Single-cell exome sequencing and monoclonal evolution of a JAK2-negative myeloproliferative neoplasm.

Tumor heterogeneity presents a challenge for inferring clonal evolution and driver gene identification. Here, we describe a method for analyzing the cancer genome at a single-cell nucleotide level. To perform our analyses, we first devised and validated a high-throughput whole-genome single-cell sequencing method using two lymphoblastoid cell line single cells. We then carried out whole-exome single-cell sequencing of 90 cells from a JAK2-negative myeloproliferative neoplasm patient. The sequencing data from 58 cells passed our quality control criteria, and these data indicated that this neoplasm represented a monoclonal evolution. We further identified essential thrombocythemia (ET)-related candidate mutations such as SESN2 and NTRK1, which may be involved in neoplasm progression. This pilot study allowed the initial characterization of the disease-related genetic architecture at the single-cell nucleotide level. Further, we established a single-cell sequencing method that opens the way for detailed analyses of a variety of tumor types, including those with high genetic complex between patients.

CASTpFold: Computed Atlas of Surface Topography of the universe of protein Folds.

Geometric and topological properties of protein structures, including surface pockets, interior cavities and cross channels, are of fundamental importance for proteins to carry out their functions. Computed Atlas of Surface Topography of proteins (CASTp) is a widely used web server for locating, delineating, and measuring these geometric and topological properties of protein structures. Recent developments in AI-based protein structure prediction such as AlphaFold2 (AF2) have significantly expanded our knowledge on protein structures. Here we present CASTpFold, a continuation of CASTp that provides accurate and comprehensive identifications and quantifications of protein topography. It now provides (i) results on an expanded database of proteins, including the Protein Data Bank (PDB) and non-singleton representative structures of AlphaFold2 structures, covering 183 million AF2 structures; (ii) functional pockets prediction with corresponding Gene Ontology (GO) terms or Enzyme Commission (EC) numbers for AF2-predicted structures and (iii) pocket similarity search function for surface and protein-protein interface pockets. The CASTpFold web server is freely accessible at https://cfold.bme.uic.edu/castpfold/.

A non-pheromone GPCR is essential for meiosis and ascosporogenesis in the wheat scab fungus.

Meiosis is essential for generating genetic diversity and sexual spores, but the regulation of meiosis and ascosporogenesis is not clear in filamentous fungi, in which dikaryotic and diploid cells formed inside fruiting bodies are not free living and independent of pheromones or pheromone receptors. In this study, Gia1, a non-pheromone GPCR (G protein-coupled receptor) with sexual-specific expression in Fusarium graminearum, is found to be essential for ascosporogenesis. The gia1 mutant was normal in perithecium development, crozier formation, and karyogamy but failed to undergo meiosis, which could be partially rescued by a dominant active mutation in GPA1 and activation of the Gpmk1 pathway. GIA1 orthologs have conserved functions in regulating meiosis and ascosporogenesis in Sordariomycetes. GIA1 has a paralog, GIP1, in F. graminearum and other Hypocreales species which is essential for perithecium formation. GIP1 differed from GIA1 in expression profiles and downstream signaling during sexual reproduction. Whereas the C-terminal tail and IR3 were important for intracellular signaling, the N-terminal region and EL3 of Gia1 were responsible for recognizing its ligand, which is likely a protein enriched in developing perithecia, particularly in the gia1 mutant. Taken together, these results showed that GIA1 encodes a non-pheromone GPCR that regulates the entry into meiosis and ascosporogenesis via the downstream Gpmk1 MAP kinase pathway in F. graminearum and other filamentous ascomycetes.

Structure-based pathogenicity relationship identifier for predicting effects of single missense variants and discovery of higher-order cancer susceptibility clusters of mutations.

We report the structure-based pathogenicity relationship identifier (SPRI), a novel computational tool for accurate evaluation of pathological effects of missense single mutations and prediction of higher-order spatially organized units of mutational clusters. SPRI can effectively extract properties determining pathogenicity encoded in protein structures, and can identify deleterious missense mutations of germ line origin associated with Mendelian diseases, as well as mutations of somatic origin associated with cancer drivers. It compares favorably to other methods in predicting deleterious mutations. Furthermore, SPRI can discover spatially organized pathogenic higher-order spatial clusters (patHOS) of deleterious mutations, including those of low recurrence, and can be used for discovery of candidate cancer driver genes and driver mutations. We further demonstrate that SPRI can take advantage of AlphaFold2 predicted structures and can be deployed for saturation mutation analysis of the whole human proteome.

Identification of Blood Biomarkers in Ischemic Stroke by Integrated Analysis of Metabolomics and Proteomics.

We aimed to uncover the pathological mechanism of ischemic stroke (IS) using a combined analysis of untargeted metabolomics and proteomics. The serum samples from a discovery set of 44 IS patients and 44 matched controls were analyzed using a specific detection method. The same method was then used to validate metabolites and proteins in the two validation sets: one with 30 IS patients and 30 matched controls, and the other with 50 IS patients and 50 matched controls. A total of 105 and 221 differentially expressed metabolites or proteins were identified, and the association between the two omics was determined in the discovery set. Enrichment analysis of the top 25 metabolites and 25 proteins in the two-way orthogonal partial least-squares with discriminant analysis, which was employed to identify highly correlated biomarkers, highlighted 15 pathways relevant to the pathological process. One metabolite and seven proteins exhibited differences between groups in the validation set. The binary logistic regression model, which included metabolite 2-hydroxyhippuric acid and proteins APOM_O95445, MASP2_O00187, and PRTN3_D6CHE9, achieved an area under the curve of 0.985 (95% CI: 0.966-1) in the discovery set. This study elucidated alterations and potential coregulatory influences of metabolites and proteins in the blood of IS patients.

A facile Immunoregulatory Constructional Design by Proanthocyanidin Optimizing Directional Chitosan Microchannel.

Improving the interconnected structure and bioregulatory function of natural chitosan is beneficial for optimizing its performance in bone regeneration. Here, a facile immunoregulatory constructional design is proposed for developing instructive chitosan by directional freezing and alkaline salting out. The molecular dynamics simulation confirmed the assembly kinetics and structural features of various polyphenols and chitosan molecules. Along with the in vitro anti-inflammatory, antioxidative, promoting bone mesenchymal stem cell (BMSC) adhesion and proliferation performance, proanthocyanidin optimizing chitosan (ChiO) scaffold presented an optimal immunoregulatory structure with the directional microchannel. Transcriptome analysis in vitro further revealed the cytoskeleton- and immune-regulation effect of ChiO are the key mechanism of action on BMSC. The rabbit cranial defect model (Φ = 10 mm) after 12 weeks of implantation confirmed the significantly enhanced bone reconstitution. This facile immunoregulatory directional microchannel design provides effective guidance for developing inducible chitosan scaffolds.

Tungstate Intercalated NiFe Layered Double Hydroxide Enables Long-Term Alkaline Seawater Oxidation.

Renewable electricity-driven seawater splitting presents a green, effective, and promising strategy for building hydrogen (H2)-based energy systems (e.g., storing wind power as H2), especially in many coastal cities. The abundance of Cl- in seawater, however, will cause severe corrosion of anode catalyst during the seawater electrolysis, and thus affect the long-term stability of the catalyst. Herein, seawater oxidation performances of NiFe layered double hydroxides (LDH), a classic oxygen (O2) evolution material, can be boosted by employing tungstate (WO4 2-) as the intercalated guest. Notably, insertion of WO4 2- to LDH layers upgrades the reaction kinetics and selectivity, attaining higher current densities with ≈100% O2 generation efficiency in alkaline seawater. Moreover, after a 350 h test at 1000 mA cm-2, only trace active chlorine can be detected in the electrolyte. Additionally, O2 evolution follows lattice oxygen mechanism on NiFe LDH with intercalated WO4 2-.

Predictive, preventive, and personalized medicine in breast cancer: targeting the PI3K pathway.

Breast cancer (BC) is a multifaceted disease characterized by distinct molecular subtypes and varying responses to treatment. In BC, the phosphatidylinositol 3-kinase (PI3K) pathway has emerged as a crucial contributor to the development, advancement, and resistance to treatment. This review article explores the implications of the PI3K pathway in predictive, preventive, and personalized medicine for BC. It emphasizes the identification of predictive biomarkers, such as PIK3CA mutations, and the utility of molecular profiling in guiding treatment decisions. The review also discusses the potential of targeting the PI3K pathway for preventive strategies and the customization of therapy based on tumor stage, molecular subtypes, and genetic alterations. Overcoming resistance to PI3K inhibitors and exploring combination therapies are addressed as important considerations. While this field holds promise in improving patient outcomes, further research and clinical trials are needed to validate these approaches and translate them into clinical practice.

High positive predictive value of CNVs detected by clinical exome sequencing in suspected genetic diseases.

BACKGROUND: Genetic disorders often manifest as abnormal fetal or childhood development. Copy number variations (CNVs) represent a significant genetic mechanism underlying such disorders. Despite their importance, the effectiveness of clinical exome sequencing (CES) in detecting CNVs, particularly small ones, remains incompletely understood. We aimed to evaluate the detection of both large and small CNVs using CES in a substantial clinical cohort, including parent-offspring trios and proband only analysis. METHODS: We conducted a retrospective analysis of CES data from 2428 families, collected from 2018 to 2021. Detected CNV were categorized as large or small, and various validation techniques including chromosome microarray (CMA), Multiplex ligation-dependent probe amplification assay (MLPA), and/or PCR-based methods, were employed for cross-validation. RESULTS: Our CNV discovery pipeline identified 171 CNV events in 154 cases, resulting in an overall detection rate of 6.3%. Validation was performed on 113 CNVs from 103 cases to assess CES reliability. The overall concordance rate between CES and other validation methods was 88.49% (100/113). Specifically, CES demonstrated complete consistency in detecting large CNV. However, for small CNVs, consistency rates were 81.08% (30/37) for deletions and 73.91% (17/23) for duplications. CONCLUSION: CES demonstrated high sensitivity and reliability in CNV detection. It emerges as an economical and dependable option for the clinical CNV detection in cases of developmental abnormalities, especially fetal structural abnormalities.

Carbon fluxes of China's coastal wetlands and impacts of reclamation and restoration.

Coastal wetlands play an important role in regulating atmospheric carbon dioxide (CO2) concentrations and contribute significantly to climate change mitigation. However, climate change, reclamation, and restoration have been causing substantial changes in coastal wetland areas and carbon exchange in China during recent decades. Here we compiled a carbon flux database consisting of 15 coastal wetland sites to assess the magnitude, patterns, and drivers of carbon fluxes and to compare fluxes among contrasting natural, disturbed, and restored wetlands. The natural coastal wetlands have the average net ecosystem exchange of CO2 (NEE) of -577 g C m-2 year-1, with -821 g C m-2 year-1 for mangrove forests and -430 g C m-2 year-1 for salt marshes. There are pronounced latitudinal patterns for carbon dioxide exchange of natural coastal wetlands: NEE increased whereas gross primary production (GPP) and respiration of ecosystem decreased with increasing latitude. Distinct environmental factors drive annual variations of GPP between mangroves and salt marshes; temperature was the dominant controlling factor in salt marshes, while temperature, precipitation, and solar radiation were co-dominant in mangroves. Meanwhile, both anthropogenic reclamation and restoration had substantial effects on coastal wetland carbon fluxes, and the effect of the anthropogenic perturbation in mangroves was more extensive than that in salt marshes. Furthermore, from 1980 to 2020, anthropogenic reclamation of China's coastal wetlands caused a carbon loss of ~3720 Gg C, while the mangrove restoration project during the period of 2021-2025 may switch restored coastal wetlands from a carbon source to carbon sink with a net carbon gain of 73 Gg C. The comparison of carbon fluxes among these coastal wetlands can improve our understanding of how anthropogenic perturbation can affect the potentials of coastal blue carbon in China, which has implications for informing conservation and restoration strategies and efforts of coastal wetlands.

Identification of four novel large deletions and complex variants in the α-globin locus in Chinese population.

BACKGROUND: At present, the methods generally used to detect α-thalassemia mutations are confined to detecting common mutations, which may lead to misdiagnosis or missed diagnosis. The single-molecule real-time (SMRT) sequencing enables long-read single-molecule sequencing with high detection accuracy, and long-length DNA chain reads in high-fidelity read mode. This study aimed to identify novel large deletions and complex variants in the α-globin locus in Chinese population. METHODS: We used SMRT sequencing to detect rare and complex variants in the α-globin locus in four individuals whose hematological data indicated microcytic hypochromic anemia. However, the conventional thalassemia detection result was negative. Multiplex ligation-dependent probe amplification and droplet digital polymerase chain reaction were used to confirm SMRT sequencing results. RESULTS: Four novel large deletions were observed ranging from 23 to 81 kb in the α-globin locus. One patient also had a duplication of upstream of HBZ in the deletional region, while another, with a 27.31-kb deletion on chromosome 16 (hg 38), had abnormal hemoglobin Siriraj (Hb Siriraj). CONCLUSION: We first identified the four novel deletions in the α-globin locus using SMRT sequencing. Considering that the conventional methods might lead to misdiagnosis or missed diagnosis, SMRT sequencing proved to be an excellent method to discover rare and complex variants in thalassemia, especially in prenatal diagnosis.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Hypoxia-induced ZEB1 promotes cervical cancer immune evasion by strengthening the CD47-SIRPα axis.

BACKGROUND: The dynamic interaction between cancer cells and tumour-associated macrophages (TAMs) in the hypoxic tumour microenvironment (TME) is an active barrier to the effector arm of the antitumour immune response. Cancer-secreted exosomes are emerging mediators of this cancer-stromal cross-talk in the TME; however, the mechanisms underlying this interaction remain unclear. METHODS: Exosomes were isolated with ExoQuick exosome precipitation solution. The polarizing effect of TAMs was evaluated by flow cytometry, western blot analysis, immunofluorescence staining and in vitro phagocytosis assays. Clinical cervical cancer specimens and an in vivo xenograft model were also employed. RESULTS: Our previous study showed that hypoxia increased the expression of ZEB1 in cervical squamous cell carcinoma (CSCC) cells, which resulted in increased infiltration of TAMs. Here, we found that hypoxia-induced ZEB1 expression is closely correlated with CD47-SIRPα axis activity in CSCC, which enables cancer cells to evade phagocytosis by macrophages and promotes tumour progression. ZEB1 was found to directly activate the transcription of the CD47 gene in hypoxic CSCC cells. We further showed that endogenous ZEB1 was characteristically enriched in hypoxic CSCC cell-derived exosomes and transferred into macrophages via these exosomes to promote SIRPα+ TAM polarization. Intriguingly, exosomal ZEB1 retained transcriptional activity and reprogrammed SIRPα+ TAMs via activation of the STAT3 signalling pathway in vitro and in vivo. STAT3 inhibition reduced the polarizing effect induced by exosomal ZEB1. Knockdown of ZEB1 increased the phagocytosis of CSCC cells by macrophages via decreasing CD47 and SIRPα expression. CONCLUSIONS: Our results suggest that hypoxia-induced ZEB1 promotes immune evasion in CSCC by strengthening the CD47-SIRPα axis. ZEB1-targeted therapy in combination with CD47-SIRPα checkpoint immunotherapy may improve the outcomes of CSCC patients in part by disinhibiting innate immunity.

Serum PRO-C3 is useful for risk prediction and fibrosis assessment in MAFLD with chronic kidney disease in an Asian cohort.

BACKGROUND: Metabolic dysfunction-associated fatty liver disease (MAFLD) is an emerging risk factor for chronic kidney disease (CKD). N-terminal propeptide of collagen type 3 (PRO-C3) is a biomarker of advanced fibrosis in MAFLD and PRO-C3 may be involved in renal fibrosis. We aimed to use PRO-C3 measurements to generate a new algorithmic score to test the prediction of MAFLD with chronic kidney disease (MAFLD-CKD). METHODS: A derivation and independent validation cohort of 750 and 129 Asian patients with biopsy-confirmed MAFLD were included. Serum PRO-C3 concentration was measured and regression analyses were performed to examine associations with MAFLD-CKD. A derivative algorithm for MAFLD-CKD risk prediction was evaluated with receiver operator characteristic (ROC) curve analysis. RESULTS: The study included two Asian cohorts (n = 180 with MAFLD-CKD; mean-eGFR: 94.93 mL/min/1.73 m2; median-urinary albumin-to-creatinine ratio: 6.58 mg/mmol). PRO-C3 was associated with the severity of MAFLD-CKD and independently associated with MAFLD-CKD (adjusted odds ratio = 1.16, 95% confidence interval [CI]: 1.08-1.23, p < .001). A new non-invasive score (termed PERIOD) including PRO-C3 efficiently predicted MAFLD-CKD (AUROC = .842, 95% CI: .805-.875). Accuracy, specificity and negative predictive values were 80.2%, 85.1% and 88.4%, respectively. In the validation cohort, the PERIOD score had good diagnostic performance (AUROC = .807, 95% CI: .691-.893) with similar results in all patient subgroups. In the MAFLD-CKD subgroup, the accuracy for identifying advanced fibrosis was further improved by combining the PRO-C3-based ADAPT with the Agile 3+ scores (AUROC = .90, 95% CI: .836-.964). CONCLUSIONS: The PERIOD score is helpful for accurately predicting the risk of MAFLD-CKD. PRO-C3 can also be used to assess liver fibrosis in people with MAFLD-CKD.

Association of Cardiovascular Health With Risk of Incident Depression and Anxiety.

OBJECTIVE: To investigate the association between cardiovascular health (CVH), defined by the American Heart Association's Life's Essential 8 (LE8) score, and incident depression and anxiety. DESIGN: A prospective cohort study using data from UK Biobank. SETTING: Participants were enrolled from March 2006 to October 2010. PARTICIPANTS: Participants without cardiovascular diseases and common mental disorders at baseline and having complete data on metrics of LE8 were included. MEASUREMENTS: CVH was assessed by LE8 score including eight components. The overall CVH was categorized as low (LE8 score <50), moderate (50≤ LE8 score <80), and high (LE8 score ≥80). RESULTS: We included 115,855 participants (mean age: 55.7 years; female: 52.6%). During a median follow-up of 12.4 years, 3,194 (2.8%) and 4,005 (3.5%) participants had incident depression and anxiety, respectively. Compared with participants having low CVH, those having moderate and high CVH had 37% (HR = 0.63, 95% CI: 0.57-0.70) and 52% (HR = 0.48, 95% CI: 0.41-0.55) lower risk of incident depression. Similarly, moderate and high CVH were related to a lower risk of incident anxiety (HR = 0.81, 95% CI: 0.73-0.89 and HR = 0.68, 95% CI: 0.60-0.78). Restricted cubic spline showed that LE8 score was inversely related to incident depression and anxiety in a linear manner, and the risk of incident depression and anxiety decreased by 17% (HR = 0.83, 95% CI: 0.80-0.85) and 10% (HR = 0.90, 95% CI: 0.88-0.92) for 10-point increment in LE8 score, respectively. CONCLUSIONS: Higher CVH, evaluated by LE8 score, is strongly associated with a lower risk of incident depression and anxiety, suggesting the significance of optimizing CVH by adopting LE8.

Toward Low-Carbon Rice Production in China: Historical Changes, Driving Factors, and Mitigation Potential.

Under the "Double Carbon" target, the development of low-carbon agriculture requires a holistic comprehension of spatially and temporally explicit greenhouse gas (GHG) emissions associated with agricultural products. However, the lack of systematic evaluation at a fine scale presents considerable challenges in guiding localized strategies for mitigating GHG emissions from crop production. Here, we analyzed the county-level carbon footprint (CF) of China's rice production from 2007 to 2018 by coupling life cycle assessment and the DNDC model. Results revealed a significant annual increase of 74.3 kg CO2-eq ha-1 in the average farm-based CF (FCF), while it remained stable for the product-based CF (PCF). The CF exhibited considerable variations among counties, ranging from 2324 to 20,768 kg CO2-eq ha-1 for FCF and from 0.36 to 3.81 kg CO2-eq kg-1 for PCF in 2018. The spatiotemporal heterogeneities of FCF were predominantly influenced by field CH4 emissions, followed by diesel consumption and soil organic carbon sequestration. Scenario analysis elucidates that the national total GHG emissions from rice production could be significantly reduced through optimized irrigation (48.5%) and straw-based biogas production (18.0%). Moreover, integrating additional strategies (e.g., advanced crop management, optimized fertilization, and biodiesel application) could amplify the overall emission reduction to 76.7% while concurrently boosting the rice yield by 11.8%. Our county-level research provides valuable insights for the formulation of targeted GHG mitigation policies in rice production, thereby advancing the pursuit of carbon-neutral agricultural practices.

New Insights into Aggregation Behaviors of the UV-Irradiated Dissolved Biochars (DBioCs) in Aqueous Environments: Effects of Water Chemistries and Variation in the Hamaker Constant.

The aggregation behavior of ubiquitous dissolved black carbon (DBC) largely affects the fate and transport of its own contaminants and the attached contaminants. However, the photoaging processes and resulting effects on its colloidal stability remain yet unknown. Herein, dissolved biochars (DBioCs) were extracted from common wheat straw biochar as a proxy for an anthropogenic DBC. The influences of UV radiation on their aggregation kinetics were systematically investigated under various water chemistries (pH, electrolytes, and protein). The environmental stability of the DBioCs before and after radiation was further verified in two natural water samples. Hamaker constants of pristine and photoaged DBioCs were derived according to Derjaguin-Landau-Verwey-Overbeek (DLVO) prediction, and its attenuation (3.19 ± 0.15 × 10-21 J to 1.55 ± 0.07 × 10-21 J after 7 days of radiation) was described with decay kinetic models. Pearson correlation analysis revealed that the surface properties and aggregation behaviors of DBioCs were significantly correlated with radiation time (p < 0.05), indicating its profound effects. Based on characterization and experimental results, we proposed a three-stage mechanism (contended by photodecarboxylation, photo-oxidation, and mineral exposure) that DBioCs might experience under UV radiation. These findings would provide an important reference for potential phototransformation processes and relevant behavioral changes that DBC may encounter.

RNF213 loss-of-function promotes pathological angiogenesis in moyamoya disease via the Hippo pathway.

Moyamoya disease is an uncommon cerebrovascular disorder characterized by steno-occlusive changes in the circle of Willis and abnormal vascular network development. Ring finger protein 213 (RNF213) has been identified as an important susceptibility gene for Asian patients, but researchers have not completely elucidated whether RNF213 mutations affect the pathogenesis of moyamoya disease. Using donor superficial temporal artery samples, whole-genome sequencing was performed to identify RNF213 mutation types in patients with moyamoya disease, and histopathology was performed to compare morphological differences between patients with moyamoya disease and intracranial aneurysm. The vascular phenotype of RNF213-deficient mice and zebrafish was explored in vivo, and RNF213 knockdown in human brain microvascular endothelial cells was employed to analyse cell proliferation, migration and tube formation abilities in vitro. After bioinformatics analysis of both cell and bulk RNA-seq data, potential signalling pathways were measured in RNF213-knockdown or RNF213-knockout endothelial cells. We found that patients with moyamoya disease carried pathogenic mutations of RNF213 that were positively associated with moyamoya disease histopathology. RNF213 deletion exacerbated pathological angiogenesis in the cortex and retina. Reduced RNF213 expression led to increased endothelial cell proliferation, migration and tube formation. Endothelial knockdown of RNF213 activated the Hippo pathway effector Yes-associated protein (YAP)/tafazzin (TAZ) and promoted the overexpression of the downstream effector VEGFR2. Additionally, inhibition of YAP/TAZ resulted in altered cellular VEGFR2 distribution due to defects in trafficking from the Golgi apparatus to the plasma membrane and reversed RNF213 knockdown-induced angiogenesis. All these key molecules were validated in ECs isolated from RNF213-deficient animals. Our findings may suggest that loss-of-function of RNF213 mediates the pathogenesis of moyamoya disease via the Hippo pathway.

Experimental study on the biomechanical stability of complex acetabular fractures in the quadrilateral area: application of a dynamic anterior titanium-plate screw system.

BACKGROUND AND OBJECTIVE: Complex acetabular fractures involving quadrilateral areas are more challenging to treat during surgery. To date, there has been no ideal internal fixation for these acetabular fractures. The purpose of this study was to evaluate the biomechanical stability of complex acetabular fractures using a dynamic anterior titanium-plate screw system of the quadrilateral area (DAPSQ) by simulating the standing and sitting positions of pelvic specimens. MATERIALS AND METHODS: Eight formal in-preserved cadaveric pelvises aged 30-50 years were selected as the research objects. First, one hip of the normal pelvises was randomly used as the control model (group B) for measurement, and then one hip of the pelvises was randomly selected to make the fracture model in the 8 intact pelvises as the experimental model (group A) for measurement. In group A, acetabular both-column fractures in the quadrilateral area were established, and the fractures were fixed by DAPSQ. The biomechanical testing machine was used to load (simulated physiological load) from 400 N to 700 N at a 1 mm/min speed for 30 s in the vertical direction when the specimens were measured at random in simulated standing or sitting positions in groups. The horizontal displacement and longitudinal displacement of the acetabular fractures in the quadrilateral area were measured in both the standing and sitting simulations. RESULTS: As the load increased, no dislocation or internal fixation breakage occurred during the measurements. In the standing position, the horizontal displacement of the quadrilateral area fractures in group A and group B appeared to be less than 1 mm with loads ranging from 400 N to 700 N, and there was no significant difference between group A and group B (p > 0.05). The longitudinal displacement appeared to be greater than 1 mm with a load of 700 mm in group A (700 N, 2 cases), and the difference was significant between group A and group B (p < 0.05). In the sitting position, the horizontal and longitudinal displacements of the quadrilateral areas were within 0.5 mm in group A and group B, and there was no significant difference between group A and group B (p > 0.05). CONCLUSION: For complex acetabular fractures in the quadrilateral area, DAPSQ fixation may provide early sitting stability, but it is inappropriate for patients to stand too early.

Spectrum-effect relationship between HPLC fingerprint and hypoglycemic of litchi leaves (Litchi chinensis Sonn) in vitro.

Litchi chinensis Sonn (Litchi) has been listed in the Chinese Pharmacopeia, and is an economically and medicinally valuable species within the family Sapindaceae. However, the material basis of its pharmacological action and the pharmacodynamic substances associated with its hypoglycemic effect are still unclear. The predominant objective of this study was to establish the fingerprint profile of litchi leaves and to evaluate the relationship between the components of the high-performance liquid chromatography (HPLC) fingerprint of litchi leaves, assess its hypoglycemic effect by measuring α-glucosidase and α-amylase inhibition, and find the spectrum-effect relationship of litchi leaves by bivariate correlation analysis, Grey relational analysis and partial least squares regression analysis. In this study, the fingerprint of litchi leaves was established by HPLC, and a total of 15 common peaks were identified that clearly calibrated eight components, with P1 being gallic acid, P2 being protocatechuic acid, P3 being catechin, P6 being epicatechin, P12 being rutin, P13 being astragalin, P14 being quercetin and P15 being kaempferol. The similarities between the fingerprints of 11 batches of litchi leaves were 0.766-0.979. Simultaneously, the results of the spectrum-effect relationship showed that the chemical constituents represented by peaks P8, P3, P12, P14, P2, P13, and P11 were relevant to the hypoglycemic effect.