to 23.4, 18.9), and V (76.6 to 83.1%, 80.8%). Morphological measurements of adult males (n=15) were body length (range = 479.5 to 568.0 µm, mean = 516.0 µm), head with two lip annuli, stylet (14.5 to 15.5 µm, 15.0 µm), tail length (24.0 to 29.0 µm, 26.0 µm), spicule length (16.4 to 19.0 µm, 17.5 µm), gubernaculum length (4.4 to 5.3 µm, 4.9 µm), a (29.2 to 32.5, 31.0), b (5.7 to 6.9, 6.2), and c (18.2 to 22.6, 19.8). The morphological characters of this population are consistent with the description of P. coffeae (Castillo and Vovlas, 2007). Nematode DNA was extracted from an individual female. The primers of D2A/D3B (5'-ACAAGTACCGTGAGGGAAAGTTG-3'/5'-TCGGAAGGAACCAGCTACTA-3') (Subbotin et al. 2006) and 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3' / 5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992) were used to amplify the D2/D3 expansion region of the 28S rRNA gene and the rDNA internal transcribed spacer (ITS) region, respectively. The PCR products were purified and transformed to E. coli strain DH5α, and then sequenced by Sangon Biotech Co. Ltd. (Shanghai, China). The obtained sequences of the D2/D3 region (793 bp) and the ITS region (1,242 bp) were submitted to GenBank, and the accession numbers for D2/D3 region were OK103614 and OK103619 which had 98.6% and 100% identity with the reported P. coffeae sequences (KC490925); the two obtained ITS sequences accession numbers OK103603 and OK103613) had more than 99% identity with published P. coffeae sequences from GenBank (e.g., LC030410, LC030395, MH134508 and LC030380). Hence, both morphological and molecular data demonstrated the presence of P. coffeae. To further confirm reproduction on corn, the obtained RLN population was used to inoculate corn plants in 2-liter pots containing 1.8-liter sterilized and mixed soil with 2 pastoral soil: 1 substrate in greenhouse at 27°C. About 15 days after sowing, each pot with one corn plant (cv. Heyu 187) with the same growth status was selected to inoculate P. coffeae. Five small holes near the roots were made using a glass rod. Approximately 1,000 mixed stage nematodes of P. coffeae were then pipetted into the holes of each plant. Eight replications were performed. Eight additional pots of uninoculated corn plants were used as control. After 2 months, corn roots were washed and brown lesions were observed on roots. The average number of RLN/pot was approximately 5,030 in soil and 2,870 in roots, and each pot had an average of 7.9 reproduction factors (final population/initial population), indicating that this nematode population infects and reproduces well on this corn cultivar. No nematodes and symptoms was detected in the control pot. The nematode of P. coffeae has only been reported on corn in Guangdong, Liaoning, Shangdong and Henan Provinces in China (Liu et al. 1996; Liu et al. 2001; Xia et al. 2021). To our knowledge, this is the first report of P. coffeae infecting corn in Xinjiang Uygur Autonomous Region of China. Since RLN can cause considerable damage to corn, one of the most important food crops produced in China, strategic measures should be taken to prevent the spread of P. coffeae to other regions.

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

HIF-1α Causes LCMT1/PP2A Deficiency and Mediates Tau Hyperphosphorylation and Cognitive Dysfunction during Chronic Hypoxia.

Chronic hypoxia is a risk factor for Alzheimer's disease (AD), and the neurofibrillary tangle (NFT) formed by hyperphosphorylated tau is one of the two major pathological changes in AD. However, the effect of chronic hypoxia on tau phosphorylation and its mechanism remains unclear. In this study, we investigated the role of HIF-1α (the functional subunit of hypoxia-inducible factor 1) in tau pathology. It was found that in Sprague-Dawley (SD) rats, global hypoxia (10% O2, 6 h per day) for one month induced cognitive impairments. Meanwhile it induced HIF-1α increase, tau hyperphosphorylation, and protein phosphatase 2A (PP2A) deficiency with leucine carboxyl methyltransferase 1(LCMT1, increasing PP2A activity) decrease in the rats' hippocampus. The results were replicated by hypoxic treatment in primary hippocampal neurons and C6/tau cells (rat C6 glioma cells stably expressing human full-length tau441). Conversely, HIF-1α silencing impeded the changes induced by hypoxia, both in primary neurons and SD rats. The result of dual luciferase assay proved that HIF-1α acted as a transcription factor of LCMT1. Unexpectedly, HIF-1α decreased the protein level of LCMT1. Further study uncovered that both overexpression of HIF-1α and hypoxia treatment resulted in a sizable degradation of LCMT1 via the autophagy--lysosomal pathway. Together, our data strongly indicated that chronic hypoxia upregulates HIF-1α, which obviously accelerated LCMT1 degradation, thus counteracting its transcriptional expression. The increase in HIF-1α decreases PP2A activity, finally resulting in tau hyperphosphorylation and cognitive dysfunction. Lowering HIF-1α in chronic hypoxia conditions may be useful in AD prevention.

Tau accumulation triggers STAT1-dependent memory deficits by suppressing NMDA receptor expression.

Intracellular tau accumulation forming neurofibrillary tangles is hallmark pathology of Alzheimer's disease (AD), but how tau accumulation induces synapse impairment is elusive. By overexpressing human full-length wild-type tau (termed hTau) to mimic tau abnormality as seen in the brain of sporadic AD patients, we find that hTau accumulation activates JAK2 to phosphorylate STAT1 (signal transducer and activator of transcription 1) at Tyr701 leading to STAT1 dimerization, nuclear translocation, and its activation. STAT1 activation suppresses expression of N-methyl-D-aspartate receptors (NMDARs) through direct binding to the specific GAS element of GluN1, GluN2A, and GluN2B promoters, while knockdown of STAT1 by AAV-Cre in STAT1flox/flox mice or expressing dominant negative Y701F-STAT1 efficiently rescues hTau-induced suppression of NMDAR expression with amelioration of synaptic functions and memory performance. These findings indicate that hTau accumulation impairs synaptic plasticity through JAK2/STAT1-induced suppression of NMDAR expression, revealing a novel mechanism for hTau-associated synapse and memory deficits.

Occurrence of Pratylenchus coffeae Causing Root Rot of Soybean in Shandong Province of China.

Soybean (Glycine max L.) is a very important commercial crop in China (Li et al. 2019). Pratylenchus coffeae (Zimmermann, 1898) Filipjev & Schuurmans Stekhoven, 1941, is one of the most important root-lesion nematodes that invade the roots of many crops. In August 2018, five root and soil samples were collected in a soybean field, near Xipan village in Linshu county of Linyi City, Shandong Province, China (Fig. S1), to investigate the occurrence of root-lesion nematodes. The collected plants (cv. Lindou No.10) were growing poorly and the roots showed distinct brown lesions (Fig. S2). Pratylenchus spp. were extracted using the modified Baermann funnel method for 2 days (Hooper et al. 2005). On average, 395 root-lesion nematodes per kg of soil and 36 root-lesion nematodes per gram of fresh roots were extracted. The extracted root-lesion nematodes were disinfected with 0.3% streptomycin sulfate and cultured on carrot disks for propagation at 25°C. The species identification was based on morphological and molecular criteria. Key morphological features were determined for females and males. Measurements of females (n = 16) included body length = 561.0 µm ± 37.6 (standard deviation) (520.5 to 654.0 µm), tail length = 30.0 µm ± 1.9 (27.0 to 33.5 µm), stylet = 16.0 µm ± 0.6 (15.0 to 17.5 µm), a = 28.2 ± 2.3 (23.7 to 31.5), b = 6.4 ± 0.5 (5.7 to 7.3), c = 18.7 ± 1.8 (15.7 to 23.8), and V = 80.8% ± 2.1 (76.5 to 83.8%). Measurements of males (n = 16): body length = 511.0 µm ± 28.1 (range= 475.5 to 566.0 µm), tail length = 26.0 µm ± 1.3 (23.5 to 28.5 µm), stylet = 15.0 µm ± 0.5 (14.5 to 16.0 µm), spicule length = 17.0 µm ± 0.9 (16.0 to 18.5 µm), a = 30.8 ± 1.5 (28.0 to 33.2), b = 6.1 ±0.4 (5.6 to 6.9), and c = 19.8 ± 1.3 (18.1 to 22.2) (Fig. S3). All the morphological features of this population matched the description of P. coffeae (Castillo and Vovlas, 2007). DNA was extracted from an individual female as described previously (Wang et al. 2011). The rDNA-internal transcribed spacer (ITS) region and the D2/D3 region of the 28S rRNA gene were amplified by primers 18S/26S (Vrain et al. 1992) and D2A/D3B (De Ley et al. 1999), respectively. The PCR products were purified and sequenced. The obtained sequences of the ITS region (1,253 bp) and the D2/D3 region of 28S rRNA (781 bp) were deposited in GenBank. The ITS sequences of the root-lesion nematode obtained in this study (GenBank Accession no. MT879294) exhibited 99% identity with several P. coffeae sequences available in the GenBank (e.g., KR106219, MT586756, KY424205, and MN749379), and the obtained D2/D3 region sequence (MT879295) exhibited 100% identity with several P. coffeae sequences (e.g., MT586754, MN750755, MK829009, and MH730447). Both morphological and molecular data confirmed the presence of P. coffeae. To confirm reproduction on soybean, the obtained root-lesion nematode population was used in a greenhouse (25°C) assay to fulfill modified Koch's postulates. About 20 days after sowing, eight pots, each with one soybean plant (Lindou No.10) were inoculated with 1000 P. coffeae. The inoculated plants were kept in 1.5 L pots containing 1.2 L sterilized soil. Eight pots of uninoculated soybeans were used as the control. Ten weeks later, the inoculated roots were washed and brown lesions were observed. The number of nematodes/pot was approximately 7360 in soil and 796 in roots, and the reproduction factor was 8.16. Root-lesion nematodes and symptoms were not observed in control groups. P. coffeae has only been reported on soybean in Zhejiang (Wei et al. 2013) and Henan Province (Li et al. 2019) of China. To our knowledge, this is the first report of P. coffeae infecting soybean in Shandong Province, China. Since the root-lesion nematode can cause considerable damage to soybean, care should be taken to prevent the spread of P. coffeae to other regions in China.

Exploring the effect of inhibitor AKB-9778 on VE-PTP by molecular docking and molecular dynamics simulation.

Diabetic macular edema, also known as diabetic eye disease, is mainly caused by the overexpression of vascular endothelial protein tyrosine phosphatase (VE-PTP) at hypoxia/ischemic. AKB-9778 is a known VE-PTP inhibitor that can effectively interact with the active site of VE-PTP to inhibit the activity of VE-PTP. However, the binding pattern of VE-PTP with AKB-9778 and the dynamic implications of AKB-9778 on VE-PTP system at the molecular level are poorly understood. Through molecular docking, it was found that the AKB-9778 was docked well in the binding pocket of VE-PTP by the interactions of hydrogen bond and Van der Waals. Furthermore, after molecular dynamic simulations on VE-PTP system and VE-PTP AKB-9778 system, a series of postdynamic analyses found that the flexibility and conformation of the active site undergone an obvious transition after VE-PTP binding with AKB-9778. Moreover, by constructing the RIN, it was found that the different interactions in the active site were the detailed reasons for the conformational differences between these two systems. Thus, the finding here might provide a deeper understanding of AKB-9778 as VE-PTP Inhibitor.

[Physicochemical properties of medicinal fungus Polyporus umbellatus sclerotial exudate].

This study was conducted to investigate the physicochemical properties of Polyporus umbellatus sclerotial exudate. Morphological characteristics of the sclerotia and its exudate were observed during different stages of sclerotial formation. The pH of the exudate was detected at different time during cultivation. A phenol-sulfuric acid method was employed to determine the polysaccharide content of P. umbellatus sclerotial exudate during cultivating time. Additionally, the protein content was measured by means of BCA protein assay. Furthermore, CAT content was detected using ultraviolet absorption method. That the protein content of the exudate and CAT specific activity rose gradually during the passage of the cultivating time indicated a high level of oxidative stress during P. umbellatus sclerotial exudate formation. The results showed that the pH of the exudate increased gradually and then dropped down during sclerotial formation. That the pH of the exudate maintained the acidity state during the cultivation indirectly indicated that acidic environment would help sclerotial formation. The exudate produced gradually and was absorbed by the sclerotia itself.

Complicated Role of Post-translational Modification and Protease-Cleaved Fragments of Tau in Alzheimer's Disease and Other Tauopathies.

Tau, a microtubule-associated protein predominantly localized in neuronal axons, plays a crucial role in promoting microtubule assembly, stabilizing their structure, and participating in axonal transport. Perturbations in tau's structure and function are implicated in the pathogenesis of neurodegenerative diseases collectively known as tauopathies, the most common disorder of which is Alzheimer's disease (AD). In tauopathies, it has been found that tau has a variety of post-translational modification (PTM) abnormalities and/or tau is cleaved into a variety of fragments by some specific proteolytic enzymes; however, the precise contributions of these abnormal modifications and fragments to disease onset and progression remain incompletely understood. Herein, we provide an overview about the involvement of distinctive abnormal tau PTMs and different tau fragments in the pathogenesis of AD and other tauopathies and discuss the involvement of proteolytic enzymes such as caspases, calpains, and asparagine endopeptidase in mediating tau cleavage while also addressing the intercellular transmission role played by tau. We anticipate that further exploration into PTMs and fragmented forms of tau will yield valuable insights for diagnostic approaches and therapeutic interventions targeting AD and other related disorders.

Abnormal protein post-translational modifications induces aggregation and abnormal deposition of protein, mediating neurodegenerative diseases.

Protein post-translational modifications (PPTMs) refer to a series of chemical modifications that occur after the synthesis of protein. Proteins undergo different modifications such as phosphorylation, acetylation, ubiquitination, and so on. These modifications can alter the protein's structure, function, and interaction, thereby regulating its biological activity. In neurodegenerative diseases, several proteins undergo abnormal post-translational modifications, which leads to aggregation and abnormal deposition of protein, thus resulting in neuronal death and related diseases. For example, the main pathological features of Alzheimer's disease are the aggregation of beta-amyloid protein and abnormal phosphorylation of tau protein. The abnormal ubiquitination and loss of α-synuclein are related to the onset of Parkinson's disease. Other neurodegenerative diseases such as Huntington's disease, amyotrophic lateral sclerosis, and so on are also connected with abnormal PPTMs. Therefore, studying the abnormal PPTMs in neurodegenerative diseases is critical for understanding the mechanism of these diseases and the development of significant therapeutic strategies. This work reviews the implications of PPTMs in neurodegenerative diseases and discusses the relevant therapeutic strategies.

Dynamic changes in lysosome-related pathways in APP/PS1 mice with aging.

Senile plaque, composed of amyloid ß protein (Aß) aggregates, is a critical pathological feature in Alzheimer's disease (AD), leading to cognitive dysfunction. However, how Aß aggregates exert age-dependent toxicity and temporal cognitive dysfunction in APP/PS1 mice remains incompletely understood. In this study, we investigated AD pathogenesis and dynamic alterations in lysosomal pathways within the hippocampus of age-gradient male mice using transcriptome sequencing, molecular biology assays, and histopathological analyses. We observed high levels of ß-amyloid precursor protein (APP) protein expression in the hippocampus at an early stage and age-dependent Aß deposition. Transcriptome sequencing revealed the enrichment of differential genes related to the lysosome pathway. Furthermore, the protein expression of ATP6V0d2 and CTSD associated with lysosomal functions exhibited dynamic changes with age, increasing in the early stage and decreasing later. Similar age-dependent patterns were observed for the endosome function, autophagy pathway, and SGK1/FOXO3a pathway. Nissl and Golgi staining in the hippocampal region showed age-dependent neuronal loss and synaptic damage, respectively. These findings clearly define the age-gradient changes in the autophagy-lysosome system, the endosome/lysosome system, and the SGK1/FOXO3a pathway in the hippocampus of APP/PS1 mice, providing new perspectives and clues for understanding the possible mechanisms of AD, especially the transition from compensatory to decompensated state.

[Improving the temperature robustness of the DOAS based on two-dimensional correlation spectroscopy technology].

The accuracy of the measurement results will be influenced by the ambient temperature in the real-time monitoring based on Differential Optical Absorption Spectroscopy (DOAS). A novel method to improve the temperature robustness of DOAS technology is adopted by two-dimensional correlation spectroscopy technology. Two-dimensional correlation is used to analyse the SO2 absorption cross section at different temperatures. The diagonal slices of synchronization correlation spectroscopy which come from dynamic absorption cross section are obtained. The wavelength 300.5-310 nm is used as the preferred inversion wavelength range based on the slices. The field measurement results and reference value are compared. Results show that the 24-hour average measurement error is 22.5% at 290-310 nm and that at 300.5-310 nm is 9.9%. The correlation coefficients are 0.9496 and 0.7808, respectively. Two-dimensional correlation DOAS technology can be applied to enhance the robustness of temperature, and to improve the accuracy of the measurement results.

Gypenoside IX restores Akt/GSK-3ß pathway and alleviates Alzheimer's disease-like neuropathology and cognitive deficits.

The main pathological changes of Alzheimer's disease (AD), a progressive neurodegenerative disorder, include senile plaque (deposited by amyloid beta), neurofibrillary tangle (formed by paired helical filaments composed of hyperphosphorylated tau), and massive loss of neurons. Currently there is a lack of ideal drugs to halt AD progression. Gypenosides (GPs), a kind of natural product, possesses potential therapeutic effects for neurodegenerative diseases, including AD. However, the specific role and mechanism of GPs for AD remain unclear. In the current study, we used staurosporine (STP), an inducer of apoptosis and causing tau hyperphosphorylation, to mimic AD models, and explored the role and mechanism of Gypenoside IX (one of the extracts of Gynostemma, GP for short name in our experiments) in STP treated primary hippocampal neurons and rats. We found STP not only increased apoptosis and tau hyperphosphorylation, but also significantly increased Aß production, resulting in synaptic dysfunction and cognitive decline in mimic AD models by STP. GP was found to rescue apoptosis and cognitive impairments caused by STP treatment. Moreover, GP recovered the decreased synaptic proteins PSD95, Synaptophysin and GluR2, and blocked dendritic spine loss. Interestingly, GP decreased the STP induced tau hyperphosphorylation at different sites including S-199, S-202, T-205, T-231, S-262, S-396, and S-404, and at the same time decreased Aß production through down-regulation of BACE1 and PS1. These effects in STP treated primary hippocampal neurons and rats were accompanied with a restoration of AKT/GSK-3ß signaling axis with GP treatment, supporting that dysregulation of AKT/GSK-3ß pathway might be involved in STP related AD pathogenesis. The results from our research proved that GP might be a potential candidate compound to reduce neuronal damage and prevent the cognitive decline in AD.

Interaction between cucumber green mottle mosaic virus MP and CP promotes virus systemic infection.

The movement protein (MP) and coat protein (CP) of tobamoviruses play critical roles in viral cell-to-cell and long-distance movement, respectively. Cucumber green mottle mosaic virus (CGMMV) is a member of the genus Tobamovirus. The functions of CGMMV MP and CP during viral infection remain largely unclear. Here, we show that CGMMV MP can interact with CP in vivo, and the amino acids at positions 79-128 in MP are vital for the MP-CP interaction. To confirm this finding, we mutated five conserved residues within the residue 79-128 region and six other conserved residues flanking this region, followed by in vivo interaction assays. The results showed that the conserved threonine residue at the position 107 in MP (MPT107 ) is important for the MP-CP interaction. Substitution of T107 with alanine (MPT107A ) delayed CGMMV systemic infection in Nicotiana benthamiana plants, but increased CGMMV local accumulation. Substitutions of another 10 conserved residues, not responsible for the MP-CP interaction, with alanine inhibited or abolished CGMMV systemic infection, suggesting that these 10 conserved residues are possibly required for the MP movement function through a CP-independent manner. Moreover, two movement function-associated point mutants (MPF17A and MPD97A ) failed to cause systemic infection in plants without impacting on the MP-CP interaction. Furthermore, we have found that co-expression of CGMMV MP and CP increased CP accumulation independent of the interaction. MP and CP interaction inhibits the salicylic acid-associated defence response at an early infection stage. Taken together, we propose that the suppression of host antiviral defence through the MP-CP interaction facilitates virus systemic infection.

Inactivation of ERK1/2-CREB Pathway Is Implicated in MK801-induced Cognitive Impairment.

OBJECTIVE: Schizophrenia (SZ) is associated with cognitive impairment, and it is known that the activity of cAMP response element binding protein (CREB) decreases in the brain of SZ patients. The previous study conducted by the investigators revealed that the upregulation of CREB improves the MK801-related SZ cognitive deficit. The present study further investigates the mechanism on how CREB deficiency is associated with SZ-related cognitive impairment. METHODS: MK-801 was used to induce SZ in rats. Western blotting and immunofluorescence were performed to investigate CREB and the CREB-related pathway implicated in MK801 rats. The long-term potentiation and behavioral tests were performed to assess the synaptic plasticity and cognitive impairment, respectively. RESULTS: The phosphorylation of CREB at Ser133 decreased in the hippocampus of SZ rats. Interestingly, among the upstream kinases of CREB, merely ERK1/2 was downregulated, while CaMKII and PKA remained unchanged in the brain of MK801-related SZ rats. The inhibition of ERK1/2 by PD98059 reduced the phosphorylation of CREB-Ser133, and induced synaptic dysfunction in primary hippocampal neurons. Conversely, the activation of CREB attenuated the ERK1/2 inhibitor-induced synaptic and cognitive impairment. CONCLUSION: These present findings partially suggest that the deficiency of the ERK1/2-CREB pathway is involved in MK801-related SZ cognitive impairment. The activation of the ERK1/2-CREB pathway may be therapeutically useful for treating SZ cognitive deficits.

Ferulic Acid Improves Synaptic Plasticity and Cognitive Impairments by Alleviating the PP2B/DARPP-32/PP1 Axis-Mediated STEP Increase and Aß Burden in Alzheimer's Disease.

The burden of Alzheimer's disease, the most prevalent neurodegenerative disease, is increasing exponentially due to the increase in the elderly population worldwide. Synaptic plasticity is the basis of learning and memory, but it is impaired in AD. Uncovering the disease's underlying molecular pathogenic mechanisms involving synaptic plasticity could lead to the identification of targets for better disease management. Using primary neurons treated with Aß and APP/PS1 animal models, we evaluated the effect of the phenolic compound ferulic acid (FA) on synaptic dysregulations. Aß led to synaptic plasticity and cognitive impairments by increasing STEP activity and decreasing the phosphorylation of the GluN2B subunit of NMDA receptors, as well as decreasing other synaptic proteins, including PSD-95 and synapsin1. Interestingly, FA attenuated the Aß-upregulated intracellular calcium and thus resulted in a decrease in PP2B-induced activation of DARPP-32, inhibiting PP1. This cascade event maintained STEP in its inactive state, thereby preventing the loss of GluN2B phosphorylation. This was accompanied by an increase in PSD-95 and synapsin1, improved LTP, and a decreased Aß load, together leading to improved behavioral and cognitive functions in APP/PS1 mice treated with FA. This study provides insight into the potential use of FA as a therapeutic strategy in AD.

[Selection of digital filtering in the escaping ammonia monitoring with TDLAS].

Tunable diode laser absorption spectroscopy technology (TDLAS), with its advantages of high selectivity and accuracy, provides a reliable approach to the on-line detection of escaping ammonia. Firstly, the present paper introduces the TDLAS principle, experimental system and the analyses of system noise. Then with the concentration of 90 x 10(-6) and 30 x 10(-6) NH3 for example, we used TDLAS system to collect their second harmonic original spectrum with all kinds of noise interference. To improve the signal spectrum, five types of digital filtering methods were respectively used to filter the original spectrum. Finally we did the NH3 experiments of concentration gradient and the long time monitoring: NH3 experiment of 20 x 10(-6). The analysis indicated that the averaging-wavelet filtering is validated to be more accurate than the other filtering methods in the noise reduction, which can improve the precision of the monitoring system from 10 x 10(-6) to 1.25 x 10(-6) and the SNR also increases by 14 times. It provides an effective pretreatment during the monitoring of escaping ammonia of extremely low concentration.