RESUMEN
Over the years, a number of state-of-the-art data analysis tools have been developed to provide a comprehensive analysis of data collected from gas chromatography-mass spectrometry (GC-MS). Unfortunately, the time shift problem remains unsolved in these tools. Here, we developed a novel comprehensive data analysis strategy for GC-MS-based untargeted metabolomics (AntDAS-GCMS) to perform total ion chromatogram peak detection, peak resolution, time shift correction, component registration, statistical analysis, and compound identification. Time shift correction was specifically optimized in this work. The information on mass spectra and elution profiles of compounds was used to search for inherent landmarks within analyzed samples to resolve the time shift problem across samples efficiently and accurately. The performance of our AntDAS-GCMS was comprehensively investigated by using four complex GC-MS data sets with various types of time shift problems. Meanwhile, AntDAS-GCMS was compared with advanced GC-MS data analysis tools and classic time shift correction methods. Results indicated that AntDAS-GCMS could achieve the best performance compared to the other methods.
Asunto(s)
Cromatografía de Gases y Espectrometría de Masas , Metabolómica , Cromatografía de Gases y Espectrometría de Masas/métodos , Metabolómica/métodos , Animales , Factores de Tiempo , Análisis de DatosRESUMEN
Maize (Zea mays L.) as the most important crops is globally cultivated for food, feedstuff and industrial raw materials. During August to September 2021, we carried out a survey on the soil-borne diseases of tobacco in Guizhou Province. Poorly developed maize plants were observed in the same field of root-knot nematode (RKN) infected tobacco (Nicotiana tabacum L.) in Dafang County, Bijie City (106º00'08"E, 22º24'81"N) (Figure 1A). Roots of maize plant were taken back to laboratory for nematode identification and infecting confirmation in greenhouse. Females, males, second-stage juveniles (J2s) and eggs were collected from the sampling roots and nematodes were identified based on morphological and molecular characteristics. The identification of the nematode was performed by observations of morphological characters of adults (n= 30) and molecular analysis. Perineal pattern of female showed distinct characteristics of a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. 1B). J2s hatched from eggs demonstrated the morphometric characters of body length = 433.25 µm, body width = 16.31 µm, stylet length = 10.43 µm. DGO = 3.62 µm, tail length = 52.78 µm, and hyaline tail terminus = 11.14 µm (Fig. 1C). For molecular analysis, females from infected roots of maize in fields and in Koch's postulate experiment were definitively identified via PCR using the M. arenaria species-specific markers (Far/Rarï¼TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT). PCR products of females amplification were run in the agar gel, and a PCR product of 420 bp band was identified for M. arenaria for all tested female samples (Fig. 1E). The obtained specific fragment was sequenced and submitted to GenBank with accession number of OP503512. A 100% identity of the Fare/Rare sequence with M. arenaria (Accession: GQ395518.1, J. Phytopathol. 160(2): 59-66, 2012, MZ555757.1ï¼MZ555753.1, U42342.1ï¼were found through NCBI blast. Therefore, based on morphological and molecular analysis, the nematodes from maize were determined to be M. arenaria according to the related description of (Perry et al., 2009). Koch's postulate was conducted in greenhouse by inoculation of J2 from the original population to pots containing two-week old maize seedlings (n= 15, 1000 J2/seedling) and 5 seedlings were nonincubated as controls. Plants were maintained in greenhouse at 26 to 28°C. On day 50 after inoculation, all the inoculated plants showed typical RKN symptoms such as stunting and galled roots which were similar to those observed in the field (Fig. 2A). Females, J2 and eggs were found in the roots after staining(Fig. 2B, C, D) by the method of Bybd et al. (1983), while uninoculated control plants presented normal development, confirming that Maize was a host of M. arenaria. M. arenaria is one of the most damaging plant-parasitic nematodes, which can infect many crops worldwide, resulting in great losses on the crop quality and yield. The Southern Root-Knot Nematode (M. incognita) had been known to cause root-knot nematode disease on maize in Shandong Province of China(Shi et al.,2020). As a major rotation crop, maize was recommended for the management of RKNs and most soil-born pathogens in tobacco planting systems in China. However, the findings of M. arenaria on maize demonstrates that further investigation and management strategies should be conduct. To our knowledge, this is the first report of M. arenaria parasitizing maize in Guizhou province of China.
RESUMEN
With the increased incidence of wine fraud, a fast and reliable method for wine certification has become a necessary prerequisite for the vigorous development of the global wine industry. In this study, a classification strategy based on three-dimensional fluorescence spectroscopy combined with chemometrics was proposed for oak-barrel and stainless steel tanks with oak chips aged wines. Principal component analysis (PCA), partial least squares analysis (PLS-DA), and Fisher discriminant analysis (FDA) were used to distinguish and evaluate the data matrix of the three-dimensional fluorescence spectra of wines. The results showed that FDA was superior to PCA and PLS-DA in classifying oak-barrel and stainless steel tanks with oak chips aged wines. As a general conclusion, three-dimensional fluorescence spectroscopy can provide valuable fingerprint information for the identification of oak-barrel and stainless steel tanks with oak chips aged wines, while the study will provide some theoretical references and standards for the quality control and quality assessment of oak-barrel aged wines.
Asunto(s)
Quercus , Vino , Vino/análisis , Acero Inoxidable , Quercus/química , Espectrometría de Fluorescencia , Quimiometría , Madera/químicaRESUMEN
An actinobacterial strain, designated R-N-C8T, was isolated from the rhizosphere soil of Arabidopsis thaliana collected in Yunnan Province, south-west China. Based on the results of 16S rRNA gene sequence analysis, strain R-N-C8T had highest similarity to Nocardioides terrae CGMCC 1.7056T (96.5%), Nocardioides opuntiae KCTC 19804T (96.3%) and Nocardioides currus IB-3T (96.1%), and lower than 96.0â% similarity to other members of the genus Nocardioides. Phylogenetic trees based on 16S rRNA gene sequences indicated that strain R-N-C8T formed an isolated branch with N. terrae CGMCC 1.7056T and N. opuntiae KCTC 19804T. The polar lipids contained phosphatidylglycerol, diphosphatidylglycerol, one unidentified phosphoglycolipid and four unidentified phospholipids in the cellular membrane. The major fatty acids were identified as iso-C16â:â0, anteiso-C17â:â0, iso-C17â:â0, summed feature 9 (iso-C17â:â1 ω9c and/or C16â:â0 10-methyl) and iso-C15â:â0. The predominant respiratory quinone was MK-8(H4) and ll-diaminopimelic acid was the diagnostic diamino acid in the cell-wall peptidoglycan. The genomic DNA G+C content was 70.9âmol%. The orthologous average nucleotide identiy values between N. terrae CGMCC 1.7056T, N. currus IB-3T and strain R-N-C8T were 77.1 and 75.1â%, respectively. DNA-DNA hybridization values between N. terrae CGMCC 1.7056T, N. currus IB-3T and strain R-N-C8T were 20.7 and 19.9â% respectively. Data from phenotypic and genotypic analyses supported that strain R-N-C8T represents a new species of Nocardioides, for which the name Nocardioides nematodiphilus sp. nov. is proposed. The type strain is R-N-C8T (=CGMCC 1.18723T= KCTC 49528T).
Asunto(s)
Actinomycetales , Arabidopsis , Técnicas de Tipificación Bacteriana , Composición de Base , China , ADN Bacteriano/genética , Ácidos Grasos/química , Nocardioides , Fosfolípidos/química , Filogenia , ARN Ribosómico 16S/genética , Rizosfera , Análisis de Secuencia de ADN , Microbiología del SueloRESUMEN
The comprehensive study of compound variations in released smoke during the combustion process is a great challenge in many scientific fields related to analytical chemistry like traditional Chinese medicine, environment analysis, food analysis, etc. In this work, we propose a new comprehensive strategy for efficiently and high-thoroughly characterizing compounds in the online released complex smokes: (i) A smoke capture device was designed for efficiently collecting chemical constituents to perform gas chromatography-mass spectrometry (GC-MS) based untargeted analysis. (ii) An advanced data analysis tool, AntDAS-GCMS, was used for automatically extracting compounds in the original acquired GC-MS data files. Additionally, a GC-MS data analysis guided instrumental parameter optimizing strategy was proposed for the optimization of parameters in the smoke capture device. The developed strategy was demonstrated by the study of compound variations in the smoke of traditional Chinese medicine, Artemisia argyi Levl. et Vant. The results indicated that more than 590 components showed significant differences among released smokes of various moxa velvet ratios. Finally, about 88 compounds were identified, of which phenolic compounds were the most abundant, followed by aromatics, alkenes, alcohols and furans. In conclusion, we may provide a novel approach to the studies of compounds in online released smoke.