Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 401
Filtrar
Más filtros

Banco de datos
País/Región como asunto
Tipo del documento
Intervalo de año de publicación
1.
Proc Natl Acad Sci U S A ; 121(16): e2318783121, 2024 Apr 16.
Artículo en Inglés | MEDLINE | ID: mdl-38588412

RESUMEN

Communication between insects and plants relies on the exchange of bioactive molecules that traverse the species interface. Although proteinic effectors have been extensively studied, our knowledge of other molecules involved in this process remains limited. In this study, we investigate the role of salivary microRNAs (miRNAs) from the rice planthopper Nilaparvata lugens in suppressing plant immunity. A total of three miRNAs were confirmed to be secreted into host plants during insect feeding. Notably, the sequence-conserved miR-7-5P is specifically expressed in the salivary glands of N. lugens and is secreted into saliva, distinguishing it significantly from homologues found in other insects. Silencing miR-7-5P negatively affects N. lugens feeding on rice plants, but not on artificial diets. The impaired feeding performance of miR-7-5P-silenced insects can be rescued by transgenic plants overexpressing miR-7-5P. Through target prediction and experimental testing, we demonstrate that miR-7-5P targets multiple plant genes, including the immune-associated bZIP transcription factor 43 (OsbZIP43). Infestation of rice plants by miR-7-5P-silenced insects leads to the increased expression of OsbZIP43, while the presence of miR-7-5P counteracts this upregulation effect. Furthermore, overexpressing OsbZIP43 confers plant resistance against insects which can be subverted by miR-7-5P. Our findings suggest a mechanism by which herbivorous insects have evolved salivary miRNAs to suppress plant immunity, expanding our understanding of cross-kingdom RNA interference between interacting organisms.


Asunto(s)
Hemípteros , MicroARNs , Oryza , Animales , Interferencia de ARN , MicroARNs/genética , MicroARNs/metabolismo , Saliva , Hemípteros/fisiología , Inmunidad de la Planta/genética , Oryza/genética
2.
Proc Natl Acad Sci U S A ; 121(14): e2315982121, 2024 Apr 02.
Artículo en Inglés | MEDLINE | ID: mdl-38536757

RESUMEN

Throughout evolution, arboviruses have developed various strategies to counteract the host's innate immune defenses to maintain persistent transmission. Recent studies have shown that, in addition to bacteria and fungi, the innate Toll-Dorsal immune system also plays an essential role in preventing viral infections in invertebrates. However, whether the classical Toll immune pathway is involved in maintaining the homeostatic process to ensure the persistent and propagative transmission of arboviruses in insect vectors remain unclear. In this study, we revealed that the transcription factor Dorsal is actively involved in the antiviral defense of an insect vector (Laodelphax striatellus) by regulating the target gene, zinc finger protein 708 (LsZN708), which mediates downstream immune-related effectors against infection with the plant virus (Rice stripe virus, RSV). In contrast, an antidefense strategy involving the use of the nonstructural-protein (NS4) to antagonize host antiviral defense through competitive binding to Dorsal from the MSK2 kinase was employed by RSV; this competitive binding inhibited Dorsal phosphorylation and reduced the antiviral response of the host insect. Our study revealed the molecular mechanism through which Toll-Dorsal-ZN708 mediates the maintenance of an arbovirus homeostasis in insect vectors. Specifically, ZN708 is a newly documented zinc finger protein targeted by Dorsal that mediates the downstream antiviral response. This study will contribute to our understanding of the successful transmission and spread of arboviruses in plant or invertebrate hosts.


Asunto(s)
Arbovirus , Hemípteros , Oryza , Tenuivirus , Animales , Arbovirus/genética , Hemípteros/fisiología , Tenuivirus/fisiología , Insectos Vectores , Antivirales/metabolismo , Oryza/genética , Enfermedades de las Plantas
3.
J Virol ; : e0099724, 2024 Aug 30.
Artículo en Inglés | MEDLINE | ID: mdl-39212930

RESUMEN

Negevirus is a recently proposed taxon of arthropod-infecting virus, which is associated with plant viruses of two families (Virgaviridae and Kitaviridae). Nevertheless, the evolutionary history of negevirus-host and its relationship with plant viruses remain poorly understood. Endogenous nege-like viral elements (ENVEs) are ancient nege-like viral sequences integrated into the arthropod genomes, which can serve as the molecular fossil records of previous viral infection. In this study, 292 ENVEs were identified in 150 published arthropod genomes, revealing the evolutionary history of nege-like viruses and two related plant virus families. We discovered three novel and eight strains of nege-like viruses in 11 aphid species. Further analysis indicated that 10 ENVEs were detected in six aphid genomes, and they were divided into four types (ENVE1-ENVE4). Orthologous integration and phylogenetic analyses revealed that nege-like viruses had a history of infection of over 60 My and coexisted with aphid ancestors throughout the Cenozoic Era. Moreover, two nege-like viral proteins (CP and SP24) were highly homologous to those of plant viruses in the families Virgaviridae and Kitaviridae. CP- and SP24-derived ENVEs were widely integrated into numerous arthropod genomes. These results demonstrate that nege-like viruses have a long-term coexistence with arthropod hosts and plant viruses of the two families, Virgaviridae and Kitaviridae, which may have evolved from the nege-like virus ancestor through horizontal virus transfer events. These findings broaden our perspective on the history of viral infection in arthropods and the origins of plant viruses. IMPORTANCE: Although negevirus is phylogenetically related to plant virus, the evolutionary history of negevirus-host and its relationship with plant virus remain largely unknown. In this study, we used endogenous nege-like viral elements (ENVEs) as the molecular fossil records to investigate the history of nege-like viral infection in arthropod hosts and the evolution of two related plant virus families (Virgaviridae and Kitaviridae). Our results showed the infection of nege-like viruses for over 60 My during the arthropod evolution. ENVEs highly homologous to viral sequences in Virgaviridae and Kitaviridae were present in a wide range of arthropod genomes but were absent in plant genomes, indicating that plant viruses in these two families possibly evolved from the nege-like virus ancestor through cross-species horizontal virus transmission. Our findings provide a new perspective on the virus-host coevolution and the origins of plant viruses.

4.
PLoS Pathog ; 19(3): e1011266, 2023 03.
Artículo en Inglés | MEDLINE | ID: mdl-36928081

RESUMEN

The Janus kinase-signal transducer and activator of transcription (JAK-STAT) pathway is an evolutionarily conserved signaling pathway that can regulate various biological processes. However, the role of JAK-STAT pathway in the persistent viral infection in insect vectors has rarely been investigated. Here, using a system that comprised two different plant viruses, Rice stripe virus (RSV) and Rice black-streaked dwarf virus (RBSDV), as well as their insect vector small brown planthopper, we elucidated the regulatory mechanism of JAK-STAT pathway in persistent viral infection. Both RSV and RBSDV infection activated the JAK-STAT pathway and promoted the accumulation of suppressor of cytokine signaling 5 (SOCS5), an E3 ubiquitin ligase regulated by the transcription factor STAT5B. Interestingly, the virus-induced SOCS5 directly interacted with the anti-apoptotic B-cell lymphoma-2 (BCL2) to accelerate the BCL2 degradation through the 26S proteasome pathway. As a result, the activation of apoptosis facilitated persistent viral infection in their vector. Furthermore, STAT5B activation promoted virus amplification, whereas STAT5B suppression inhibited apoptosis and reduced virus accumulation. In summary, our results reveal that virus-induced JAK-STAT pathway regulates apoptosis to promote viral infection, and uncover a new regulatory mechanism of the JAK-STAT pathway in the persistent plant virus transmission by arthropod vectors.


Asunto(s)
Tenuivirus , Virosis , Animales , Quinasas Janus/metabolismo , Transducción de Señal , Factores de Transcripción STAT/metabolismo , Tenuivirus/metabolismo , Insectos Vectores , Proteínas Proto-Oncogénicas c-bcl-2/metabolismo
5.
BMC Genomics ; 25(1): 53, 2024 Jan 11.
Artículo en Inglés | MEDLINE | ID: mdl-38212677

RESUMEN

BACKGROUND: Saliva plays a crucial role in shaping the feeding behavior of insects, involving processes such as food digestion and the regulation of interactions between insects and their hosts. Cyrtorhinus lividipennis serves as a predominant natural enemy of rice pests, while Apolygus lucorum, exhibiting phytozoophagous feeding behavior, is a destructive agricultural pest. In this study, a comparative transcriptome analysis, incorporating the published genomes of C.lividipennis and A.lucorum, was conducted to reveal the role of salivary secretion in host adaptation. RESULTS: In contrast to A.lucorum, C.lividipennis is a zoophytophagous insect. A de novo genome analysis of C.lividipennis yielded 19,706 unigenes, including 16,217 annotated ones. On the other hand, A.lucorum had altogether 20,111 annotated genes, as obtained from the published official gene set (20,353 unigenes). Functional analysis of the top 1,000 salivary gland (SG)-abundant genes in both insects revealed that the SG was a dynamically active tissue engaged in protein synthesis and secretion. Predictions of other tissues and signal peptides were compared. As a result, 94 and 157 salivary proteins were identified in C.lividipennis and A.lucorum, respectively, and were categorized into 68 and 81 orthogroups. Among them, 26 orthogroups were shared, potentially playing common roles in digestion and detoxification, including several venom serine proteases. Furthermore, 42 and 55 orthogroups were exclusive in C.lividipennis and A.lucorum, respectively, which were exemplified by a hyaluronidase in C.lividipennis that was associated with predation, while polygalacturonases in A.lucorum were involved in mesophyll-feeding patterns. CONCLUSIONS: Findings in this study provide a comprehensive insight into saliva secretions in C.lividipennis and A.lucorum via a transcriptome approach, reflecting the intricate connections between saliva secretions and feeding behaviors. It is found that conserved salivary secretions are involved in shaping the overlapping feeding patterns, while a plethora of unique salivary secretions may drive the evolution of specific feeding behaviors crucial for their survival. These results enhance our understanding of the feeding mechanisms in different insects from the perspective of saliva and contribute to future environmentally friendly pest control by utilizing predatory insects.


Asunto(s)
Heterópteros , Transcriptoma , Animales , Heterópteros/genética , Glándulas Salivales , Perfilación de la Expresión Génica/métodos , Saliva
6.
Mol Cancer ; 23(1): 120, 2024 Jun 04.
Artículo en Inglés | MEDLINE | ID: mdl-38831402

RESUMEN

The efficacy of anthracycline-based chemotherapeutics, which include doxorubicin and its structural relatives daunorubicin and idarubicin, remains almost unmatched in oncology, despite a side effect profile including cumulative dose-dependent cardiotoxicity, therapy-related malignancies and infertility. Detoxifying anthracyclines while preserving their anti-neoplastic effects is arguably a major unmet need in modern oncology, as cardiovascular complications that limit anti-cancer treatment are a leading cause of morbidity and mortality among the 17 million cancer survivors in the U.S. In this study, we examined different clinically relevant anthracycline drugs for a series of features including mode of action (chromatin and DNA damage), bio-distribution, anti-tumor efficacy and cardiotoxicity in pre-clinical models and patients. The different anthracycline drugs have surprisingly individual efficacy and toxicity profiles. In particular, aclarubicin stands out in pre-clinical models and clinical studies, as it potently kills cancer cells, lacks cardiotoxicity, and can be safely administered even after the maximum cumulative dose of either doxorubicin or idarubicin has been reached. Retrospective analysis of aclarubicin used as second-line treatment for relapsed/refractory AML patients showed survival effects similar to its use in first line, leading to a notable 23% increase in 5-year overall survival compared to other intensive chemotherapies. Considering individual anthracyclines as distinct entities unveils new treatment options, such as the identification of aclarubicin, which significantly improves the survival outcomes of AML patients while mitigating the treatment-limiting side-effects. Building upon these findings, an international multicenter Phase III prospective study is prepared, to integrate aclarubicin into the treatment of relapsed/refractory AML patients.


Asunto(s)
Aclarubicina , Antraciclinas , Leucemia Mieloide Aguda , Animales , Femenino , Humanos , Masculino , Aclarubicina/farmacología , Aclarubicina/uso terapéutico , Antraciclinas/uso terapéutico , Antineoplásicos/uso terapéutico , Antineoplásicos/farmacología , Antineoplásicos/efectos adversos , Leucemia Mieloide Aguda/tratamiento farmacológico , Leucemia Mieloide Aguda/mortalidad , Resultado del Tratamiento
7.
Mol Biol Evol ; 40(10)2023 10 04.
Artículo en Inglés | MEDLINE | ID: mdl-37804524

RESUMEN

Herbivorous insects such as whiteflies, planthoppers, and aphids secrete abundant orphan proteins to facilitate feeding. Yet, how these genes are recruited and evolve to mediate plant-insect interaction remains unknown. In this study, we report a horizontal gene transfer (HGT) event from fungi to an ancestor of Aleyrodidae insects approximately 42 to 190 million years ago. BtFTSP1 is a salivary protein that is secreted into host plants during Bemisia tabaci feeding. It targets a defensive ferredoxin 1 in Nicotiana tabacum (NtFD1) and disrupts the NtFD1-NtFD1 interaction in plant cytosol, leading to the degradation of NtFD1 in a ubiquitin-dependent manner. Silencing BtFTSP1 has negative effects on B. tabaci feeding while overexpressing BtFTSP1 in N. tabacum benefits insects and rescues the adverse effect caused by NtFD1 overexpression. The association between BtFTSP1 and NtFD1 is newly evolved after HGT, with the homologous FTSP in its fungal donor failing to interact and destabilize NtFD1. Our study illustrates the important roles of horizontally transferred genes in plant-insect interactions and suggests the potential origin of orphan salivary genes.


Asunto(s)
Áfidos , Hemípteros , Animales , Ferredoxinas/metabolismo , Plantas/metabolismo , Hemípteros/genética , Nicotiana/genética , Nicotiana/metabolismo , Áfidos/metabolismo , Proteínas y Péptidos Salivales/genética
8.
J Gen Virol ; 105(4)2024 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-38602389

RESUMEN

A negative-strand symbiotic RNA virus, tentatively named Nilaparvata lugens Bunyavirus (NLBV), was identified in the brown planthopper (BPH, Nilaparvata lugens). Phylogenetic analysis indicated that NLBV is a member of the genus Mobuvirus (family Phenuiviridae, order Bunyavirales). Analysis of virus-derived small interfering RNA suggested that antiviral immunity of BPH was successfully activated by NLBV infection. Tissue-specific investigation showed that NLBV was mainly accumulated in the fat-body of BPH adults. Moreover, NLBV was detected in eggs of viruliferous female BPHs, suggesting the possibility of vertical transmission of NLBV in BPH. Additionally, no significant differences were observed for the biological properties between NLBV-infected and NLBV-free BPHs. Finally, analysis of geographic distribution indicated that NLBV may be prevalent in Southeast Asia. This study provided a comprehensive characterization on the molecular and biological properties of a symbiotic virus in BPH, which will contribute to our understanding of the increasingly discovered RNA viruses in insects.


Asunto(s)
Hemípteros , Orthobunyavirus , Virus ARN , Animales , Femenino , Filogenia , Insectos , Virus ARN/genética
9.
Br J Haematol ; 204(5): 2049-2056, 2024 May.
Artículo en Inglés | MEDLINE | ID: mdl-38343073

RESUMEN

Iron overload from repeated transfusions has a negative impact on cardiac function, and iron chelation therapy may help prevent cardiac dysfunction in transfusion-dependent patients with myelodysplastic syndromes (MDS). TELESTO (NCT00940602) was a prospective, placebo-controlled, randomised study to evaluate the iron chelator deferasirox in patients with low- or intermediate-1-risk MDS and iron overload. Echocardiographic parameters were collected at screening and during treatment. Patients receiving deferasirox experienced a significant decrease in the composite risk of hospitalisation for congestive heart failure (CHF) or worsening of cardiac function (HR = 0.23; 95% CI: 0.05, 0.99; nominal p = 0.0322) versus placebo. No significant differences between the arms were found in left ventricular ejection fraction, ventricular diameter and mass or pulmonary artery pressure. The absolute number of events was low, but the enrolled patients were younger than average for patients with MDS, with no serious cardiac comorbidities and a modest cardiovascular risk profile. These results support the effectiveness of deferasirox in preventing cardiac damage caused by iron overload in this patient population. Identification of patients developing CHF is challenging due to the lack of distinctive echocardiographic features. The treatment of iron overload may be important to prevent cardiac dysfunction in these patients, even those with moderate CHF risk.


Asunto(s)
Deferasirox , Quelantes del Hierro , Sobrecarga de Hierro , Síndromes Mielodisplásicos , Humanos , Deferasirox/uso terapéutico , Síndromes Mielodisplásicos/terapia , Síndromes Mielodisplásicos/tratamiento farmacológico , Síndromes Mielodisplásicos/complicaciones , Masculino , Femenino , Quelantes del Hierro/uso terapéutico , Persona de Mediana Edad , Anciano , Sobrecarga de Hierro/etiología , Sobrecarga de Hierro/tratamiento farmacológico , Estudios Prospectivos , Benzoatos/uso terapéutico , Benzoatos/efectos adversos , Insuficiencia Cardíaca/etiología , Reacción a la Transfusión/etiología , Ecocardiografía , Adulto , Anciano de 80 o más Años , Triazoles/uso terapéutico , Triazoles/efectos adversos , Transfusión Sanguínea
10.
Small ; 20(33): e2401162, 2024 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-38511537

RESUMEN

Constructing the pore structures in amorphous metal oxide nanosheets can enhance their electrocatalytic performance by efficiently increasing specific surface areas and facilitating mass transport in electrocatalysis. However, the accurate synthesis for porous amorphous metal oxide nanosheets remains a challenge. Herein, a facile nitrate-assisted oxidation strategy is reported for synthesizing amorphous mesoporous iridium oxide nanomeshes (a-m IrOx NMs) with a pore size of ∼4 nm. X-ray absorption characterizations indicate that a-m IrOx NMs possess stretched Ir─O bonds and weaker Ir-O interaction compared with commercial IrO2. Combining thermogravimetric-fourier transform infrared spectroscopy with differential scanning calorimetry measurements, it is demonstrated that sodium nitrate, acting as an oxidizing agent, is conducive to the formation of amorphous nanosheets, while the NO2 produced by the in situ decomposition of nitrates facilitates the generation of pores within the nanomeshes. As an anode electrocatalyst in proton exchange membrane water electrolyzer, a-m IrOx NMs exhibit superior performance, maintaining a cell voltage of 1.67 V at 1 A cm-2 for 120 h without obvious decay with a low loading (0.4 mgcatalyst cm-2). Furthermore, the nitrate-assisted method is demonstrated to be a general approach to prepare various amorphous metal oxide nanomeshes, including amorphous RhOx, TiOx, ZrOx, AlOx, and HfOx nanomeshes.

11.
Blood ; 140(10): 1132-1144, 2022 09 08.
Artículo en Inglés | MEDLINE | ID: mdl-35653587

RESUMEN

Genetic alternations can occur at noncoding regions, but how they contribute to cancer pathogenesis is poorly understood. Here, we established a mutational landscape of cis-regulatory regions (CREs) in acute promyelocytic leukemia (APL) based on whole-genome sequencing analysis of paired tumor and germline samples from 24 patients and epigenetic profiling of 16 patients. Mutations occurring in CREs occur preferentially in active enhancers bound by the complex of master transcription factors in APL. Among significantly enriched mutated CREs, we found a recurrently mutated region located within the third intron of WT1, an essential regulator of normal and malignant hematopoiesis. Focusing on noncoding mutations within this WT1 intron, an analysis on 169 APL patients revealed that somatic mutations were clustered into a focal hotspot region, including one site identified as a germline polymorphism contributing to APL risk. Significantly decreased WT1 expression was observed in APL patients bearing somatic and/or germline noncoding WT1 variants. Furthermore, biallelic WT1 inactivation was recurrently found in APL patients with noncoding WT1 variants, which resulted in the complete loss of WT1. The high incidence of biallelic inactivation suggested the tumor suppressor activity of WT1 in APL. Mechanistically, noncoding WT1 variants disrupted MYB binding on chromatin and suppressed the enhancer activity and WT1 expression through destroying the chromatin looping formation. Our study highlights the important role of noncoding variants in the leukemogenesis of APL.


Asunto(s)
Leucemia Promielocítica Aguda , Proteínas Proto-Oncogénicas c-myb , Proteínas WT1 , Cromatina/metabolismo , Mutación de Línea Germinal , Humanos , Leucemia Promielocítica Aguda/genética , Leucemia Promielocítica Aguda/metabolismo , Polimorfismo de Nucleótido Simple , Unión Proteica/genética , Proteínas Proto-Oncogénicas c-myb/genética , Proteínas Proto-Oncogénicas c-myb/metabolismo , Proteínas WT1/genética
12.
FASEB J ; 37(2): e22783, 2023 02.
Artículo en Inglés | MEDLINE | ID: mdl-36705056

RESUMEN

Capsular residual lens epithelial cells (CRLEC) undergo differentiation to fiber cells for lens regeneration or tansdifferentiation to myofibroblasts leading to posterior capsular opacification (PCO) after cataract surgery. The underlying regulatory mechanism remains unclear. Using human lens epithelial cell lines and the ex vivo cultured rat lens capsular bag model, we found that the lens epithelial cells secrete HSP90α extracellularly (eHSP90) through an autophagy-associated pathway. Administration of recombinant GST-HSP90α protein or its M-domain induces the elongation of rat CRLEC cells with concomitant upregulation of the crucial fiber cell transcriptional factor PROX1and its downstream targets, ß- and γ-crystallins and structure proteins. This regulation is abolished by PROX1 siRNA. GST-HSP90α upregulates PROX1 by binding to LRP1 and activating LRP1-AKT mediated YAP degradation. The upregulation of GST-HSP90α on PROX1 expression and CRLEC cell elongation is inhibited by LRP1 and AKT inhibitors, but activated by YAP-1 inhibitor (VP). These data demonstrated that the capsular residue epithelial cells upregulate and secrete eHSP90α, which in turn drive the differentiation of lens epithelial cell to fiber cells. The recombinant HSP90α protein is a potential novel differentiation regulator during lens regeneration.


Asunto(s)
Cristalino , Proteínas Proto-Oncogénicas c-akt , Ratas , Animales , Humanos , Proteínas Proto-Oncogénicas c-akt/metabolismo , Diferenciación Celular , Cristalino/metabolismo , Factores de Transcripción/genética , Factores de Transcripción/metabolismo , Células Epiteliales/metabolismo , Proteína 1 Relacionada con Receptor de Lipoproteína de Baja Densidad/genética
13.
Arch Virol ; 169(8): 160, 2024 Jul 09.
Artículo en Inglés | MEDLINE | ID: mdl-38981875

RESUMEN

A novel monopartite dsRNA virus, tentatively named "sponge gourd amalgavirus 1" (SGAV1), was discovered by high-throughput sequencing in sponge gourd (Luffa cylindrica) displaying mosaic symptoms in Jiashan County, Zhejiang Province, China. The genome of SGAV1 is 3,447 nucleotides in length and contains partially overlapping open reading frames (ORFs) encoding a putative replication factory matrix-like protein and a fusion protein, respectively. The fusion protein of SGAV1 shares 57.07% identity with the homologous protein of salvia miltiorrhiza amalgavirus 1 (accession no. DAZ91057.1). Phylogenetic analysis based on the RNA-dependent RNA polymerase (RdRp) protein suggests that SGAV1 belongs to the genus Amalgavirus of the family Amalgaviridae. Moreover, analysis of SGAV1-derived small interfering RNAs indicated that SGAV1 was actively replicating in the host plant. Semi-quantitative RT-PCR showed higher levels of SGAV1 expression in leaves than in flowers and fruits. This is the first report of a novel amalgavirus found in sponge gourd in China.


Asunto(s)
Genoma Viral , Luffa , Sistemas de Lectura Abierta , Filogenia , Genoma Viral/genética , Luffa/virología , Animales , China , Virus ARN Bicatenario/genética , Virus ARN Bicatenario/clasificación , Virus ARN Bicatenario/aislamiento & purificación , Secuenciación Completa del Genoma , Proteínas Virales/genética , ARN Viral/genética , ARN Polimerasa Dependiente del ARN/genética
14.
Arch Virol ; 169(1): 19, 2024 Jan 05.
Artículo en Inglés | MEDLINE | ID: mdl-38180588

RESUMEN

The complete genomic sequence of a novel robigovirus, provisionally named "Mentha arvensis robigovirus 1" (MARV1), was determined by combining next-generation sequencing (NGS), reverse transcription polymerase chain reaction (RT-PCR), and rapid amplification of cDNA ends (RACE) PCR. The complete genomic sequence of this new virus is 7617 nucleotides in length, excluding the 3' poly(A) tail. The MARV1 genome encodes a putative replicase, "triple gene block" proteins, and a coat protein. Phylogenetic analysis demonstrated that MARV1 is a member of the genus Robigovirus, with closest relationships to African oil palm ringspot virus (AOPRV). Furthermore, MARV1-derived small interfering RNAs (siRNAs) showed typical patterns of plant-virus-derived siRNAs produced by the host antiviral RNA interference pathway. This is the first report of a plant virus of the genus Robigovirus in M. arvensis.


Asunto(s)
Flexiviridae , Mentha , Filogenia , Genómica , Secuenciación de Nucleótidos de Alto Rendimiento , ARN Mensajero , ARN Interferente Pequeño/genética
15.
Arch Virol ; 169(7): 141, 2024 Jun 08.
Artículo en Inglés | MEDLINE | ID: mdl-38850364

RESUMEN

The brown planthopper (BPH), Nilaparvata lugens, is a significant agricultural pest capable of long-distance migration and transmission of viruses that cause severe disease in rice. In this study, we identified a novel segmented RNA virus in a BPH, and this virus exhibited a close relationship to members of a recently discovered virus lineage known as "quenyaviruses" within the viral kingdom Orthornavirae. This newly identified virus was named "Nilaparvata lugens quenyavirus 1" (NLQV1). NLQV1 consists of five positive-sense, single-stranded RNAs, with each segment containing a single open reading frame (ORF). The genomic characteristics and phylogenetic analysis support the classification of NLQV1 as a novel quenyavirus. Notably, all of the genome segments of NLRV contained the 5'-terminal sequence AUCUG. The characteristic virus-derived small interfering RNA (vsiRNA) profile of NLQV1 suggests that the antiviral RNAi pathway of the host BPH was activated in response to virus infection. These findings represent the first documented report of quenyaviruses in planthoppers, contributing to our understanding of quenyaviruses and expanding our knowledge of insect-specific viruses in planthoppers.


Asunto(s)
Genoma Viral , Hemípteros , Sistemas de Lectura Abierta , Filogenia , Virus ARN , ARN Viral , Animales , Hemípteros/virología , Genoma Viral/genética , ARN Viral/genética , Virus ARN/genética , Virus ARN/clasificación , Virus ARN/aislamiento & purificación , Enfermedades de las Plantas/virología , Oryza/virología , Secuenciación Completa del Genoma , ARN Interferente Pequeño/genética
16.
Arch Virol ; 169(8): 166, 2024 Jul 12.
Artículo en Inglés | MEDLINE | ID: mdl-38995418

RESUMEN

The virus family Phenuiviridae (order Hareavirales, comprising segmented negative-sense single stranded RNA viruses) has highly diverse members that are known to infect animals, plants, protozoans, and fungi. In this study, we identified a novel phenuivirus infecting a strain of the entomopathogenic fungus Cordyceps javanica isolated from a small brown plant hopper (Laodelphax striatellus), and this virus was tentatively named "Cordyceps javanica negative-strand RNA virus 1" (CjNRSV1). The CjNRSV1 genome consists of three negative-sense single stranded RNA segments (RNA1-3) with lengths of 7252, 2401, and 1117 nt, respectively. The 3'- and 5'-terminal regions of the RNA1, 2, and 3 segments have identical sequences, and the termini of the RNA segments are complementary to each other, reflecting a common characteristic of viruses in the order Hareavirales. RNA1 encodes a large protein (∼274 kDa) containing a conserved domain for the bunyavirus RNA-dependent RNA polymerase (RdRP) superfamily, with 57-80% identity to the RdRP encoded by phenuiviruses in the genus Laulavirus. RNA2 encodes a protein (∼79 kDa) showing sequence similarity (47-63% identity) to the movement protein (MP, a plant viral cell-to-cell movement protein)-like protein (MP-L) encoded by RNA2 of laulaviruses. RNA3 encodes a protein (∼28 kDa) with a conserved domain of the phenuivirid nucleocapsid protein superfamily. Phylogenetic analysis using the RdRPs of various phenuiviruses and other unclassified phenuiviruses showed CjNRSV1 to be grouped with established members of the genus Laulavirus. Our results suggest that CjNRSV1 is a novel fungus-infecting member of the genus Laulavirus in the family Phenuiviridae.


Asunto(s)
Cordyceps , Genoma Viral , Filogenia , ARN Viral , Cordyceps/genética , ARN Viral/genética , Virus Fúngicos/clasificación , Virus Fúngicos/genética , Virus Fúngicos/aislamiento & purificación , Proteínas Virales/genética , Virus ARN de Sentido Negativo/genética , Virus ARN de Sentido Negativo/clasificación , ARN Polimerasa Dependiente del ARN/genética , Virus ARN/genética , Virus ARN/clasificación , Virus ARN/aislamiento & purificación , Secuencia de Aminoácidos , Sistemas de Lectura Abierta
17.
Proc Natl Acad Sci U S A ; 118(11)2021 03 16.
Artículo en Inglés | MEDLINE | ID: mdl-33836579

RESUMEN

Plant viruses employ diverse virulence strategies to achieve successful infection, but there are few known general strategies of viral pathogenicity and transmission used by widely different plant viruses. Here, we report a class of independently evolved virulence factors in different plant RNA viruses which possess active transcriptional repressor activity. Rice viruses in the genera Fijivirus, Tenuivirus, and Cytorhabdovirus all have transcriptional repressors that interact in plants with the key components of jasmonic acid (JA) signaling, namely mediator subunit OsMED25, OsJAZ proteins, and OsMYC transcription factors. These transcriptional repressors can directly disassociate the OsMED25-OsMYC complex, inhibit the transcriptional activation of OsMYC, and then combine with OsJAZ proteins to cooperatively attenuate the JA pathway in a way that benefits viral infection. At the same time, these transcriptional repressors efficiently enhanced feeding by the virus insect vectors by repressing JA signaling. Our findings reveal a common strategy in unrelated plant viruses in which viral transcriptional repressors hijack and repress the JA pathway in favor of both viral pathogenicity and vector transmission.


Asunto(s)
Insectos Vectores/virología , Enfermedades de las Plantas/virología , Proteínas de Plantas/fisiología , Virus de Plantas/genética , Virus de Plantas/patogenicidad , Virus ARN/genética , Virus ARN/patogenicidad , Proteínas Represoras/fisiología , Factores de Virulencia/genética , Animales , Proteínas de Plantas/clasificación , Proteínas Represoras/clasificación
18.
Proc Natl Acad Sci U S A ; 118(6)2021 02 09.
Artículo en Inglés | MEDLINE | ID: mdl-33495363

RESUMEN

As all-trans retinoic acid (ATRA) and arsenic trioxide (ATO) are widely accepted in treating acute promyelocytic leukemia (APL), deescalating toxicity becomes a research hotspot. Here, we evaluated whether chemotherapy could be replaced or reduced by ATO in APL patients at different risks. After achieving complete remission with ATRA-ATO-based induction therapy, patients were randomized (1:1) into ATO and non-ATO groups for consolidation: ATRA-ATO versus ATRA-anthracycline for low-/intermediate-risk patients, or ATRA-ATO-anthracycline versus ATRA-anthracycline-cytarabine for high-risk patients. The primary end point was to assess disease-free survival (DFS) at 3 y by a noninferiority margin of -5%; 855 patients were enrolled with a median follow-up of 54.9 mo, and 658 of 755 patients could be evaluated at 3 y. In the ATO group, 96.1% (319/332) achieved 3-y DFS, compared to 92.6% (302/326) in the non-ATO group. The difference was 3.45% (95% CI -0.07 to 6.97), confirming noninferiority (P < 0.001). Using the Kaplan-Meier method, the estimated 7-y DFS was 95.7% (95% CI 93.6 to 97.9) in ATO and 92.6% (95% CI 89.8 to 95.4) in non-ATO groups (P = 0.066). Concerning secondary end points, the 7-y cumulative incidence of relapse (CIR) was significantly lower in ATO (2.2% [95% CI 1.1 to 4.2]) than in non-ATO group (6.1% [95% CI 3.9 to 9.5], P = 0.011). In addition, grade 3 to 4 hematological toxicities were significantly reduced in the ATO group during consolidation. Hence, ATRA-ATO in both chemotherapy-replacing and -reducing settings in consolidation is not inferior to ATRA-chemotherapy (https://www.clinicaltrials.gov/, NCT01987297).


Asunto(s)
Protocolos de Quimioterapia Combinada Antineoplásica/administración & dosificación , Trióxido de Arsénico/administración & dosificación , Leucemia Promielocítica Aguda/tratamiento farmacológico , Tretinoina/administración & dosificación , Adulto , Anciano , Protocolos de Quimioterapia Combinada Antineoplásica/efectos adversos , Trióxido de Arsénico/efectos adversos , Quimioterapia de Consolidación/efectos adversos , Citarabina/administración & dosificación , Citarabina/efectos adversos , Supervivencia sin Enfermedad , Femenino , Humanos , Masculino , Persona de Mediana Edad , Inducción de Remisión , Resultado del Tratamiento , Tretinoina/efectos adversos
19.
Plant Dis ; 2024 Sep 05.
Artículo en Inglés | MEDLINE | ID: mdl-39235411

RESUMEN

Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

20.
Plant Dis ; 2024 Aug 08.
Artículo en Inglés | MEDLINE | ID: mdl-39115952

RESUMEN

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA