Evaluation of a Series of Turnip Mosaic Virus Chimeric Clones Reveals Two Amino Acid Sites Critical for Systemic Infection in Chinese Cabbage.

Two infectious clones of turnip mosaic virus (TuMV), pKBC-1 and pKBC-8, with differential infectivity in Chinese cabbage (Brassica rapa subsp. pekinensis), were obtained. Both infected Nicotiana benthamiana systemically, inducing similar symptoms, whereas only virus KBC-8 infected Chinese cabbage systemically. To identify the determinants affecting infectivity on Chinese cabbage, chimeric clones were constructed by restriction fragment exchange between the parental clones and tested on several Chinese cabbage cultivars. Chimeric clones p1N8C and p8N1C demonstrated that the C-terminal portion of the polyprotein determines systemic infection of Chinese cabbage despite only three amino acid differences in this region, in the cylindrical inclusion (CI), viral protein genome-linked (VPg), and coat protein (CP). A second pair of hybrid constructs, pHindIII-1N8C and pHindIII-8N1C, failed to infect cultivars CR Victory and Jinseonnorang systemically, yet pHindIII-1N8C caused hypersensitive response-like lesions on inoculated leaves of these cultivars, and could systemically infect cultivars CR Chusarang and Jeongsang; this suggests that R genes effective against TuMV may exist in the first two cultivars but not the latter two. Constructs with single amino acid changes in both VPg (K2045E) and CP (Y3095H) failed to infect Chinese cabbage, implying that at least one of these two amino acid substitutions is essential for successful infection on Chinese cabbage. Successful infection by mutant KBC-8-CP-H and delayed infection with mutant HJY1-VPg-E following mutation or reversion suggested that VPg (2045K) is the residue required for infection of Chinese cabbage and involved in the interaction between VPg and eukaryotic initiation factor eIF(iso)4E, confirmed by yeast two-hybrid assay.

First report of dasheen mosaic virus infecting calla lilies in South Korea.

In April 2022, leaves showing virus-like symptoms including mosaic, feathery chlorotic mottle and distortions were observed on calla lilies (Zantedeschia sp.) growing in a greenhouse in Jeolla province, South Korea. Leaf samples from nine symptomatic plants from the same greenhouse were collected and tested for Zantedeschia mosaic virus (ZaMV), Zantedeschia mild mosaic virus (ZaMMV) and Dasheen mosaic virus (DaMV) by reverse transcription-polymerase chain reaction (RT-PCR) with specific primers, ZaMV-F/R (Wei et al. 2008), ZaMMV-F/R (5'-GACGATCAGCAACAGCAGCAACAGCAGAAG-3'/5'-CTGCAAGGCTGAGATCCCGAGTAGCGAGTG-3') and DsMV-CPF/CPR, respectively. In previous surveys, ZaMV and ZaMMV were detected in calla lily fields in South Korea. Of 9 symptomatic samples, 8 were positive for ZaMV and ZaMMV but no PCR product was obtained from the ninth sample, which showed a yellow feather-like pattern. To identify the causal virus, total RNA from a leaf sample of the symptomatic calla lily was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and analyzed by high-throughput sequencing. Ribosomal RNA was removed and a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Plants) and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 150 nt paired end reads. De novo assembly of the 88,171,036 reads was performed using Trinity software (r20140717) while the 113,140 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. One contig of 10,007 bp (GenBank LC723667) shared 79.89-87.08% nucleotide (nt) identities to the available genomes of other DsMV isolates including Colocasia esculenta isolates Et5 (MG602227, 87.08%; Ethiopia) and CTCRI-II-14 (KT026108, 85.32%; India), and a calla lily isolate (AJ298033, 84.95%; China). No contigs representing other plant viruses were identified. To confirm the presence of DsMV, and because the virus was not detected using DsMV-CPF/CPR, RT-PCR was performed using new virus-specific primers DsMV-F/R (5'-GATGTCAACGCTGGCACCAGT-3'/5'-CAACCTAGTAGTAACGTTGGAGA-3'), designed based on the contig sequence. PCR products of the expected 600 bp were obtained from the symptomatic plant, cloned into the pGEM-T Easy Vector (Promega, USA), and two independent clones were bidirectionally sequenced (BIONEER, Korea), and shown to be identical. The sequence was deposited in GenBank as acc. no. LC723766, and shared 100% nt identity to the full-length contig LC723667, and 91.83% identity to the Chinese calla lily DsMV isolate (AJ298033). DsMV, a member of the genus Potyvitus in the family Potyviridae, is one of the major viruses infecting taro in South Korea, showing mosaic and chlorotic feathering symptoms (Kim et al. 2004); however, there is no record in the literature of the identification of this virus in South Korea in ornamental species including calla lily. To survey the sanitary status of other calla lilies, 95 samples with or without symptoms were collected from other regions and subjected to RT-PCR detection for DsMV. Ten of these samples were positive with primers DsMV-F/R, including seven mixed infections (DsMV+ZaMV or DsMV+ZaMV+ZaMMV). To our knowledge, this is the first report of DsMV infecting calla lilies in South Korea. The virus is easily spread by vegetative propagation (Babu et al. 2011) and by aphids (Reyes et al. 2006). This study will help the management of viral diseases on calla lilies in South Korea.

Construction of full-length infectious cDNA clones of two Korean isolates of turnip mosaic virus breaking resistance in Brassica napus.

In this work, two new turnip mosaic virus (TuMV) strains (Canola-12 and Canola-14) overcoming resistance in canola (Brassica napus) were isolated from a B. napus sample that showed typical TuMV-like symptoms and was collected in the city of Gimcheon, South Korea, in 2020. The complete genome sequence was determined and an infectious clone was made for each isolate. Phylogenetic analysis indicated that the strains isolated from canola belonged to the World-B group. Both infectious clones, which used 35S and T7 promoters to drive expression, induced systemic symptoms in Nicotiana benthamiana and B. napus. To our knowledge, this is the first report of TuMV infecting B. napus in South Korea.

Construction of full-length infectious clones of turnip mosaic virus isolates infecting Perilla frutescens and genetic analysis of recently emerged strains in Korea.

Perilla is an annual herb with a unique aroma and taste that has been cultivated in Korea for hundreds of years. It has been widely cultivated in many Asian and European countries as a food and medicinal crop. Recently, several viruses have been reported to cause diseases in perilla in Korea, including turnip mosaic virus (TuMV), which is known as a brassica pathogen due to its significant damage to brassica crops. In this study, we determined the complete genome sequences of two new TuMV isolates originating from perilla in Korea. Full-length infectious cDNA clones of these two isolates were constructed, and their infectivity was tested by agroinfiltration of Nicotiana benthamiana and sap inoculation of Chinese cabbage and radish plants. In addition, we analyzed the phylogenetic relationship of six new Korean TuMV isolates to members of the four major groups. We also used RDP4 software to conduct recombination analysis of recent isolates from Korea, which provided new insight into the evolutionary relationships of Korean isolates of TuMV.

Reassortment of Infectious Clones of Radish Mosaic Virus Shows that Systemic Necrosis in Nicotiana benthamiana Is Determined by RNA1.

Three infectious clones of radish mosaic virus (RaMV) were generated from isolates collected in mainland Korea (RaMV-Gg) and Jeju Island (RaMV-Aa and RaMV-Bb). These isolates differed in sequences and pathogenicity. Examination of the wild-type isolates and reassortants between the genomic RNA1 and RNA2 of these three isolates revealed that severe symptoms were associated with RNA1 of isolates Aa or Gg causing systemic necrosis in Nicotiana benthamiana, or with RNA1 of isolate Bb for induction of veinal necrosis and severe mosaic symptoms in radish. Reverse transcription, followed by quantitative real-time PCR (Q-RT-PCR), results from infected N. benthamiana confirmed that viral RNA2 accumulation level was correlated to RaMV necrosis-inducing ability, and that the RNA2 accumulation level was mostly dependent on the origin of RNA1. However, in radish, Q-RT-PCR results showed more similar viral RNA2 accumulation levels regardless of the ability of the isolate to induce necrosis. Phylogenetic analysis of genomic RNAs sequence including previously characterized isolates from North America, Europe, and Asia suggest possible recombination within RNA1, while analysis of concatenated RNA1+RNA2 sequences indicates that reassortment of RNA1 and RNA2 has been more important in the evolution of RaMV isolates than recombination. Korean isolate Aa is a potential reassortant between isolates RaMV-J and RaMV-TW, while isolate Bb might have evolved from reassortment between isolates RaMV-CA and RaMV-J. The Korean isolates were shown to also be able to infect Chinese cabbage, raising concerns that RaMV may spread from radish fields to the Chinese cabbage crop in Korea, causing further economic losses.

First report of pepino mosaic virus infecting tomato in South Korea.

Pepino mosaic virus (PepMV), a member of the genus Potexvirus in the family Alphaflexiviridae, has been responsible for economic losses in tomato across Africa, Asia, Europe, and the Americas over the last two decades, but has not previously been reported in South Korea. In December 2020, virus-like symptoms (foliar interveinal chlorosis and unevenly discolored fruits) were observed on ~5% of tomato (Solanum lycopersicum) plants growing in a greenhouse in Jeolla province, South Korea. To identify the causal virus, total RNA from a leaf sample of the symptomatic tomato was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and analyzed by high-throughput sequencing. Ribosomal RNA was removed and a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Plants) and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 151 nt paired end reads. De novo assembly of the 74,417,192 reads was performed using Trinity software (r20140717) while the 308,940 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. Two contigs of 6,419 and 6,391 bp (GenBank LC656469, JKT1; and LC656470, JKT2) shared 94.81% and 98.34% nucleotide (nt) identities with isolates of the CH2 group (MK133092 and MF422613) and US1 group (FJ940225), respectively. No contigs representing other plant viruses were identified. A phylogenetic tree of the genomes of 44 isolates encompassing different PepMV strains (Abrahamian et al., 2020) also placed JKT1 in the CH2 clade, and JKT2 in the US1 clade. Leaf samples from 24 randomly selected plants from the same greenhouse were tested by reverse transcription-polymerase chain reaction (RT-PCR) with PepMV-specific primers, Pep3/Pep4 and PepCP-D/PepCP-R (Souiri et al., 2019), yielding products of the expected sizes (625 bp for Pep3/Pep4 and 848 bp for PepCP-D/PepCP-R) from all samples. Amplicons were cloned into the pGEM-T Easy Vector (Promega, USA); two clones for each amplicon were bidirectionally sequenced (BIONEER, Korea) and deposited in GenBank. The 848 bp amplicon (accession no. LC637517) showed 99.65% nt identity to the JKT1 genome (LC656469) and 94.69% identity to a CH2 isolate (JN835466); the 625 bp amplicon (LC637518) had 99.36% nt identity to the JKT2 genome (LC656470) and 97.28% identity to a US1 isolate (FJ940225). Primers specific to the coat protein gene of each isolate (JKT1-F/JKT1-R, CGCTTGCTGGTGCTGTTCAAG/ACGTCTAGACAAAGCAGGGTT, 934 bp; JKT2-F/JKT2-R, CACTAAATGCAGCAGTTTCTG/AGTTTCATTAGCAGCCAGTC, 830 bp) also yielded the expected amplicons from all 24 samples, indicating mixed infections of PepMV strains CH2 and US1. The PCR products from three randomly-selected samples shared 79.93-80.17% nt identity between (JKT1/JKT2) two JKT1-derived sequences (LC683791 and LC683792) and two JKT2-derived sequences (LC683793 and LC683794), further supporting the presence of mixed infections in the samples. To our knowledge, this is the first report of PepMV infecting tomato in South Korea. The virus is carried on tomato seeds (Córdoba-Sellés et al., 2007; Hanssen et al., 2010), and efficiently transmitted by mechanical means leading to rapid spread in tomato crops, and the severe strain CH2 may be a serious threat to tomato production in South Korea. It is important to concentrate on the phytosanitary control for both importation and exportation to manage and prevent further spread of contaminated seeds or infected transplants.

First report of Cucurbit chlorotic yellows virus infecting Cucumis melo (muskmelon and oriental melon) in Korea.

In December 2018, virus-like symptoms (yellowing, vein clearing) were observed on 2% of muskmelon (Cucumis melo L.) plants in plastic houses on a farm in Gyeongsang province, Korea Total RNA from two symptomatic and two asymptomatic plants was extracted using RNeasy Plant Mini Kit (Qiagen, Germany) for high throughput sequencing (HTS). After pre-processing and Ribo-Zero rRNA removal, a cDNA library was prepared (Illumina TruSeq Stranded Total RNA kit) and sequenced (Illumina NovaSeq 6000 system: Macrogen Inc. Korea). De novo assembly of 88,222,684 HTS reads with Trinity software (r20140717) yielded 146,269 contigs of 201-28,442 bp, which were screened against the NCBI viral genome database by BLASTn. Contigs from cucumber mosaic virus (CMV), melon necrotic spot virus (MNSV), tobacco mosaic virus (TMV) and watermelon mosaic virus (WMV) were identified, all previously reported in Korea. Two contigs (8,539 and 8,040 bp) with 99.9% sequence identity to distinct cucurbit chlorotic yellows virus (CCYV) isolates (JN641883, RNA1, Taiwan; MH819191, RNA2, China) were also identified. The ten sequences most closely related to each RNA of the Korean isolate (≥99% coverage, ≥99.6% nt identity) were from Japan, China, Taiwan, or Israel. CCYV presence was confirmed by reverse transcription-PCR (RT-PCR) using newly designed specific primers, RdRp-F/RdRp-R (5'-ACCGAACACTTGGCTATCCAA-3'/5'-CTTAATGCCGCGTATGAACTCA-3') span style="font-family:'Times New Roman'; letter-spacing:-0.5pt">and HSP-F/HSP-R (5'-TGAACGACACTGAGTTCATTCCTA-3'/5'-CGCCAAGATCGTACATGAGGAA-3'), against RNA dependent RNA polymerase (RdRp; RNA1) and the heat shock protein 70 homolog (HSP70h; RNA2). Symptomatic samples yielded products of expected sizes (RdRp,450 bp; HSP70h, 510 bp) while asymptomatic samples did not. The amplicons were cloned, and two clones of each were sequenced (BIONEER, Korea; GenBank acc. nos. LC592226 and LC592227) showing 100% and 99.2% nt identity with RdRp and HSP70h genes of Chinese CCYV isolate SD (MH819190 and MH819191, respectively) and other Asian isolates. Primers specific for CMV, WMV, beet pseudo-yellows virus (BPYV) (Okuda et al., 2007), TMV (Kim et al., 2018), MNSV (F/R, 5'-ATCTCGCATTTGGCATTACTC-3'/5'-ATTTGTAGAGATGCCAACGTA-3'), cucurbit yellow stunting disorder virus (CYSDV; Zeng et al., 2011) and cucurbit aphid-borne yellows virus (CABYV; F/R, 5'-CGGTCTATTGTCTGCAGTACCA-3'/5'- GTAGAGGATCTTGAATTGGTCCTCA-3') were also used. None of these viruses were detected in the symptomatic samples, but both asymptomatic plants were positive for CMV and WMV, and one also for MNSV. In June and September 2020, muskmelon and oriental melon (Cucumis melo L. var. makuwa) plants with yellowing disease (incidence 80-90%) and whiteflies were observed in all investigated plastic houses of one muskmelon and one oriental melon farm in Gyeonggi and Jeolla provinces. Symptomatic samples (14 muskmelon; 6 oriental melon) were collected and RT-PCR tested as above; 19/20 samples were positive for CCYV, but none for the other viruses. The oriental melon sequence (LC592895, LC592230) showed 99.7% and 100% nt identity with the RdRp and HSP70h genes of Chinese isolate SD, respectively. CCYV was first reported in Japan (Okuda et al., 2010), Taiwan, and China (Huang et al., 2010; Gu et al., 2011); to our knowledge, this is the first report of CCYV infecting muskmelon and oriental melon in Korea. Whitefly-transmitted CCYV could present a serious threat of yield losses to cucurbit crops in Korea, requiring control of vector populations to prevent spread of CCYV.

First report of Passiflora latent virus(Passiflora latent virus;PLV) infecting persimmon in Korea.

Passiflora latent virus (PLV), a member of the genus Carlavirus in the family Betaflexiviridae has been reported in Passiflora species in Australia, Germany, Israel, the United States, and New Zealand (Tang et al., 2008). In September 2019, leaves showing a virus-like disease with mosaic, curling and necrosis were collected from ten persimmon (Diospyros kaki Thunb.) orchards in Gyeongsang province, Korea. Total RNA from a pooled sample of leaves from 21 trees was extracted using RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high throughput sequencing. After pre-processing and Ribo-Zero rRNA Removal, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo assembly of the 74,862,810 reads was performed using Trinity software (r20140717); the initially assembled 213,476 contigs were screened against the NCBI viral genome database using BLASTN. By these means, 12 contigs derived from PLV were identified. Contigs with lengths of 209 to 802 nt shared nt identities of 90.70 to 94.82% with PLV isolates, covering a total of 5,169 nt (~61.6% of the full PLV genome). Two additional viruses were also detected from the pooled sample: persimmon cryptic virus (PeCV) and persimmon virus A (PeVA). To confirm PLV infection, reverse transcription-polymerase chain reaction (RT-PCR) was performed using virus-specific primers, PLV-F (5'-ACACAAAACTGCGTGTTGGA-3') and PLV-R (5'-CAAGACCCACCTACCTCAGTGTG-3'), designed based on a 633 nt contig sequence in the polymerase gene. RT-PCR products of the expected 571 bp were obtained from two of 21 individual original samples; no asymptomatic plants were tested. Amplicons were cloned into the pGEM-T Easy Vector, and two clones per sample Sanger sequenced bidirectionally (BIONEER, Korea). The identical Sequence (GenBank LC556232) showed 99.65% nt identity to the contig, and 93.87% identity with the corresponding polymerase sequence of PLV-Rehovot isolate from passion fruit in Israel (MH379331). The two PLV positive samples showing leaf necrosis were also co-infected with PeVA, identified by RT-PCR using previously reported primers PeVAfor/ PeVArev (Morell et al., 2014), but not with PeCV (mixed with PeVA in only 1/21 plants; PeVA was found in 19/21 plants). None of the tested viruses were detected in two trees, displaying mosaic, and leaf curling, respectively. The foliar symptoms of PLV infection on passionfruit have been reported to vary throughout the year (Spiegel et al., 2007). No such observations in persimmon was possible, as the infected persimmon trees were removed and destroyed because they might pose a threat to the cultivation of passion fruits in Korea. To our knowledge, this is the first report of persimmon as a host of PLV anywhere in the world, and the first report of PLV in Korea in any host. A further survey is needed to determine possible presence of PLV on persimmon and Passiflora species.

A single nucleotide change in the overlapping MP and CP reading frames results in differences in symptoms caused by two isolates of Youcai mosaic virus.

Two isolates of Youcai mosaic virus (YoMV) were obtained, and their full-length genomic sequences were determined. Full-length infectious cDNA clones of each isolate were generated in which the viral sequence was under the control of dual T7 and 35S promoters for both in vitro transcript production and agro-infiltration. Comparison of the predicted amino acid sequences of the encoded proteins revealed only four differences between the isolates: three in the RNA-dependent RNA polymerase (RdRp) (V383I and M492I in the 125-kDa protein and T1245M in the 182-kDa protein); and one in the overlapping region of the movement protein (MP) and coat protein (CP) genes, affecting only the N-terminal domain of CP (CP M17T). One of the isolates caused severe symptoms in Nicotiana benthamiana plants, while the other caused only mild symptoms. In order to identify the amino acid residues associated with symptom severity, chimeric constructs were generated by combining parts of the two infectious YoMV clones, and the symptoms in infected plants were compared to those induced by the parental isolates. This allowed us to conclude that the M17T substitution in the N-terminal domain of CP was responsible for the difference in symptom severity. The M17T variation was found to be unique among characterized YoMV isolates. A difference in potential post-translational modification resulting from the presence of a predicted casein kinase II phosphorylation site only in the CP of isolate HK2 may be responsible for the symptom differences.

Sequence Variations Among 17 New Radish Isolates of Turnip mosaic virus Showing Differential Pathogenicity and Infectivity in Nicotiana benthamiana, Brassica rapa, and Raphanus sativus.

Infectious clones were generated from 17 new Korean radish isolates of Turnip mosaic virus (TuMV). Phylogenetic analysis indicated that all new isolates, and three previously characterized Korean radish isolates, belong to the basal-BR group (indicating that the pathotype can infect both Brassica and Raphanus spp.). Pairwise analysis revealed genomic nucleotide and polyprotein amino acid identities of >87.9 and >95.7%, respectively. Five clones (HJY1, HJY2, KIH2, BE, and prior isolate R007) had lower sequence identities than other isolates and produced mild symptoms in Nicotiana benthamiana. These isolates formed three distinct sequence classes (HJY1/HJY2/R007, KIH2, and BE), and several differential amino acid residues (in P1, P3, 6K2, and VPg) were present only in mild isolates HJY1, HJY2, and R007. The remaining isolates all induced systemic necrosis in N. benthamiana. Four mild isolates formed a phylogenetic subclade separate from another subclade including all of the necrosis-inducing isolates plus mild isolate KIH2. Symptom severity in radish and Chinese cabbage genotypes was not correlated with pathogenicity in N. benthamiana; indeed, Chinese cabbage cultivar Norang was not infected by any isolate, whereas Chinese cabbage cultivar Chusarang was uniformly susceptible. Four isolates were unable to infect radish cultivar Iljin, but no specific amino acid residues were correlated with avirulence. These results may lead to the identification of new resistance genes against TuMV.

A Turnip Mosaic Virus Determinant of Systemic Necrosis in Nicotiana benthamiana and a Novel Resistance-Breaking Determinant in Chinese Cabbage Identified from Chimeric Infectious Clones.

Infectious clones of Korean turnip mosaic virus (TuMV) isolates KIH1 and HJY1 share 88.1% genomic nucleotides and 96.4% polyprotein amino acid identity, and they induce systemic necrosis or mild mosaic, respectively, in Nicotiana benthamiana. Chimeric constructs between these isolates exchanged the 5', central, and 3' domains of KIH1 (K) and HJY1 (H), where the order of the letters indicates the origin of these domains. KIH1 and chimeras KHH and KKH induced systemic necrosis, whereas HJY1 and chimeras HHK, HKK, and HKH induced mild symptoms, indicating the determinant of necrosis to be within the 5' 3.9 kb of KIH1; amino acid identities of the included P1, Helper component protease, P3, 6K1, and cylindrical inclusion N-terminal domain were 90.06, 98.91, 93.80, 100, and 100%, respectively. Expression of P1 or P3 from a potato virus X vector yielded symptom differences only between P3 of KIH1 and HJY1, implicating a role for P3 in necrosis in N. benthamiana. Chimera KKH infected Brassica rapa var. pekinensis 'Norang', which was resistant to both KIH1 and HJY1, indicating that two separate TuMV determinants are required to overcome the resistance. Ability of diverse TuMV isolates, chimeras, and recombinants to overcome resistance in breeding lines may allow identification of novel resistance genes.

Complete nucleotide sequence and genome organization of peach virus D, a putative new member of the genus Marafivirus.

The complete nucleotide sequence of peach virus D (PeVD) from Prunus persica was determined. The PeVD genome consists of 6,612 nucleotides excluding the 3' poly(A) tail and contains a single open reading frame coding for a polyprotein of 227 kDa. Sequence comparisons and phylogenetic analysis revealed that PeVD is most closely related to viruses in the genus Marafivirus, family Tymoviridae. The complete nucleotide and CP amino acid sequences of PeVD were most similar (51.1-57.8% and 32.2-48.0%, respectively) to members of the genus Marafivirus, suggesting that PeVD is a new member of this genus.

Complete nucleotide sequences and construction of full-length infectious cDNA clones of cucumber green mottle mosaic virus (CGMMV) in a versatile newly developed binary vector including both 35S and T7 promoters.

Seed-transmitted viruses have caused significant damage to watermelon crops in Korea in recent years, with cucumber green mottle mosaic virus (CGMMV) infection widespread as a result of infected seed lots. To determine the likely origin of CGMMV infection, we collected CGMMV isolates from watermelon and melon fields and generated full-length infectious cDNA clones. The full-length cDNAs were cloned into newly constructed binary vector pJY, which includes both the 35S and T7 promoters for versatile usage (agroinfiltration and in vitro RNA transcription) and a modified hepatitis delta virus ribozyme sequence to precisely cleave RNA transcripts at the 3' end of the tobamovirus genome. Three CGMMV isolates (OMpj, Wpj, and Mpj) were separately evaluated for infectivity in Nicotiana benthamiana, demonstrated by either Agroinfiltration or inoculation with in vitro RNA transcripts. CGMMV nucleotide identities to other tobamoviruses were calculated from pairwise alignments using DNAMAN. CGMMV identities were 49.89% to tobacco mosaic virus; 49.85% to pepper mild mottle virus; 50.47% to tomato mosaic virus; 60.9% to zucchini green mottle mosaic virus; and 60.96% to kyuri green mottle mosaic virus, confirming that CGMMV is a distinct species most similar to other cucurbit-infecting tobamoviruses. We further performed phylogenetic analysis to determine relationships of our new Korean CGMMV isolates to previously characterized isolates from Canada, China, India, Israel, Japan, Korea, Russia, Spain, and Taiwan available from NCBI. Analysis of CGMMV amino acid sequences showed three major clades, broadly typified as 'Russian,' 'Israeli,' and 'Asian' groups. All of our new Korean isolates fell within the 'Asian' clade. Neither the 128 nor 186 kDa RdRps of the three new isolates showed any detectable gene silencing suppressor function.

New Korean isolates of Pepper mild mottle virus (PMMoV) differ in symptom severity and subcellular localization of the 126 kDa protein.

Two isolates of Pepper mild mottle virus (PMMoV) were selected from a nationwide survey of pepper fields in South Korea in 2014 and 2015, in which Cucumber mosaic virus was also detected; the two PMMoV isolates, Sangcheong 47 (S-47, KX399390) and Jeongsong 76 (J-76, KX399389), share ~99% nucleotide and amino acid identity and are closely related to Japanese and Chinese isolates at the nucleotide level. Amino acid sequence comparisons revealed 99.73, 99.81, 98.44, and 100% identity in the ORF1, ORF2, MP, and CP, respectively, between S-47 and J-76. In addition, we generated infectious clones of S-47 and J-76, and T7 promoter driven transcripts of each inoculated to Nicotiana benthamiana produced very severe symptoms, whereas only mild symptoms developed in Capsicum annuum. Gene silencing suppressor function of 126 kDa and cytoskeleton-connected plasmodesmata localization of movement protein of S-47 and J-76 showed no difference between isolates, whereas 126 kDa of J-76 clearly formed intracellular aggregates not observed with S-47 126 kDa protein. Differences between these isolates in 126/183 kDa-related functions including subcellular localization suggest that differential interactions with host proteins may affect symptom development in C. annuum.

Non-destructive evaluation of bacteria-infected watermelon seeds using visible/near-infrared hyperspectral imaging.

BACKGROUND: There is a need to minimize economic damage by sorting infected seeds from healthy seeds before seeding. However, current methods of detecting infected seeds, such as seedling grow-out, enzyme-linked immunosorbent assays, the polymerase chain reaction (PCR) and the real-time PCR have a critical drawbacks in that they are time-consuming, labor-intensive and destructive procedures. The present study aimed to evaluate the potential of visible/near-infrared (Vis/NIR) hyperspectral imaging system for detecting bacteria-infected watermelon seeds. RESULTS: A hyperspectral Vis/NIR reflectance imaging system (spectral region of 400-1000 nm) was constructed to obtain hyperspectral reflectance images for 336 bacteria-infected watermelon seeds, which were then subjected to partial least square discriminant analysis (PLS-DA) and a least-squares support vector machine (LS-SVM) to classify bacteria-infected watermelon seeds from healthy watermelon seeds. The developed system detected bacteria-infected watermelon seeds with an accuracy > 90% (PLS-DA: 91.7%, LS-SVM: 90.5%), suggesting that the Vis/NIR hyperspectral imaging system is effective for quarantining bacteria-infected watermelon seeds. CONCLUSION: The results of the present study show that it is possible to use the Vis/NIR hyperspectral imaging system for detecting bacteria-infected watermelon seeds. © 2016 Society of Chemical Industry.

Complete genome sequence of a novel potyvirus, callistephus mottle virus, identified in Callistephus chinensis.

The complete genomic sequence of a novel putative member of the genus Potyvirus was detected from Callistephus chinensis (China aster) in South Korea. The genomic RNA consists of 9,859 nucleotides (excluding the 3' poly(A) tail) and contains the typical open reading frame of potyviruses, encoding a putative large polyprotein of 3,154 amino acids. The Callistephus virus is most closely related to plum pox virus and members of the ApVY subgroup which showed 50-52 % polyprotein amino acid sequence identity. These results suggest that the Callistephus virus is a novel member of the genus Potyvirus, tentatively named "callistephus mottle virus" (CalMV).

Comparison of helper component-protease RNA silencing suppression activity, subcellular localization, and aggregation of three Korean isolates of Turnip mosaic virus.

In 2014, we performed a nationwide survey in Korean radish fields to investigate the distribution and variability of Turnip mosaic virus (TuMV). Brassica rapa ssp. pekinensis sap-inoculated with three isolates of TuMV from infected radish tissue showed different symptom severities, whereas symptoms in Raphanus sativus were similar for each isolate. The helper component-protease (HC-Pro) genes of each isolate were sequenced, and phylogenetic analysis showed that the three Korean isolates were clustered into the basal-BR group. The HC-Pro proteins of these isolates were tested for their RNA silencing suppressor (VSR) activity and subcellular localization in Nicotiana benthamiana. A VSR assay by co-agroinfiltration of HC-Pro with soluble-modified GFP (smGFP) showed that HC-Pro of isolate R007 and R041 showed stronger VSR activity than R065. The HC-Pros showed 98.25 % amino acid identity, and weak VSR isolate (R065) has a single variant residue in the C-terminal domain associated with protease activity and self-interaction compared to isolates with strong VSR activity. Formation of large subcellular aggregates of GFP:HC-Pro fusion proteins in N. benthamiana was only observed for HC-Pro from isolates with strong VSR activity, suggesting that R065 'weak' HC-Pro may have diminished self-association; substitution of the variant C-terminal residue largely reversed the HC-Pro aggregation and silencing suppressor characteristics. The lack of correlation between VSR efficiency and induction of systemic necrosis (SN) suggests that differences in viral accumulation due to HC-Pro are not responsible for SN.

Complete genome sequence of a tentative new caulimovirus from the medicinal plant Atractylodes macrocephala.

A total of nine contigs related to caulimovirus-like sequences were detected using high-throughput paired-end RNA sequencing. An attempt to find the plant sample infected with this type of virus identified the medicinal plant Atractylodes macrocephala Koidzumi showing mild mottle symptoms. Subsequently, the complete DNA genome sequence of the Atractylodes virus was determined. The 8,105-nt genome of the virus was composed of six open reading frames and displayed the highest nucleotide sequence identity (70%) with soybean Putnam virus. Based upon the symptoms observed on the source plant, we propose to refer to this new member of the genus Caulimovirus as atractylodes mild mottle virus.

Genomic detection and characterization of a Korean isolate of Little cherry virus 1 sampled from a peach tree.

A peach tree (Prunus persica) showing yellowing and mild mottle symptoms was analyzed using high-throughput RNA sequencing to determine the causal agent. A total of nine contigs similar to Little cherry virus 1 (LChV-1) were produced, and all the contigs showed nucleotide sequence identity (lower than 83 %) and query coverage (higher than 73 %) with LChV-1. The symptomatic peach sample was confirmed to be infected with LChV-1-like virus as a result of reverse transcription-polymerase chain reaction using primers designed based on sequences of the contigs. Occurrence of diseases caused by LChV-1 in Prunus species has been reported. Complete 16,931-nt genome of the peach virus composed of eight open reading frames was determined, and conserved domains including viral methyltransferase, viral helicase 1, RNA-dependent RNA polymerase (RdRp), heat shock protein 70 homologue (HSP70h), HSP90h and closterovirus coat protein (CP) were identified. Phylogenetic trees based on amino acid sequence alignments between the peach virus and members in the family Closteroviridae showed that the virus was most similar to LChV-1. Pairwise comparisons based on amino acid sequence alignments of three genes (RdRp, HSP70h and CP) between the peach virus and LChV-1 isolates showed the highest amino acid sequence identities, with 84.32 % for RdRp, 85.48 % for HSP70h and 80.45 % for CP. These results indicate that this is the first report for the presence of LChV-1 in South Korea and may be one of the first reports of natural infection of peach by LChV-1. Although it is not clear if LChV-1 YD isolate was responsible for specific symptoms observed, detection and characterization of the peach tree-infecting LChV-1 in South Korea would be useful in terms of the epidemiology of LChV-1.

Complete genome sequence and construction of infectious full-length cDNA clones of tobacco ringspot Nepovirus, a viral pathogen causing bud blight in soybean.

Tobacco ringspot virus (TRSV, genus Nepovirus), causes severe diseases in soybean and tobacco plants. TRSV-induced bud blight disease significantly reduced both the yield and quality of soybeans. The function of the encoded viral gene product involved in TRSV infection was unclear due to the limitation of reverse genetics studies on the viral genome. Here, we represent the successful construction of infectious full-length cDNA clones of TRSV genome (RNA1 and RNA2). The cDNAs of TRSV RNA1 and RNA2 were cloned into the binary vector pPZP211 immediately downstream of a double cauliflower mosaic virus 35S promoter and upstream of the nopaline synthase terminator. Seven days after agrobacterium-mediated co-inoculation of these two constructs, Nicotiana benthamiana plants developed a systemic infection with necrotic ringspot symptoms and weak stunting of the leaves, similar to that induced by natural TRSV. The systemic infection was confirmed by transmission electron microscopy and Western blot analysis. Simultaneously, soybean, tomato, and Arabidopsis ecotype Estland were mechanically inoculated with sap prepared from TRSV-agroinfiltrated N. benthamiana leaves, showing typical symptoms of bud blight, necrotic spots, and lethal systemic necrosis, respectively. The system developed herein will be an appealing way to determine TRSV viral gene functions and study host-TRSV interactions.