Single-cell exome sequencing and monoclonal evolution of a JAK2-negative myeloproliferative neoplasm.

Tumor heterogeneity presents a challenge for inferring clonal evolution and driver gene identification. Here, we describe a method for analyzing the cancer genome at a single-cell nucleotide level. To perform our analyses, we first devised and validated a high-throughput whole-genome single-cell sequencing method using two lymphoblastoid cell line single cells. We then carried out whole-exome single-cell sequencing of 90 cells from a JAK2-negative myeloproliferative neoplasm patient. The sequencing data from 58 cells passed our quality control criteria, and these data indicated that this neoplasm represented a monoclonal evolution. We further identified essential thrombocythemia (ET)-related candidate mutations such as SESN2 and NTRK1, which may be involved in neoplasm progression. This pilot study allowed the initial characterization of the disease-related genetic architecture at the single-cell nucleotide level. Further, we established a single-cell sequencing method that opens the way for detailed analyses of a variety of tumor types, including those with high genetic complex between patients.

CASTpFold: Computed Atlas of Surface Topography of the universe of protein Folds.

Geometric and topological properties of protein structures, including surface pockets, interior cavities and cross channels, are of fundamental importance for proteins to carry out their functions. Computed Atlas of Surface Topography of proteins (CASTp) is a widely used web server for locating, delineating, and measuring these geometric and topological properties of protein structures. Recent developments in AI-based protein structure prediction such as AlphaFold2 (AF2) have significantly expanded our knowledge on protein structures. Here we present CASTpFold, a continuation of CASTp that provides accurate and comprehensive identifications and quantifications of protein topography. It now provides (i) results on an expanded database of proteins, including the Protein Data Bank (PDB) and non-singleton representative structures of AlphaFold2 structures, covering 183 million AF2 structures; (ii) functional pockets prediction with corresponding Gene Ontology (GO) terms or Enzyme Commission (EC) numbers for AF2-predicted structures and (iii) pocket similarity search function for surface and protein-protein interface pockets. The CASTpFold web server is freely accessible at https://cfold.bme.uic.edu/castpfold/.

A non-pheromone GPCR is essential for meiosis and ascosporogenesis in the wheat scab fungus.

Meiosis is essential for generating genetic diversity and sexual spores, but the regulation of meiosis and ascosporogenesis is not clear in filamentous fungi, in which dikaryotic and diploid cells formed inside fruiting bodies are not free living and independent of pheromones or pheromone receptors. In this study, Gia1, a non-pheromone GPCR (G protein-coupled receptor) with sexual-specific expression in Fusarium graminearum, is found to be essential for ascosporogenesis. The gia1 mutant was normal in perithecium development, crozier formation, and karyogamy but failed to undergo meiosis, which could be partially rescued by a dominant active mutation in GPA1 and activation of the Gpmk1 pathway. GIA1 orthologs have conserved functions in regulating meiosis and ascosporogenesis in Sordariomycetes. GIA1 has a paralog, GIP1, in F. graminearum and other Hypocreales species which is essential for perithecium formation. GIP1 differed from GIA1 in expression profiles and downstream signaling during sexual reproduction. Whereas the C-terminal tail and IR3 were important for intracellular signaling, the N-terminal region and EL3 of Gia1 were responsible for recognizing its ligand, which is likely a protein enriched in developing perithecia, particularly in the gia1 mutant. Taken together, these results showed that GIA1 encodes a non-pheromone GPCR that regulates the entry into meiosis and ascosporogenesis via the downstream Gpmk1 MAP kinase pathway in F. graminearum and other filamentous ascomycetes.

Structure-based pathogenicity relationship identifier for predicting effects of single missense variants and discovery of higher-order cancer susceptibility clusters of mutations.

We report the structure-based pathogenicity relationship identifier (SPRI), a novel computational tool for accurate evaluation of pathological effects of missense single mutations and prediction of higher-order spatially organized units of mutational clusters. SPRI can effectively extract properties determining pathogenicity encoded in protein structures, and can identify deleterious missense mutations of germ line origin associated with Mendelian diseases, as well as mutations of somatic origin associated with cancer drivers. It compares favorably to other methods in predicting deleterious mutations. Furthermore, SPRI can discover spatially organized pathogenic higher-order spatial clusters (patHOS) of deleterious mutations, including those of low recurrence, and can be used for discovery of candidate cancer driver genes and driver mutations. We further demonstrate that SPRI can take advantage of AlphaFold2 predicted structures and can be deployed for saturation mutation analysis of the whole human proteome.

A facile Immunoregulatory Constructional Design by Proanthocyanidin Optimizing Directional Chitosan Microchannel.

Improving the interconnected structure and bioregulatory function of natural chitosan is beneficial for optimizing its performance in bone regeneration. Here, a facile immunoregulatory constructional design is proposed for developing instructive chitosan by directional freezing and alkaline salting out. The molecular dynamics simulation confirmed the assembly kinetics and structural features of various polyphenols and chitosan molecules. Along with the in vitro anti-inflammatory, antioxidative, promoting bone mesenchymal stem cell (BMSC) adhesion and proliferation performance, proanthocyanidin optimizing chitosan (ChiO) scaffold presented an optimal immunoregulatory structure with the directional microchannel. Transcriptome analysis in vitro further revealed the cytoskeleton- and immune-regulation effect of ChiO are the key mechanism of action on BMSC. The rabbit cranial defect model (Φ = 10 mm) after 12 weeks of implantation confirmed the significantly enhanced bone reconstitution. This facile immunoregulatory directional microchannel design provides effective guidance for developing inducible chitosan scaffolds.

Tungstate Intercalated NiFe Layered Double Hydroxide Enables Long-Term Alkaline Seawater Oxidation.

Renewable electricity-driven seawater splitting presents a green, effective, and promising strategy for building hydrogen (H2 )-based energy systems (e.g., storing wind power as H2 ), especially in many coastal cities. The abundance of Cl- in seawater, however, will cause severe corrosion of anode catalyst during the seawater electrolysis, and thus affect the long-term stability of the catalyst. Herein, seawater oxidation performances of NiFe layered double hydroxides (LDH), a classic oxygen (O2 ) evolution material, can be boosted by employing tungstate (WO4 2- ) as the intercalated guest. Notably, insertion of WO4 2- to LDH layers upgrades the reaction kinetics and selectivity, attaining higher current densities with ≈100% O2 generation efficiency in alkaline seawater. Moreover, after a 350 h test at 1000 mA cm-2 , only trace active chlorine can be detected in the electrolyte. Additionally, O2 evolution follows lattice oxygen mechanism on NiFe LDH with intercalated WO4 2- .

Predictive, preventive, and personalized medicine in breast cancer: targeting the PI3K pathway.

Breast cancer (BC) is a multifaceted disease characterized by distinct molecular subtypes and varying responses to treatment. In BC, the phosphatidylinositol 3-kinase (PI3K) pathway has emerged as a crucial contributor to the development, advancement, and resistance to treatment. This review article explores the implications of the PI3K pathway in predictive, preventive, and personalized medicine for BC. It emphasizes the identification of predictive biomarkers, such as PIK3CA mutations, and the utility of molecular profiling in guiding treatment decisions. The review also discusses the potential of targeting the PI3K pathway for preventive strategies and the customization of therapy based on tumor stage, molecular subtypes, and genetic alterations. Overcoming resistance to PI3K inhibitors and exploring combination therapies are addressed as important considerations. While this field holds promise in improving patient outcomes, further research and clinical trials are needed to validate these approaches and translate them into clinical practice.

Carbon fluxes of China's coastal wetlands and impacts of reclamation and restoration.

Coastal wetlands play an important role in regulating atmospheric carbon dioxide (CO2) concentrations and contribute significantly to climate change mitigation. However, climate change, reclamation, and restoration have been causing substantial changes in coastal wetland areas and carbon exchange in China during recent decades. Here we compiled a carbon flux database consisting of 15 coastal wetland sites to assess the magnitude, patterns, and drivers of carbon fluxes and to compare fluxes among contrasting natural, disturbed, and restored wetlands. The natural coastal wetlands have the average net ecosystem exchange of CO2 (NEE) of -577 g C m-2 year-1, with -821 g C m-2 year-1 for mangrove forests and -430 g C m-2 year-1 for salt marshes. There are pronounced latitudinal patterns for carbon dioxide exchange of natural coastal wetlands: NEE increased whereas gross primary production (GPP) and respiration of ecosystem decreased with increasing latitude. Distinct environmental factors drive annual variations of GPP between mangroves and salt marshes; temperature was the dominant controlling factor in salt marshes, while temperature, precipitation, and solar radiation were co-dominant in mangroves. Meanwhile, both anthropogenic reclamation and restoration had substantial effects on coastal wetland carbon fluxes, and the effect of the anthropogenic perturbation in mangroves was more extensive than that in salt marshes. Furthermore, from 1980 to 2020, anthropogenic reclamation of China's coastal wetlands caused a carbon loss of ~3720 Gg C, while the mangrove restoration project during the period of 2021-2025 may switch restored coastal wetlands from a carbon source to carbon sink with a net carbon gain of 73 Gg C. The comparison of carbon fluxes among these coastal wetlands can improve our understanding of how anthropogenic perturbation can affect the potentials of coastal blue carbon in China, which has implications for informing conservation and restoration strategies and efforts of coastal wetlands.

Identification of four novel large deletions and complex variants in the α-globin locus in Chinese population.

BACKGROUND: At present, the methods generally used to detect α-thalassemia mutations are confined to detecting common mutations, which may lead to misdiagnosis or missed diagnosis. The single-molecule real-time (SMRT) sequencing enables long-read single-molecule sequencing with high detection accuracy, and long-length DNA chain reads in high-fidelity read mode. This study aimed to identify novel large deletions and complex variants in the α-globin locus in Chinese population. METHODS: We used SMRT sequencing to detect rare and complex variants in the α-globin locus in four individuals whose hematological data indicated microcytic hypochromic anemia. However, the conventional thalassemia detection result was negative. Multiplex ligation-dependent probe amplification and droplet digital polymerase chain reaction were used to confirm SMRT sequencing results. RESULTS: Four novel large deletions were observed ranging from 23 to 81 kb in the α-globin locus. One patient also had a duplication of upstream of HBZ in the deletional region, while another, with a 27.31-kb deletion on chromosome 16 (hg 38), had abnormal hemoglobin Siriraj (Hb Siriraj). CONCLUSION: We first identified the four novel deletions in the α-globin locus using SMRT sequencing. Considering that the conventional methods might lead to misdiagnosis or missed diagnosis, SMRT sequencing proved to be an excellent method to discover rare and complex variants in thalassemia, especially in prenatal diagnosis.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Hypoxia-induced ZEB1 promotes cervical cancer immune evasion by strengthening the CD47-SIRPα axis.

BACKGROUND: The dynamic interaction between cancer cells and tumour-associated macrophages (TAMs) in the hypoxic tumour microenvironment (TME) is an active barrier to the effector arm of the antitumour immune response. Cancer-secreted exosomes are emerging mediators of this cancer-stromal cross-talk in the TME; however, the mechanisms underlying this interaction remain unclear. METHODS: Exosomes were isolated with ExoQuick exosome precipitation solution. The polarizing effect of TAMs was evaluated by flow cytometry, western blot analysis, immunofluorescence staining and in vitro phagocytosis assays. Clinical cervical cancer specimens and an in vivo xenograft model were also employed. RESULTS: Our previous study showed that hypoxia increased the expression of ZEB1 in cervical squamous cell carcinoma (CSCC) cells, which resulted in increased infiltration of TAMs. Here, we found that hypoxia-induced ZEB1 expression is closely correlated with CD47-SIRPα axis activity in CSCC, which enables cancer cells to evade phagocytosis by macrophages and promotes tumour progression. ZEB1 was found to directly activate the transcription of the CD47 gene in hypoxic CSCC cells. We further showed that endogenous ZEB1 was characteristically enriched in hypoxic CSCC cell-derived exosomes and transferred into macrophages via these exosomes to promote SIRPα+ TAM polarization. Intriguingly, exosomal ZEB1 retained transcriptional activity and reprogrammed SIRPα+ TAMs via activation of the STAT3 signalling pathway in vitro and in vivo. STAT3 inhibition reduced the polarizing effect induced by exosomal ZEB1. Knockdown of ZEB1 increased the phagocytosis of CSCC cells by macrophages via decreasing CD47 and SIRPα expression. CONCLUSIONS: Our results suggest that hypoxia-induced ZEB1 promotes immune evasion in CSCC by strengthening the CD47-SIRPα axis. ZEB1-targeted therapy in combination with CD47-SIRPα checkpoint immunotherapy may improve the outcomes of CSCC patients in part by disinhibiting innate immunity.

Serum PRO-C3 is useful for risk prediction and fibrosis assessment in MAFLD with chronic kidney disease in an Asian cohort.

BACKGROUND: Metabolic dysfunction-associated fatty liver disease (MAFLD) is an emerging risk factor for chronic kidney disease (CKD). N-terminal propeptide of collagen type 3 (PRO-C3) is a biomarker of advanced fibrosis in MAFLD and PRO-C3 may be involved in renal fibrosis. We aimed to use PRO-C3 measurements to generate a new algorithmic score to test the prediction of MAFLD with chronic kidney disease (MAFLD-CKD). METHODS: A derivation and independent validation cohort of 750 and 129 Asian patients with biopsy-confirmed MAFLD were included. Serum PRO-C3 concentration was measured and regression analyses were performed to examine associations with MAFLD-CKD. A derivative algorithm for MAFLD-CKD risk prediction was evaluated with receiver operator characteristic (ROC) curve analysis. RESULTS: The study included two Asian cohorts (n = 180 with MAFLD-CKD; mean-eGFR: 94.93 mL/min/1.73 m2; median-urinary albumin-to-creatinine ratio: 6.58 mg/mmol). PRO-C3 was associated with the severity of MAFLD-CKD and independently associated with MAFLD-CKD (adjusted odds ratio = 1.16, 95% confidence interval [CI]: 1.08-1.23, p < .001). A new non-invasive score (termed PERIOD) including PRO-C3 efficiently predicted MAFLD-CKD (AUROC = .842, 95% CI: .805-.875). Accuracy, specificity and negative predictive values were 80.2%, 85.1% and 88.4%, respectively. In the validation cohort, the PERIOD score had good diagnostic performance (AUROC = .807, 95% CI: .691-.893) with similar results in all patient subgroups. In the MAFLD-CKD subgroup, the accuracy for identifying advanced fibrosis was further improved by combining the PRO-C3-based ADAPT with the Agile 3+ scores (AUROC = .90, 95% CI: .836-.964). CONCLUSIONS: The PERIOD score is helpful for accurately predicting the risk of MAFLD-CKD. PRO-C3 can also be used to assess liver fibrosis in people with MAFLD-CKD.

Association of Cardiovascular Health With Risk of Incident Depression and Anxiety.

OBJECTIVE: To investigate the association between cardiovascular health (CVH), defined by the American Heart Association's Life's Essential 8 (LE8) score, and incident depression and anxiety. DESIGN: A prospective cohort study using data from UK Biobank. SETTING: Participants were enrolled from March 2006 to October 2010. PARTICIPANTS: Participants without cardiovascular diseases and common mental disorders at baseline and having complete data on metrics of LE8 were included. MEASUREMENTS: CVH was assessed by LE8 score including eight components. The overall CVH was categorized as low (LE8 score <50), moderate (50≤ LE8 score <80), and high (LE8 score ≥80). RESULTS: We included 115,855 participants (mean age: 55.7 years; female: 52.6%). During a median follow-up of 12.4 years, 3,194 (2.8%) and 4,005 (3.5%) participants had incident depression and anxiety, respectively. Compared with participants having low CVH, those having moderate and high CVH had 37% (HR = 0.63, 95% CI: 0.57-0.70) and 52% (HR = 0.48, 95% CI: 0.41-0.55) lower risk of incident depression. Similarly, moderate and high CVH were related to a lower risk of incident anxiety (HR = 0.81, 95% CI: 0.73-0.89 and HR = 0.68, 95% CI: 0.60-0.78). Restricted cubic spline showed that LE8 score was inversely related to incident depression and anxiety in a linear manner, and the risk of incident depression and anxiety decreased by 17% (HR = 0.83, 95% CI: 0.80-0.85) and 10% (HR = 0.90, 95% CI: 0.88-0.92) for 10-point increment in LE8 score, respectively. CONCLUSIONS: Higher CVH, evaluated by LE8 score, is strongly associated with a lower risk of incident depression and anxiety, suggesting the significance of optimizing CVH by adopting LE8.

New Insights into Aggregation Behaviors of the UV-Irradiated Dissolved Biochars (DBioCs) in Aqueous Environments: Effects of Water Chemistries and Variation in the Hamaker Constant.

The aggregation behavior of ubiquitous dissolved black carbon (DBC) largely affects the fate and transport of its own contaminants and the attached contaminants. However, the photoaging processes and resulting effects on its colloidal stability remain yet unknown. Herein, dissolved biochars (DBioCs) were extracted from common wheat straw biochar as a proxy for an anthropogenic DBC. The influences of UV radiation on their aggregation kinetics were systematically investigated under various water chemistries (pH, electrolytes, and protein). The environmental stability of the DBioCs before and after radiation was further verified in two natural water samples. Hamaker constants of pristine and photoaged DBioCs were derived according to Derjaguin-Landau-Verwey-Overbeek (DLVO) prediction, and its attenuation (3.19 ± 0.15 × 10-21 J to 1.55 ± 0.07 × 10-21 J after 7 days of radiation) was described with decay kinetic models. Pearson correlation analysis revealed that the surface properties and aggregation behaviors of DBioCs were significantly correlated with radiation time (p < 0.05), indicating its profound effects. Based on characterization and experimental results, we proposed a three-stage mechanism (contended by photodecarboxylation, photo-oxidation, and mineral exposure) that DBioCs might experience under UV radiation. These findings would provide an important reference for potential phototransformation processes and relevant behavioral changes that DBC may encounter.

Toward Low-Carbon Rice Production in China: Historical Changes, Driving Factors, and Mitigation Potential.

Under the "Double Carbon" target, the development of low-carbon agriculture requires a holistic comprehension of spatially and temporally explicit greenhouse gas (GHG) emissions associated with agricultural products. However, the lack of systematic evaluation at a fine scale presents considerable challenges in guiding localized strategies for mitigating GHG emissions from crop production. Here, we analyzed the county-level carbon footprint (CF) of China's rice production from 2007 to 2018 by coupling life cycle assessment and the DNDC model. Results revealed a significant annual increase of 74.3 kg CO2-eq ha-1 in the average farm-based CF (FCF), while it remained stable for the product-based CF (PCF). The CF exhibited considerable variations among counties, ranging from 2324 to 20,768 kg CO2-eq ha-1 for FCF and from 0.36 to 3.81 kg CO2-eq kg-1 for PCF in 2018. The spatiotemporal heterogeneities of FCF were predominantly influenced by field CH4 emissions, followed by diesel consumption and soil organic carbon sequestration. Scenario analysis elucidates that the national total GHG emissions from rice production could be significantly reduced through optimized irrigation (48.5%) and straw-based biogas production (18.0%). Moreover, integrating additional strategies (e.g., advanced crop management, optimized fertilization, and biodiesel application) could amplify the overall emission reduction to 76.7% while concurrently boosting the rice yield by 11.8%. Our county-level research provides valuable insights for the formulation of targeted GHG mitigation policies in rice production, thereby advancing the pursuit of carbon-neutral agricultural practices.

RNF213 loss-of-function promotes pathological angiogenesis in moyamoya disease via the Hippo pathway.

Moyamoya disease is an uncommon cerebrovascular disorder characterized by steno-occlusive changes in the circle of Willis and abnormal vascular network development. Ring finger protein 213 (RNF213) has been identified as an important susceptibility gene for Asian patients, but researchers have not completely elucidated whether RNF213 mutations affect the pathogenesis of moyamoya disease. Using donor superficial temporal artery samples, whole-genome sequencing was performed to identify RNF213 mutation types in patients with moyamoya disease, and histopathology was performed to compare morphological differences between patients with moyamoya disease and intracranial aneurysm. The vascular phenotype of RNF213-deficient mice and zebrafish was explored in vivo, and RNF213 knockdown in human brain microvascular endothelial cells was employed to analyse cell proliferation, migration and tube formation abilities in vitro. After bioinformatics analysis of both cell and bulk RNA-seq data, potential signalling pathways were measured in RNF213-knockdown or RNF213-knockout endothelial cells. We found that patients with moyamoya disease carried pathogenic mutations of RNF213 that were positively associated with moyamoya disease histopathology. RNF213 deletion exacerbated pathological angiogenesis in the cortex and retina. Reduced RNF213 expression led to increased endothelial cell proliferation, migration and tube formation. Endothelial knockdown of RNF213 activated the Hippo pathway effector Yes-associated protein (YAP)/tafazzin (TAZ) and promoted the overexpression of the downstream effector VEGFR2. Additionally, inhibition of YAP/TAZ resulted in altered cellular VEGFR2 distribution due to defects in trafficking from the Golgi apparatus to the plasma membrane and reversed RNF213 knockdown-induced angiogenesis. All these key molecules were validated in ECs isolated from RNF213-deficient animals. Our findings may suggest that loss-of-function of RNF213 mediates the pathogenesis of moyamoya disease via the Hippo pathway.

The optimal introversion angle and length of pedicle screw to avoid L1-S1 vascular damage.

BACKGROUND: posterior pedicle screw fixation is common method, one of the most severe complications is iatrogenic vascular damage, no report investigated association of different introversion angles (INTAs) and length of pedicle screw. The aims were to investigate the optimal introversion angle and length of pedicle screw for improving the safety of the operation, and to analyze the differences of vascular damage types at L1-S1. METHODS: Lumbar CT imaging data from110 patients were analyzed by DICOM software, and all parameters were measured by new Cartesian coordinate system, INTAs (L1-L5:5°,10°,15°,S1: 0°, 5°,10°,15°), DO-AVC (the distance between the origin (O) with anterior vertebral cortex (AVC)), DAVC-PGVs (the distance between AVC and the prevertebral great vessels (PGVs)), DO-PGVs (the distance between the O and PGVs). At different INTAs, DAVC-PGVs were divided into four grades: Grade III: DAVC-PGVs ≤ 3 mm, Grade II: 3 mm < DAVC-PGVs ≤ 5 mm, Grade I: DAVC-PGVs > 5 mm, and N: the not touching PGVs. RESULTS: The optimal INTA was 5° at L1-L3, the left was 5° and the right was 15° at L4, and screw length was less than 50 mm at L1-L4. At L5, the left optimal INTA was 5° and the right was 10°, and screw length was less than 45 mm. The optimal INTA was 15° at S1, and screw length was less than 50 mm. However, screw length was less than 40 mm when the INTA was 0° or 5° at S1. CONCLUSIONS: At L5-S1, the risk of vascular injury is the highest. INTA and length of the pedicle screw in lumbar operation are closely related. 3 mm interval of screw length may be more preferable to reduce vascular damage.

Establishment of a Model for Human Hypertrophic Scar Using Tissue Engineering Method.

BACKGROUND: Treatment of human hypertrophic scar (HS) is a challenge for plastic surgeons, whereas the clinical and experimental research has been limited due to the lack of an ideal model of human HS tissue. OBJECTIVE: To establish a model of human HS using tissue engineering method, to improve the research for HS in the clinic and laboratory. METHODS: Hypertrophic scar fibroblasts (HSFBs) were transferred to polylactic acid (PLA)/polyglycolic acid (PGA) scaffolds. Biocompatibility of HSFBs-PLA/PGA composites was evaluated using scanning electron microscopy. Composites of HSFBs-PLA/PGA were implanted in subcutaneous pockets in athymic mice after 4 weeks in vitro culture. A re-entry operation was performed to obtain the HS-like tissues after 12 weeks of in vivo culture. The histological stain, the expression of type I collagen, the proliferation ability, and vitality of HSFBs were compared between human HS tissue and HS-like tissue. RESULTS: The structure of PLA/PGA scaffolds facilitates HSFBs adhesion and proliferation. The HSFBs-PLA/PGA composites were in vivo cultured for 12 weeks, and then HS-like tissues were harvested from nude athymic mice. There was no statistical significance in the expression of type I collagen, cell cycle, and cell proliferation between human HS tissue and HS-like tissue. CONCLUSION: The authors successfully established a model of human HS using the tissue engineering method, which could provide HS-like tissue for research. And it also could provide enough HS-like tissues to help reduce experimental variability within groups. This model can be used to investigate in prevention and treatment of HS and further explore the mechanisms of HS.

Loss of Gucy1a3 causes poor post-stroke recovery by reducing angiogenesis via the HIF-1α/VEGFA signaling pathway in mice.

OBJECTIVES: Ischemic stroke is a common and debilitating disease that can cause permanent neurological damage. Gucy1a3, which encodes the α1 subunit of soluble guanylyl cyclase, has been reported to be associated with functional recovery after ischemic stroke. However, the mechanism is still not well understood. In the present study, we investigated the effects of Gucy1a3 on (i) post-stroke recovery; (ii) vascular endothelial growth factor A (VEGFA) and hypoxia inducible factor 1 alpha (HIF-1α) expression; and (iii) angiogenesis after ischemic stroke. MATERIALS AND METHODS: Wild-type and Gucy1a3 knockout C57BL/6J male mice were respectively used to establish the models of permanent middle cerebral artery occlusion (pMCAO). Neurological deficit scores were evaluated at 24 h and 96 h after pMCAO. Cerebral infarct volume was measured by 2,3,5-triphenyltetrazolium chloride (TTC) staining. For determining microvessel density, immunohistochemical analysis was performed with CD31. The expression of VEGFA and HIF-1α was detected by western blotting. RESULTS: Our results suggest that loss of Gucy1a3 increased the infarct volume and aggravated neurological deficits after pMCAO. In addition, the Gucy1a3 knockout brains exhibited significantly lower microvessel densities and VEGFA and HIF-1α expression levels than the wild-type brains at 96 h post-pMCAO. CONCLUSIONS: Our study indicates that GUCY1A3 might be involved in angiogenesis after ischemic stroke. Further investigation of GUCY1A3 will provide a new therapeutic target for stroke.

Telecoupling between urban expansion and forest ecosystem service loss through cultivated land displacement: A case study of Zhejiang Province, China.

Urbanization can either directly occupy forests or indirectly lead to forest loss elsewhere through cultivated land displacement, resulting in further forest fragmentation and ecosystem service (ES) loss. However, the effects of urban expansion on forest area and ESs are unknown, and this is especially true for indirect effects. Taking Zhejiang Province, China, a typical deforested province, as an example, this study quantified the direct and indirect effects of urban expansion on forest area and five ESs (timber yield, water yield, carbon sequestration, soil conservation, and biodiversity) from 2000 to 2020, explored the relationship between forest structure (forest proportion, mean patch area, edge density, and mean euclidean nearest neighbor distance) change and ESs, and revealed the telecoupling of urban expansion and forest loss and cascade effects among urbanization, deforestation, forest structure, and ESs. The results indicated that the indirect forest loss (4.30%-6.15%) caused by cultivated land displacement due to urban expansion was larger than the direct forest loss (2.42%). Urban expansion has a greater negative impact on carbon sequestration (6.40%-8.20%), water yield (6.08%-7.78%), and biodiversity (5.79%-7.44%) than on timber yield (4.77%-6.17%) and soil conservation (4.43%-5.77%). The indirect forest ES loss was approximately 2.83-4.34 times greater than the direct forest ES loss. Most forest ESs showed a nonlinear significant positive correlation with changes in forest proportion and mean patch area and a significant nonlinear negative correlation with changes in edge density and mean Euclidean nearest neighbor distance (p < 0.05). There is telecoupling between urban expansion in one region and forest ES loss in other distant regions. This study contributes to guiding sustainable forest conservation and management globally.