Integrative Proteomic Analysis Reveals the Cytoskeleton Regulation and Mitophagy Difference Between Ischemic Cardiomyopathy and Dilated Cardiomyopathy.

Ischemic cardiomyopathy (ICM) and dilated cardiomyopathy (DCM) are the two primary etiologies of end-stage heart failure. However, there remains a dearth of comprehensive understanding the global perspective and the dynamics of the proteome and phosphoproteome in ICM and DCM, which hinders the profound comprehension of pivotal biological characteristics as well as differences in signal transduction activation mechanisms between these two major types of heart failure. We conducted high-throughput quantification proteomics and phosphoproteomics analysis of clinical heart tissues with ICM or DCM, which provided us the system-wide molecular insights into pathogenesis of clinical heart failure in both ICM and DCM. Both protein and phosphorylation expression levels exhibit distinct separation between heart failure and normal control heart tissues, highlighting the prominent characteristics of ICM and DCM. By integrating with omics results, Western blots, phosphosite-specific mutation, chemical intervention, and immunofluorescence validation, we found a significant activation of the PRKACA-GSK3ß signaling pathway in ICM. This signaling pathway influenced remolding of the microtubule network and regulated the critical actin filaments in cardiac construction. Additionally, DCM exhibited significantly elevated mitochondria energy supply injury compared to ICM, which induced the ROCK1-vimentin signaling pathway activation and promoted mitophagy. Our study not only delineated the major distinguishing features between ICM and DCM but also revealed the crucial discrepancy in the mechanisms between ICM and DCM. This study facilitates a more profound comprehension of pathophysiologic heterogeneity between ICM and DCM and provides a novel perspective to assist in the discovery of potential therapeutic targets for different types of heart failure.

Design of a sorbitol-activated nitrogen metabolism-dependent regulatory system for redirection of carbon metabolism flow in Bacillus licheniformis.

Synthetic regulation of metabolic fluxes has emerged as a common strategy to improve the performance of microbial cell factories. The present regulatory toolboxes predominantly rely on the control and manipulation of carbon pathways. Nitrogen is an essential nutrient that plays a vital role in growth and metabolism. However, the availability of broadly applicable tools based on nitrogen pathways for metabolic regulation remains limited. In this work, we present a novel regulatory system that harnesses signals associated with nitrogen metabolism to redirect excess carbon flux in Bacillus licheniformis. By engineering the native transcription factor GlnR and incorporating a sorbitol-responsive element, we achieved a remarkable 99% inhibition of the expression of the green fluorescent protein reporter gene. Leveraging this system, we identified the optimal redirection point for the overflow carbon flux, resulting in a substantial 79.5% reduction in acetoin accumulation and a 2.6-fold increase in acetate production. This work highlight the significance of nitrogen metabolism in synthetic biology and its valuable contribution to metabolic engineering. Furthermore, our work paves the way for multidimensional metabolic regulation in future synthetic biology endeavors.

Real-world performance of indobufen versus aspirin after percutaneous coronary intervention: insights from the ASPIRATION registry.

BACKGROUND: Indobufen is widely used in patients with aspirin intolerance in East Asia. The OPTION trial launched by our cardiac center examined the performance of indobufen based dual antiplatelet therapy (DAPT) after percutaneous coronary intervention (PCI). However, the vast majority of patients with acute coronary syndrome (ACS) and aspirin intolerance were excluded. We aimed to explore this question in a real-world population. METHODS: Patients enrolled in the ASPIRATION registry were grouped according to the DAPT strategy that they received after PCI. The primary endpoints were major adverse cardiovascular and cerebrovascular events (MACCE) and Bleeding Academic Research Consortium (BARC) type 2, 3, or 5 bleeding. Propensity score matching (PSM) was adopted for confounder adjustment. RESULTS: A total of 7135 patients were reviewed. After one-year follow-up, the indobufen group was associated with the same risk of MACCE versus the aspirin group after PSM (6.5% vs. 6.5%, hazard ratio [HR] = 0.99, 95% confidence interval [CI] = 0.65 to 1.52, P = 0.978). However, BARC type 2, 3, or 5 bleeding was significantly reduced (3.0% vs. 11.9%, HR = 0.24, 95% CI = 0.15 to 0.40, P < 0.001). These results were generally consistent across different subgroups including aspirin intolerance, except that indobufen appeared to increase the risk of MACCE in patients with ACS. CONCLUSIONS: Indobufen shared the same risk of MACCE but a lower risk of bleeding after PCI versus aspirin from a real-world perspective. Due to the observational nature of the current analysis, future studies are still warranted to further evaluate the efficacy of indobufen based DAPT, especially in patients with ACS. TRIAL REGISTRATION: Chinese Clinical Trial Register ( https://www.chictr.org.cn ); Number: ChiCTR2300067274.

Pinacidil ameliorates cardiac microvascular ischemia-reperfusion injury by inhibiting chaperone-mediated autophagy of calreticulin.

Calcium overload is the key trigger in cardiac microvascular ischemia-reperfusion (I/R) injury, and calreticulin (CRT) is a calcium buffering protein located in the endoplasmic reticulum (ER). Additionally, the role of pinacidil, an antihypertensive drug, in protecting cardiac microcirculation against I/R injury has not been investigated. Hence, this study aimed to explore the benefits of pinacidil on cardiac microvascular I/R injury with a focus on endothelial calcium homeostasis and CRT signaling. Cardiac vascular perfusion and no-reflow area were assessed using FITC-lectin perfusion assay and Thioflavin-S staining. Endothelial calcium homeostasis, CRT-IP3Rs-MCU signaling expression, and apoptosis were assessed by real-time calcium signal reporter GCaMP8, western blotting, and fluorescence staining. Drug affinity-responsive target stability (DARTS) assay was adopted to detect proteins that directly bind to pinacidil. The present study found pinacidil treatment improved capillary density and perfusion, reduced no-reflow and infraction areas, and improved cardiac function and hemodynamics after I/R injury. These benefits were attributed to the ability of pinacidil to alleviate calcium overload and mitochondria-dependent apoptosis in cardiac microvascular endothelial cells (CMECs). Moreover, the DARTS assay showed that pinacidil directly binds to HSP90, through which it inhibits chaperone-mediated autophagy (CMA) degradation of CRT. CRT overexpression inhibited IP3Rs and MCU expression, reduced mitochondrial calcium inflow and mitochondrial injury, and suppressed endothelial apoptosis. Importantly, endothelial-specific overexpression of CRT shared similar benefits with pinacidil on cardiovascular protection against I/R injury. In conclusion, our data indicate that pinacidil attenuated microvascular I/R injury potentially through improving CRT degradation and endothelial calcium overload.

Nicorandil alleviates cardiac microvascular ferroptosis in diabetic cardiomyopathy: Role of the mitochondria-localized AMPK-Parkin-ACSL4 signaling pathway.

Mitochondria-associated ferroptosis exacerbates cardiac microvascular dysfunction in diabetic cardiomyopathy (DCM). Nicorandil, an ATP-sensitive K+ channel opener, protects against endothelial dysfunction, mitochondrial dysfunction, and DCM; however, its effects on ferroptosis and mitophagy remain unexplored. The present study aimed to assess the beneficial effects of nicorandil against endothelial ferroptosis in DCM and the underlying mechanisms. Cardiac microvascular perfusion was assessed using a lectin perfusion assay, while mitophagy was assessed via mt-Keima transfection and transmission electron microscopy. Ferroptosis was examined using mRNA sequencing, fluorescence staining, and western blotting. The mitochondrial localization of Parkin, ACSL4, and AMPK was determined via immunofluorescence staining. Following long-term diabetes, nicorandil treatment improved cardiac function and remodeling by alleviating cardiac microvascular injuries, as evidenced by the improved microvascular perfusion and structural integrity. mRNA-sequencing and biochemical analyses showed that ferroptosis occurred and Pink1/Parkin-dependent mitophagy was suppressed in cardiac microvascular endothelial cells after diabetes. Nicorandil treatment suppressed mitochondria-associated ferroptosis by promoting the Pink1/Parkin-dependent mitophagy. Moreover, nicorandil treatment increased the phosphorylation level of AMPKα1 and promoted its mitochondrial translocation, which further inhibited the mitochondrial translocation of ACSL4 via mitophagy and ultimately suppressed mitochondria-associated ferroptosis. Importantly, overexpression of mitochondria-localized AMPKα1 (mitoAα1) shared similar benefits with nicorandil on mitophagy, ferroptosis and cardiovascular protection against diabetic injury. In conclusion, the present study demonstrated the therapeutic effects of nicorandil against cardiac microvascular ferroptosis in DCM and revealed that the mitochondria-localized AMPK-Parkin-ACSL4 signaling pathway mediates mitochondria-associated ferroptosis and the development of cardiac microvascular dysfunction.

Insight into the Cold Adaptation Mechanism of an Aerobic Denitrifying Bacterium: Bacillus simplex H-b.

Psychrophilic bacteria with aerobic denitrification ability have promising potential for application in nitrogen-contaminated wastewater treatment, especially under cold conditions. A better understanding of the cold adaptation mechanism during aerobic denitrification would be beneficial for the practical application of this type of functional bacterium. In this study, Bacillus simplex H-b with good denitrification performance at 5°C was used to investigate the corresponding cold tolerance mechanism. Transcriptomics and nitrogen removal characterization experiments were conducted at different temperatures (5°C, 20°C, and 30°C). At low temperatures, more nitrogen was utilized for assimilation, accompanied by the accumulation of ATP and extracellular polymeric substances (EPS), rather than transforming inorganic nitrogen in the dissimilation pathway. In addition, the proportion of unsaturated fatty acids was higher in strains cultured at low temperatures. At the molecular level, the adjustment of membrane transport, synthesis of cofactors and vitamins, and transcriptional regulators might contribute to the survival of the strain under cold conditions. Moreover, nucleotide precursor synthesis, translation, and oxidative and temperature stress response mechanisms also enhanced the resistance of strain H-b to low temperatures. The results suggest that combining multiple regulatory mechanisms and synergistic adaptation to cold stress enabled the growth and relatively high nitrogen removal rate (27.22%) of strain H-b at 5°C. By clarifying the mechanism of regulation and cold resistance of strain H-b, a theoretical foundation for enhancing the application potential of this functional bacterium for nitrogen-contaminated wastewater treatment was provided. IMPORTANCE The newly isolated aerobic denitrifying bacterium Bacillus simplex H-b removed various forms of inorganic nitrogen (nitrate, nitrite, and ammonium) from wastewater, even when the temperature was as low as 5°C. Although this environmentally functional bacterium has been suggested as a promising candidate for nitrogen-contaminated water treatment at low temperatures, understanding its cold adaptation mechanism during aerobic denitrification is limited. In this study, the cold tolerance mechanism of this strain was comprehensively explained. Furthermore, a theoretical basis for the practical application of this type of functional bacterium for nitrogen removal in cold regions is provided. The study expands our understanding of the survival strategy of psychrophilic bacteria and hence supports their further utilization in wastewater treatment applications.

Pediococcus pentosaceus CECT 8330 protects DSS-induced colitis and regulates the intestinal microbiota and immune responses in mice.

BACKGROUND: Compelling evidences demonstrated that gut microbiota dysbiosis plays a critical role in the pathogenesis of inflammatory bowel diseases (IBD). Therapies for targeting the microbiota may provide alternative options for the treatment of IBD, such as probiotics. Here, we aimed to investigate the protective effect of a probiotic strain, Pediococcus pentosaceus (P. pentosaceus) CECT 8330, on dextran sulfate sodium (DSS)-induced colitis in mice. METHODS: C57BL/6 mice were administered phosphate-buffered saline (PBS) or P. pentosaceus CECT 8330 (5 × 108 CFU/day) once daily by gavage for 5 days prior to or 2 days after colitis induction by DSS. Weight, fecal conditions, colon length and histopathological changes were examined. ELISA and flow cytometry were applied to determine the cytokines and regulatory T cells (Treg) ratio. Western blot was used to examine the tight junction proteins (TJP) in colonic tissues. Fecal short-chain fatty acids (SCFAs) levels and microbiota composition were analyzed by targeted metabolomics and 16S rRNA gene sequencing, respectively. The Kyoto Encyclopedia of Genes and Genomes (KEGG) and Cluster of orthologous groups of proteins (COG) pathway analysis were used to predict the microbial functional profiles. RESULTS: P. pentosaceus CECT 8330 treatment protected DSS-induced colitis in mice as evidenced by reducing the weight loss, disease activity index (DAI) score, histological damage, and colon length shortening. P. pentosaceus CECT 8330 decreased the serum levels of proinflammatory cytokines (TNF-α, IL-1ß, and IL-6), and increased level of IL-10 in DSS treated mice. P. pentosaceus CECT 8330 upregulated the expression of ZO-1, Occludin and the ratio of Treg cells in colon tissue. P. pentosaceus CECT 8330 increased the fecal SCFAs level and relative abundances of several protective bacteria genera, including norank_f_Muribaculaceae, Lactobacillus, Bifidobacterium, and Dubosiella. Furthermore, the increased abundances of bacteria genera were positively correlated with IL-10 and SCFAs levels, and negatively associated with IL-6, IL-1ß, and TNF-α, respectively. The KEGG and COG pathway analysis revealed that P. pentosaceus CECT 8330 could partially recover the metabolic pathways altered by DSS. CONCLUSIONS: P. pentosaceus CECT 8330 administration protects the DSS-induced colitis and modulates the gut microbial composition and function, immunological profiles, and the gut barrier function. Therefore, P. pentosaceus CECT 8330 may serve as a promising probiotic to ameliorate intestinal inflammation.

Combined therapy with early initiation of infliximab following drainage of perianal fistulising Crohn's disease: a retrospective cohort study.

BACKGROUND: Recent studies have confirmed that combined surgery and anti-TNF therapy could improve outcomes in patients with perianal fistulising Crohn's disease (PFCD). However, the optimal timing for infliximab infusion after surgical intervention is uncertain. We aimed to determine the long-term efficacy of early initiation of infliximab following surgery among PFCD patients. METHODS: We performed a retrospective cohort study of PFCD patients who received combined infliximab and surgical treatment between 2010 and 2018 at a tertiary referral hospital. Patients were grouped according to the time interval between surgery and infliximab infusion, with < 6 weeks into early infliximab induction group and > 6 weeks into delayed infliximab induction group. The primary outcome was to compare surgical re-intervention between early and delayed infliximab induction groups. The secondary outcomes were fistula healing and predictors associated with these outcomes of early infliximab induction approach. RESULTS: One hundred and seventeen patients were included (73 in early infliximab induction, 44 in delayed infliximab induction). The median interval between surgery and infliximab initiation was 9.0 (IQR 5.5-17.0) days in early infliximab induction group and 188.0 (IQR 102.25-455.75) days in delayed infliximab induction group. After followed-up for a median of 36 months, 61.6% of patients in early infliximab induction group and 65.9% in delayed infliximab induction group attained fistula healing (p = 0.643). The cumulative re-intervention rate was 23%, 32%, 34% in early infliximab induction group and 16%, 25%, 25% in delayed infliximab induction group, at 1, 2, and 3 years respectively (p = 0.235). Presence of abscess at baseline (HR = 5.283; 95% CI, 1.61-17.335; p = 0.006) and infliximab maintenance therapy > 3 infusions (HR = 3.691; 95% CI, 1.233-11.051; p = 0.02) were associated with re-intervention in early infliximab induction group. Presence of abscess at baseline also negatively influenced fistula healing (HR = 3.429, 95% CI, 1.216-9.668; p = 0.02). CONCLUSION: Although no clear benefit was shown compared with delayed infliximab induction group, early initiation of infliximab after surgery could achieve promising results for PFCD patients. Before infliximab infusion, durable drainage is required for patients with concomitant abscess or prolonged infliximab maintenance therapy.

Engineering of Bacillus Promoters Based on Interacting Motifs between UP Elements and RNA Polymerase (RNAP) α-Subunit.

Bacillus genetics need more versatile promoters for gene circuit engineering. UP elements are widely distributed in noncoding regions and interact with the α-subunit of RNA polymerase (RNAP). They can be applied as a standard element for synthetic biology. Characterization of the binding motif between UP elements and RNAP may assist with rational and effective engineering. In this study, 11 Bacillus constitutive promoters were screened for strength in Bacillus licheniformis. The motif in UP elements from a strong native promoter, PLan, was characterized. The influence of specific sequences on RNAP binding and expression strength was investigated both in vitro and in vivo. It was found that sequences up to 50 base pairs upstream of the consensus motif significantly contributed to α-CTD (the alpha subunit carboxy-terminal domain) association. Meanwhile, two repeats of a proximal subsite were able to more strongly activate the expression (by 8.2-fold) through strengthening interactions between UP elements and RNAP. Based the above molecular basis, a synthetic UP element, UP5-2P, was constructed and applied to nine wild-type promoters. Fluorescence polarization results demonstrated that it had an apparent effect on promoter-α-CTD interactions, and elevated expression strength was observed for all the engineered promoters. The highest improved core promoter, Pacpp, was more strongly activated by 7.4-fold. This work thus develops a novel strategy for Bacillus promoter engineering.

Recombinant Human Arresten and Canstatin Inhibit Angiogenic Behaviors of HUVECs via Inhibiting the PI3K/Akt Signaling Pathway.

Angiogenetic inhibitors are crucial in tumor therapy, and endogenous angiogenesis inhibitors have attracted considerable attention due to their effectiveness, safety, and multi-targeting ability. Arresten and canstatin, which have anti-angiogenesis effects, are the c-terminal fragments of the α1 and α2 chains of type IV collagen, respectively. In this study, human arresten and canstatin were recombinantly expressed in Escherichia coli (E. coli), and their effects on the proliferation, migration and tube formation of human umbilical vein endothelial cells (HUVECs) were evaluated. Regarding the cell cycle distribution test and 5-ethynyl-2'-deoxyuridine (EdU) assays, arresten and canstatin could repress the proliferation of HUVECs at a range of concentrations. Transwell assay indicated that the migration of HUVECs was significantly decreased in the presence of arresten and canstatin, while tube formation assays suggested that the total tube length and junction number of HUVECs were significantly inhibited by these two proteins; moreover, they could also reduce the expression of vascular endothelial growth factor (VEGF) and the phosphorylation levels of PI3K and Akt, which indicated that the activation of the 3-kinase/serine/threonine-kinase (PI3K/Akt) signaling pathway was inhibited. These findings may have important implications for the soluble recombinant expression of human arresten and canstatin, and for the related therapy of cancer.

Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression.

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was "ACTTAGTTTAAGCAATAGACAAAGT", and this can be degenerated to "ACTTWGTTTAWSSNATAVACAAAGT" in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

Development and validation of an LC-MS/MS method for quantifying nine antimicrobials in human serum and its application to study the exposure of Chinese pregnant women to antimicrobials.

BACKGROUND: To study the prevalence of the exposure of pregnant women to antimicrobials, a sensitive and reliable liquid chromatography-tandem mass spectrometry (LC-MS/MS) method was developed and validated to determine nine antimicrobials, namely sulfadimidine, sulfapyridine, sulfadiazine, sulfathiazole, ofloxacin, ciprofloxacin, norfloxacin, tetracycline, and lincomycin, in human serum. METHODS: The sample preparation procedure included protein precipitation followed by a cleanup step with solid phase extraction (SPE). Separation was carried out using a CORTECS T3 column (100 × 2.1 mm, 2.7 µm) by gradient elution with a runtime of 8.0 min. Detection was performed on a triple quadruple tandem mass spectrometer with scheduled multiple reaction monitoring (sMRM) in positive ion scan mode. RESULTS: The calibration curves were linear over the concentration range of 0.5-50 ng/ml, and the limit of quantitation was between 0.01 and 0.2 ng/ml. For each level of quality control samples, the inter- and intra-assay precision values were less than 12.0%, and the accuracy ranged from 86.1% to 109.0%. No significant matrix effect or carryover was observed. The antimicrobials of interest were stable under all investigated conditions. The validated method was applied to analyze clinical samples from pregnant women in China, and 10 out of 500 samples showed the presence of antimicrobial residues. Moreover, compared with the time-resolved fluoro-immunoassay (TRFIA) method, the developed method showed greater sensitivity and specificity. CONCLUSION: This study provides a simple and rapid LC-MS/MS method for the simultaneous measurement of nine antimicrobials in serum samples, which could be a useful tool in clinical utilization.

Hesperidin Improves Colonic Motility in Loeramide-Induced Constipation Rat Model via 5-Hydroxytryptamine 4R/cAMP Signaling Pathway.

Fructus has motivation effect on gastrointestinal tract. Hesperidin is extracts of Fructus, and we attempted to prove its effects on improving the gastrointestinal transmission function and determine the possible mechanisms by a loperamide-induced slow transit constipation (STC) model. Constipation phenotypes were measured in rats with Lop-induced constipation after treatment with hesperidin. The amounts and water content of stool were significantly higher in the hesperidin-treated group than the loperamide-induced model group, whereas food intake was maintained at constant levels. Moreover, intestinal transit rate was increased in the treatment group of hesperidin. Histological alteration was detected by H&E staining, we found that the colon smooth muscle cells and neuron cells of the rats were increased, and the infiltration of inflammatory cells was decreased in the hesperidin-treated group compared with the loperamide-induced model group. 5-Hydroxytryptamine (5-HT) receptor4 fluorescence intensity and intracellular-free calcium ions in colon tissue were increased, and relative protein of cAMP/PKA pathway and p-cAMP response component-binding protein (CREB) pathway were upregulated in the hesperidin-treated group compared with the loperamide-induced model group. Further, SMCs from colon tissue of rats were cultured and identified. We found hesperidin could significantly promote tegaserod-induced increase of 5-HTR4 fluorescence intensity, intracellular calcium ions, relative protein of cAMP/PKA pathway and p-CREB pathway, and cell proliferation and inhibit GR113808-induced decrease of 5-HTR4 fluorescence intensity, 5-HTR4 pathway-related proteins (ADCY3, cAMP, PKA, and p-CREB), intracellular calcium ions, and cell proliferation. The analysis of our data suggested that hesperidin could obviously improve the gastrointestinal transmission function in loperamide-induced STC rat model via increasing the 5-HTR4 and intracellular-free calcium ions to enhance the expression of relative protein of cAMP/PKA pathway and p-CREB pathway. Hesperidin could be used in the treatment of STC, and our data not only provide experimental basis for the treatment of STC in hesperidin but also provides a theoretical reference for clinical treatment.

Comparative transcriptomics and transcriptional regulation analysis of enhanced laccase production induced by co-culture of Pleurotus eryngii var. ferulae with Rhodotorula mucilaginosa.

The co-culturing of Pleurotus eryngii var. ferulae and Rhodotorula mucilaginosa was confirmed in our previous studies to be an efficient strategy to improve laccase production by submerged fermentation. To determine the possible regulation principles underlying this behaviour, comparative transcriptomic analysis was performed on P. eryngii var. ferulae to investigate the differential expression of genes in co-culture. RNA-seq analysis showed that genes concerning xenobiotic biodegradation and expenditure of energy were upregulated. However, genes related to oxidative stress were downregulated. In addition, the transcription levels of laccase isoenzymes were not consistent in the co-culture system: 3 laccase genes (lacc1, lacc2, lacc12) were upregulated, and 3 laccase genes (lacc4, lacc6, lacc9) were downregulated. The enhancement in laccase activity can be due to upregulation of a laccase heterodimer encoded by the genes lacc2 and ssPOXA3a (or ssPOXA3b), whose expression levels were increased by 459% and 769% (or 585% for ssPOXA3b) compared with those of a control, respectively. ß-Carotene produced by R. mucilaginosa upregulated the transcription of lacc2 only. Combining these results with an analysis of cis-acting responsive elements indicated that four transcription factors (TFs) had potential regulatory effects on the transcription of laccase genes. It was supposed that TFa regulated lacc transcription by binding with methyl jasmonate and heat shock response elements. The expression of TFb, TFc, and TFd was regulated by ß-carotene. However, ß-carotene had no effect on TFa expression. These results provide a possible mechanism for the regulation of laccase gene transcription in the co-culture system and are also beneficial for the future intensification of fungal laccase production.

Construction of a novel sugar alcohol-inducible expression system in Bacillus licheniformis.

Bacillus licheniformis is an important industrial microorganism that can utilize a wide range of biomass. However, the lack of expression elements in B. licheniformis, especially regulated promoters, significantly restricts its applications. In this study, two promoters involved in the sugar alcohol uptake pathway, PmtlA and PmtlR, were characterized and developed as regulated promoters for expression. The results showed that mannitol, mannose, sorbitol, sorbose, and arabinose can act as inducers to activate expression from PmtlA at different levels. The induction by sorbitol was the strongest, and the optimal induction conditions were 15 g/L sorbitol during mid-logarithmic growth at 28 °C. In this work, the palindrome-like sequence 'TTGTCA-cacggctcc-TGCCAA' in PmtlA was identified as the binding site of the MtlR protein. This study helps to enrich the known inducible expression systems in B. licheniformis.

Analysis of Risk Factors for Anorectal Stenosis of Perianal Fistulizing Crohn's Disease.

BACKGROUND To analyze the risk factors of anorectal stenosis associated with perianal fistulizing Crohn's disease (PFCD). MATERIAL AND METHODS We retrospectively analyzed 139 cases of PFCD from January 2010 to December 2017 at the Affiliated Hospital of Nanjing University of Chinese Medicine. They were divided into 2 groups according to whether anorectal stenosis occurred. The possible factors associated with anorectal stenosis of PFCD were selected based on the literature review and clinical observations. Univariate analysis was performed to screen the risk factors of anorectal stenosis, and multivariate logistic regression analysis was performed on these risk factors and factors that were clinically considered to be potentially influential, to screen out the independent risk factors of anorectal stenosis. RESULTS We found that 44 cases (31.7%) of PFCD were associated with anorectal stenosis. Univariate analysis showed that CDAI, lesion location, and age at diagnosis were risk factors for anorectal stenosis of PFCD. Logistic regression analysis showed that mild (fair to good) (OR=3.833, 95% CI: 1.123~13.080) to moderate (poor) (OR=7.345, 95% CI: 1.964~27.474) CDAI and age at diagnosis (OR=1.067, 95% CI: 1.013~1.124) were independent risk factors for anorectal stenosis of PFCD. CONCLUSIONS Higher CDAI and older age at diagnosis appear to confer higher risk of anorectal stenosis associated with PFCD.

Simultaneous quantitation of four androgens and 17-hydroxyprogesterone in polycystic ovarian syndrome patients by LC-MS/MS.

BACKGROUND: Due to the low concentration of androgens in women and the limitation of immunoassays, it remains a challenge to accurately determine the levels of serum androgens in polycystic ovary syndrome (PCOS) patients for clinical laboratories. In this report, a liquid chromatography-tandem mass spectrometry (LC-MS/MS) method was developed and validated for simultaneous quantitation of testosterone (T), androstenedione (A4), dehydroepiandrosterone sulfate (DHEAS), dihydrotestosterone (DHT), and 17-hydroxyprogesterone (17-OHP) that are associated with PCOS. METHODS: The serum samples were processed by protein precipitation and solid phase extraction before analysis with the in-house developed LC-MS/MS. The chromatographic separation was achieved with a C18 column, using a linear gradient elution with two mobile phases: 0.02% formic acid in water (phase A) and 0.1% formic acid in methanol (phase B). The separated analytes were detected by positive or negative electrospray ionization mode under multiple reaction monitoring (MRM). RESULTS: The assay for all the five analytes was linear, stable, with imprecision less than 9% and recoveries within ±10%. The lower limits of quantification were 0.05, 0.05, 5, 0.025, and 0.025 ng/mL for T, A4, DHEAS, DHT, and 17-OHP, respectively. In the receiver operating characteristic curve (ROC) analyses with the PCOS (n = 63) and healthy (n = 161) subjects, the AUC of the four-androgen combined was greater than that of any single androgen tested in PCOS diagnosis. CONCLUSIONS: The LC-MS/MS method for the four androgens and 17-OHP showed good performance for clinical implementation. More importantly, simultaneous quantitation of the four androgens provided better diagnostic power for PCOS.

Retinol and α-tocopherol in pregnancy: Establishment of reference intervals and associations with CBC.

Profound physiological changes during pregnancy may affect the requirement of retinol and tocopherol, which are essential micronutrients for the maintenance of maternal health and foetal development. However, the current reference intervals (RIs) of retinol and tocopherol are based on non-pregnant population. In the present study, a liquid chromatography-tandem mass spectrometry quantitation method for serum retinol and α-tocopherol was established and validated. In addition, we established trimester-specific RIs of retinol and α-tocopherol using the data from paired screening test for 31,301 outpatients who participated in the prenatal vitamins A/E evaluation program at our hospital using the Hoffmann method, which is a simple indirect RI estimation method that does not require the recruitment of healthy subjects. Further, to explore the associations between the levels of retinol and α-tocopherol and the parameters of complete blood count (CBC), the results of retinol, α-tocopherol, and CBC of 1,977 pregnant outpatients in the third trimester were analysed. The testing interval between the levels of vitamins and CBC was no more than 7 days. Although no significant changes were noticed in the levels of retinol, the α-tocopherol levels continuously increased with normal physiological changes throughout pregnancy. Lower retinol levels were associated with the higher incidence of anaemia, whereas higher levels of retinol and lower levels of α-tocopherol were associated with higher platelet count.

Unraveling the specific regulation of the shikimate pathway for tyrosine accumulation in Bacillus licheniformis.

L-Tyrosine serves as a common precursor for multiple valuable secondary metabolites. Synthesis of this aromatic amino acid in Bacillus licheniformis occurs via the shikimate pathway, but the underlying mechanisms involving metabolic regulation remain unclear. In this work, improved L-tyrosine accumulation was achieved in B. licheniformis via co-overexpression of aroGfbr and tyrAfbr from Escherichia coli to yield strain 45A12, and the L-tyrosine titer increased to 1005 mg/L with controlled glucose feeding. Quantitative RT-PCR results indicated that aroA, encoding DAHP synthase, and aroK, encoding shikimate kinase, were feedback-repressed by the end product L-tyrosine in the modified strain. Therefore, the native aroK was first expressed with multiple copies to yield strain 45A13, which could accumulate 1201 mg/L L-tyrosine. Compared with strain 45A12, the expression of aroB and aroF in strain 45A13 was upregulated by 21% and 27%, respectively, which may also have resulted in the improvement of L-tyrosine production. Furthermore, supplementation with 5 g/L shikimate enhanced the L-tyrosine titers of 45A12 and 45A13 by 29.1% and 24.0%, respectively. However, the yield of L-tyrosine per unit of shikimate decreased from 0.365 to 0.198 mol/mol after aroK overexpression in strain 45A12, which suggested that the gene product was also involved in uncharacterized pathways. This study provides a good starting point for further modification to achieve industrial-scale production of L-tyrosine using B. licheniformis, a generally recognized as safe workhorse.

Transcriptional Changes in the Xylose Operon in Bacillus licheniformis and Their Use in Fermentation Optimization.

The xylose operon is an efficient biological element used for the regulation of gene expression in Bacillus licheniformis. Although the mechanism underlying the xylose-mediated regulation of this operon has been elucidated, the transcriptional changes that occur under various fermentation conditions remain unclear. In this study, the effects of different conditions on xylose operon expression were investigated. Significant upregulation was observed during the transition from the logarithmic phase to the stationary phase (2.5-fold, n = 3, p < 0.01). Glucose suppressed transcription over 168-fold (n = 3, p < 0.01). Meanwhile, the inhibitory effect of glucose hardly strengthened at concentrations from 20 to 180 g/L. Furthermore, the transcription of the xylose operon increased at elevated temperatures (25-42 °C) and was optimal at a neutral pH (pH 6.5-7.0). Based on these findings, relevant fermentation strategies (delaying the induction time, using dextrin as a carbon source, increasing the fermentation temperature, and maintaining a neutral pH) were proposed. Subsequently, these strategies were validated through the use of maltogenic amylase as a reporter protein, as an 8-fold (n = 3, p < 0.01) increase in recombinant enzyme activity compared to that under unoptimized conditions was observed. This work contributes to the development of fermentation optimization and furthers the use of the xylose operon as an efficient expression element.