Natural variation for gene expression responses to abiotic stress in maize.

Plants respond to abiotic stress through a variety of physiological, biochemical, and transcriptional mechanisms. Many genes exhibit altered levels of expression in response to abiotic stress, which requires concerted action of both cis- and trans-regulatory features. In order to study the variability in transcriptome response to abiotic stress, RNA sequencing was performed using 14-day-old maize seedlings of inbreds B73, Mo17, Oh43, PH207 and B37 under control, cold and heat conditions. Large numbers of genes that responded differentially to stress between parental inbred lines were identified. RNA sequencing was also performed on similar tissues of the F1 hybrids produced by crossing B73 and each of the three other inbred lines. By evaluating allele-specific transcript abundance in the F1 hybrids, we were able to measure the abundance of cis- and trans-regulatory variation between genotypes for both steady-state and stress-responsive expression differences. Although examples of trans-regulatory variation were observed, cis-regulatory variation was more common for both steady-state and stress-responsive expression differences. The genes with cis-allelic variation for response to cold or heat stress provided an opportunity to study the basis for regulatory diversity.

Transposable elements contribute to activation of maize genes in response to abiotic stress.

Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as "junk" DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize.

RNA-directed DNA methylation enforces boundaries between heterochromatin and euchromatin in the maize genome.

The maize genome is relatively large (∼ 2.3 Gb) and has a complex organization of interspersed genes and transposable elements, which necessitates frequent boundaries between different types of chromatin. The examination of maize genes and conserved noncoding sequences revealed that many of these are flanked by regions of elevated asymmetric CHH (where H is A, C, or T) methylation (termed mCHH islands). These mCHH islands are quite short (∼ 100 bp), are enriched near active genes, and often occur at the edge of the transposon that is located nearest to genes. The analysis of DNA methylation in other sequence contexts and several chromatin modifications revealed that mCHH islands mark the transition from heterochromatin-associated modifications to euchromatin-associated modifications. The presence of an mCHH island is fairly consistent in several distinct tissues that were surveyed but shows some variation among different haplotypes. The presence of insertion/deletions in promoters often influences the presence and position of an mCHH island. The mCHH islands are dependent upon RNA-directed DNA methylation activities and are lost in mop1 and mop3 mutants, but the nearby genes rarely exhibit altered expression levels. Instead, loss of an mCHH island is often accompanied by additional loss of DNA methylation in CG and CHG contexts associated with heterochromatin in nearby transposons. This suggests that mCHH islands and RNA-directed DNA methylation near maize genes may act to preserve the silencing of transposons from activity of nearby genes.

Genomic distribution of maize facultative heterochromatin marked by trimethylation of H3K27.

Trimethylation of histone H3 Lys-27 (H3K27me3) plays a critical role in regulating gene expression during plant and animal development. We characterized the genome-wide distribution of H3K27me3 in five developmentally distinct tissues in maize (Zea mays) plants of two genetic backgrounds, B73 and Mo17. There were more substantial differences in the genome-wide profile of H3K27me3 between different tissues than between the two genotypes. The tissue-specific patterns of H3K27me3 were often associated with differences in gene expression among the tissues and most of the imprinted genes that are expressed solely from the paternal allele in endosperm are targets of H3K27me3. A comparison of the H3K27me3 targets in rice (Oryza sativa), maize, and Arabidopsis thaliana provided evidence for conservation of the H3K27me3 targets among plant species. However, there was limited evidence for conserved targeting of H3K27me3 in the two maize subgenomes derived from whole-genome duplication, suggesting the potential for subfunctionalization of chromatin regulation of paralogs. Genomic profiling of H3K27me3 in loss-of-function mutant lines for Maize Enhancer of zeste-like2 (Mez2) and Mez3, two of the three putative H3K27me3 methyltransferases present in the maize genome, suggested partial redundancy of this gene family for maintaining H3K27me3 patterns. Only a portion of the targets of H3K27me3 required Mez2 and/or Mez3, and there was limited evidence for functional consequences of H3K27me3 at these targets.

Spreading of heterochromatin is limited to specific families of maize retrotransposons.

Transposable elements (TEs) have the potential to act as controlling elements to influence the expression of genes and are often subject to heterochromatic silencing. The current paradigm suggests that heterochromatic silencing can spread beyond the borders of TEs and influence the chromatin state of neighboring low-copy sequences. This would allow TEs to condition obligatory or facilitated epialleles and act as controlling elements. The maize genome contains numerous families of class I TEs (retrotransposons) that are present in moderate to high copy numbers, and many are found in regions near genes, which provides an opportunity to test whether the spreading of heterochromatin from retrotransposons is prevalent. We have investigated the extent of heterochromatin spreading into DNA flanking each family of retrotransposons by profiling DNA methylation and di-methylation of lysine 9 of histone 3 (H3K9me2) in low-copy regions of the maize genome. The effects of different retrotransposon families on local chromatin are highly variable. Some retrotransposon families exhibit enrichment of heterochromatic marks within 800-1,200 base pairs of insertion sites, while other families exhibit very little evidence for the spreading of heterochromatic marks. The analysis of chromatin state in genotypes that lack specific insertions suggests that the heterochromatin in low-copy DNA flanking retrotransposons often results from the spreading of silencing marks rather than insertion-site preferences. Genes located near TEs that exhibit spreading of heterochromatin tend to be expressed at lower levels than other genes. Our findings suggest that a subset of retrotransposon families may act as controlling elements influencing neighboring sequences, while the majority of retrotransposons have little effect on flanking sequences.

Parent-of-origin effects on gene expression and DNA methylation in the maize endosperm.

Imprinting describes the differential expression of alleles based on their parent of origin. Deep sequencing of RNAs from maize (Zea mays) endosperm and embryo tissue 14 d after pollination was used to identify imprinted genes among a set of ~12,000 genes that were expressed and contained sequence polymorphisms between the B73 and Mo17 genotypes. The analysis of parent-of-origin patterns of expression resulted in the identification of 100 putative imprinted genes in maize endosperm, including 54 maternally expressed genes (MEGs) and 46 paternally expressed genes (PEGs). Three of these genes have been previously identified as imprinted, while the remaining 97 genes represent novel imprinted maize genes. A genome-wide analysis of DNA methylation identified regions with reduced endosperm DNA methylation in, or near, 19 of the 100 imprinted genes. The reduced levels of DNA methylation in endosperm are caused by hypomethylation of the maternal allele for both MEGs and PEGs in all cases tested. Many of the imprinted genes with reduced DNA methylation levels also show endosperm-specific expression patterns. The imprinted maize genes were compared with imprinted genes identified in genome-wide screens of rice (Oryza sativa) and Arabidopsis thaliana, and at least 10 examples of conserved imprinting between maize and each of the other species were identified.

Aneuploidy causes tissue-specific qualitative changes in global gene expression patterns in maize.

Segmental aneuploidy refers to the relative excess or deficiency of specific chromosome regions. This condition results in gene dosage imbalance and often causes severe phenotypic alterations in plants and animals. The mechanisms by which gene dosage imbalance affects gene expression and phenotype are not completely clear. The effects of aneuploidy on the transcriptome may depend on the types of cells analyzed and on the developmental stage. We performed global gene expression profiling to determine the effects of segmental aneuploidy on gene expression levels in two different maize (Zea mays) tissues and a detailed analysis of expression of 30 genes affected by aneuploidy in multiple maize tissues. Different maize tissues varied in the frequency at which genes located outside of the aneuploid regions are positively or negatively regulated as well as in the degree of gene dosage compensation. Multiple genes demonstrated qualitative changes in gene expression due to aneuploidy, when the gene became ectopically expressed or completely silenced in aneuploids relative to wild-type plants. Our data strongly suggested that quantitative changes in gene expression at developmental transition points caused by variation in gene copy number progressed through tissue development and resulted in stable qualitative changes in gene expression patterns. Thus, aneuploidy in maize results in alterations of gene expression patterns that differ between tissues and developmental stages of maize seedlings.

QTL mapping of seedling tolerance to exposure to low temperature in the maize IBM RIL population.

Maize is a cold sensitive crop that exhibits severe retardation of growth and development when exposed to cold spells during and right after germination, including the slowdown in development of new leaves and in formation of the photosynthetic apparatus. Improving cold tolerance in maize would allow early sowing to improve crop yield by prolonging a growing season and by decreasing the negative effects of summer drought, diseases, and pests. Two maize inbreds widely incorporated into American maize germplasm, B73 and Mo17, exhibit different levels of tolerance to low temperature exposure at seedling stage. In addition, thirty seven diverse inbred maize lines showed large variation for seedling response to low temperature exposure with lines with extremely low tolerance to seedling exposure to low temperatures falling into stiff stalk, non-stiff stalk, and tropical clades. We employed the maize intermated B73×Mo17 (IBM) recombinant inbred line population (IBM Syn4 RIL) to investigate the genetic architecture of cold stress tolerance at a young seedling stage and to identify quantitative trait loci (QTLs) controlling this variation. A panel of 97 recombinant inbred lines of IBM Syn4 were used to measure, and score based on several traits related to chlorophyll concentration, leaf color, and tissue damage. Our analysis resulted in detection of two QTLs with high additive impact, one on chromosome 1 (bin 1.02) and second on chromosome 5 (bin 5.05). Further investigation of the QTL regions using gene expression data provided a list of the candidate genes likely contributing to the variation in cold stress response. Among the genes located within QTL regions identified in this study and differentially expressed in response to low temperature exposure are the genes with putative functions related to auxin and gibberellin response, as well as general abiotic stress response, and genes coding for proteins with broad regulatory functions.

Profiling expression changes caused by a segmental aneuploid in maize.

BACKGROUND: While changes in chromosome number that result in aneuploidy are associated with phenotypic consequences such as Down syndrome and cancer, the molecular causes of specific phenotypes and genome-wide expression changes that occur in aneuploids are still being elucidated. RESULTS: We employed a segmental aneuploid condition in maize to study phenotypic and gene expression changes associated with aneuploidy. Maize plants that are trisomic for 90% of the short arm of chromosome 5 and monosomic for a small distal portion of the short arm of chromosome 6 exhibited a phenotypic syndrome that includes reduced stature, tassel morphology changes and the presence of knots on the leaves. The knotted-like homeobox gene knox10, which is located on the short arm of chromosome 5, was shown to be ectopically expressed in developing leaves of the aneuploid plants. Expression profiling revealed that approximately 40% of the expressed genes in the trisomic region exhibited the expected 1.5 fold increased transcript levels while the remaining 60% of genes did not show altered expression even with increased gene dosage. CONCLUSION: We found that the majority of genes with altered expression levels were located within the chromosomal regions affected by the segmental aneuploidy and exhibits dosage-dependent expression changes. A small number of genes exhibit higher levels of expression change not predicted by the dosage, or display altered expression even though they are not located in the aneuploid regions.

Natural variation for alleles under epigenetic control by the maize chromomethylase zmet2.

The contribution of epigenetic alterations to natural variation for gene transcription levels remains unclear. In this study, we investigated the functional targets of the maize chromomethylase ZMET2 in multiple inbred lines to determine whether epigenetic changes conditioned by this chromomethylase are conserved or variable within the species. Gene expression microarrays were hybridized with RNA samples from the inbred lines B73 and Mo17 and from near-isogenic derivatives containing the loss-of-function allele zmet2-m1. A set of 126 genes that displayed statistically significant differential expression in zmet2 mutants relative to wild-type plants in at least one of the two genetic backgrounds was identified. Analysis of the transcript levels in both wild-type and mutant individuals revealed that only 10% of these genes were affected in zmet2 mutants in both B73 and Mo17 genetic backgrounds. Over 80% of the genes with expression patterns affected by zmet2 mutations display variation for gene expression between wild-type B73 and Mo17 plants. Further analysis was performed for 7 genes that were transcriptionally silent in wild-type B73, but expressed in B73 zmet2-m1, wild-type Mo17, and Mo17 zmet2-m1 lines. Mapping experiments confirmed that the expression differences in wild-type B73 relative to Mo17 inbreds for these genes were caused by cis-acting regulatory variation. Methylation-sensitive PCR and bisulfite sequencing demonstrated that for 5 of these genes the CpNpG methylation in the wild-type B73 genetic background was substantially decreased in the B73 zmet2-m1 mutant and in wild-type Mo17. A survey of eight maize inbreds reveals that each of these 5 genes exhibit transcriptionally silent and methylated states in some inbred lines and unmethylated, expressed states in other inbreds, providing evidence for natural variation in epigenetic states for some maize genes.

Killing two birds with one stone: Model plant systems as a tool to teach the fundamental concepts of gene expression while analyzing biological data.

Plants are ideal systems to teach core biology concepts due to their unique physiological and developmental features. Advances in DNA sequencing technology and genomics have allowed scientists to generate genome sequences and transcriptomics data for numerous model plant species. This information is publicly available and presents a valuable tool to introduce undergraduate students to the fundamental concepts of gene expression in the context of modern quantitative biology and bioinformatics. Modern biology classrooms must provide authentic research experiences to allow developing core competencies such as scientific inquiry, critical interpretation of experimental results, and quantitative analyses of large dataset using computational approaches. Recent educational research has shown that undergraduate students struggle when connecting gene expression concepts to classic genetics, phenotypic analyses, and overall flow of biological information in living organisms, suggesting that novel approaches are necessary to enhance learning of gene expression and regulation. This review describes different strategies and resources available to instructors willing to incorporate authentic research experiences, genomic tools, and bioinformatics analyses when teaching transcriptional regulation and gene expression in undergraduate courses. A variety of laboratory exercises and pedagogy materials developed to teach gene expression using plants are discussed. This article is part of a Special Issue entitled: Plant Gene Regulatory Mechanisms and Networks, edited by Dr. Erich Grotewold and Dr. Nathan Springer.

Transgene integration in plants: poking or patching holes in promiscuous genomes?

Transgene integration in plants transformed by either Agrobacterium or direct DNA delivery methods occurs through illegitimate recombination (IR). The precise mechanism(s) for IR-mediated transgene integration and the role of host double-strand break repair enzymes remain unknown. A recent wealth of sequenced transgene loci and investigations aimed at genetically dissecting transgene integration mechanism(s) have provided new insights into the process.

Authentic Research Experience and "Big Data" Analysis in the Classroom: Maize Response to Abiotic Stress.

Integration of inquiry-based approaches into curriculum is transforming the way science is taught and studied in undergraduate classrooms. Incorporating quantitative reasoning and mathematical skills into authentic biology undergraduate research projects has been shown to benefit students in developing various skills necessary for future scientists and to attract students to science, technology, engineering, and mathematics disciplines. While large-scale data analysis became an essential part of modern biological research, students have few opportunities to engage in analysis of large biological data sets. RNA-seq analysis, a tool that allows precise measurement of the level of gene expression for all genes in a genome, revolutionized molecular biology and provides ample opportunities for engaging students in authentic research. We developed, implemented, and assessed a series of authentic research laboratory exercises incorporating a large data RNA-seq analysis into an introductory undergraduate classroom. Our laboratory series is focused on analyzing gene expression changes in response to abiotic stress in maize seedlings; however, it could be easily adapted to the analysis of any other biological system with available RNA-seq data. Objective and subjective assessment of student learning demonstrated gains in understanding important biological concepts and in skills related to the process of science.

Brd1 gene in maize encodes a brassinosteroid C-6 oxidase.

The role of brassinosteroids in plant growth and development has been well-characterized in a number of plant species. However, very little is known about the role of brassinosteroids in maize. Map-based cloning of a severe dwarf mutant in maize revealed a nonsense mutation in an ortholog of a brassinosteroid C-6 oxidase, termed brd1, the gene encoding the enzyme that catalyzes the final steps of brassinosteroid synthesis. Homozygous brd1-m1 maize plants have essentially no internode elongation and exhibit no etiolation response when germinated in the dark. These phenotypes could be rescued by exogenous application of brassinolide, confirming the molecular defect in the maize brd1-m1 mutant. The brd1-m1 mutant plants also display alterations in leaf and floral morphology. The meristem is not altered in size but there is evidence for differences in the cellular structure of several tissues. The isolation of a maize mutant defective in brassinosteroid synthesis will provide opportunities for the analysis of the role of brassinosteroids in this important crop system.

Mapping maize genes: a series of research-based laboratory exercises.

Open-ended, inquiry-based multiweek laboratory exercises are the key elements to increasing students' understanding and retention of the major biological concepts. Including original research into undergraduate teaching laboratories has also been shown to motivate students and improve their learning. Here, we present a series of original laboratory exercises on fine mapping novel maize mutations producing interesting phenotypes. In this 4-week lab series, students get involved in the whole process of identifying novel genes controlling specific phenotypes, from phenotype characterization and choosing appropriate molecular markers to calculating the genetic distance between the mutation and the marker and finding possible candidate genes using a complete genome sequence. We chose to use maize mutant lines produced by TILLING project. These lines have been partially mapped to a chromosomal bin by a high-throughput bulk segregant analysis; however, the exact map positions for these mutations have never been determined. Mapping these novel maize mutations provides students with the opportunity to conduct original research as a part of their classroom experience and to contribute to the field of maize genetics. The laboratory series was well received by the students, and the assessment results demonstrated an improvement of student learning of gene mapping, molecular marker analysis, and positional cloning concepts.

Studying gene expression: database searches and promoter fusions to investigate transcriptional regulation in bacteria.

A laboratory project was designed to illustrate how to search biological databases and utilize the information provided by these resources to investigate transcriptional regulation in Escherichia coli. The students searched several databases (NCBI Genomes, RegulonDB and EcoCyc) to learn about gene function, regulation, and the organization of transcriptional units. A fluorometer and GFP promoter fusions were used to obtain fluorescence data and measure changes in transcriptional activity. The class designed and performed experiments to investigate the regulation of genes necessary for biosynthesis of amino acids and how expression is affected by environmental signals and transcriptional regulators. Assessment data showed that this activity enhanced students' knowledge of databases, reporter genes and transcriptional regulation.

High-throughput genetic mapping of mutants via quantitative single nucleotide polymorphism typing.

Advances in next-generation sequencing technology have facilitated the discovery of single nucleotide polymorphisms (SNPs). Sequenom-based SNP-typing assays were developed for 1359 maize SNPs identified via comparative next-generation transcriptomic sequencing. Approximately 75% of these SNPs were successfully converted into genetic markers that can be scored reliably and used to generate a SNP-based genetic map by genotyping recombinant inbred lines from the intermated B73 x Mo17 population. The quantitative nature of Sequenom-based SNP assays led to the development of a time- and cost-efficient strategy to genetically map mutants via quantitative bulked segregant analysis. This strategy was used to rapidly map the loci associated with several dozen recessive mutants. Because a mutant can be mapped using as few as eight multiplexed sets of SNP assays on a bulk of as few as 20 mutant F(2) individuals, this strategy is expected to be widely adopted for mapping in many species.

Association of Arabidopsis topoisomerase IIA cleavage sites with functional genomic elements and T-DNA loci.

Topoisomerase IIA (Topo IIA) is an essential ubiquitous enzyme involved in controlling DNA topology during multiple processes of genome function, and has been implicated in the generation of double-stranded breaks (DSB) in genomic DNA prior to DNA integration in plant genomes. Despite extensive characterization of type II topoisomerases from bacteria, viruses and animals, no studies on the specificity of plant Topo IIA-mediated DNA cleavage have been reported. We mapped and characterized Arabidopsis thaliana Topo IIA (AtTopoIIA) cleavage sites and demonstrated that they were cleaved in vivo. The consensus for the AtTopoIIA cleavage sites (ANNNRN downward arrowGTACNTNNNY) was significantly different from recognition sequences reported for Topo IIA from other organisms. The mapped cleavage sites were abundant in the Arabidopsis genome, exhibited a weak consensus, and were cleaved with relatively low efficiency. Use of the systematic evolution of ligands by exponential enrichment (SELEX) protocol identified a single, efficiently cleaved sequence TATATATATGTATATATATA that was over-represented in the genome. The mapped AtTopoIIA cleavage sites and the SELEX sites differed in their genomic distribution and associations with gene regulatory elements, matrix attachment regions, stress-induced DNA duplex destabilization sequences and T-DNA loci, suggesting different genome functions. Mapped AtTopoIIA sites but not SELEX sites were strongly associated with T-DNA integration sites, providing evidence for the involvement of AtTopoIIA-mediated DSB formation in T-DNA integration.

Complex transgene locus structures implicate multiple mechanisms for plant transgene rearrangement.

To more fully characterize the internal structure of transgene loci and to gain further understanding of mechanisms of transgene locus formation, we sequenced more than 160 kb of complex transgene loci in two unrelated transgenic oat (Avena sativa L.) lines transformed using microprojectile bombardment. The transgene locus sequences from both lines exhibited extreme scrambling of non-contiguous transgene and genomic fragments recombined via illegitimate recombination. A perfect direct repeat of the delivered DNA, and inverted and imperfect direct repeats were detected in the same transgene locus indicating that homologous recombination and synthesis-dependent mechanism(s), respectively, were also involved in transgene locus rearrangement. The most unexpected result was the small size of the fragments of delivered and genomic DNA incorporated into the transgene loci via illegitimate recombination; 50 of the 82 delivered DNA fragments were shorter than 200 bp. Eleven transgene and genomic fragments were shorter than the DNA lengths required for Ku-mediated non-homologous end joining. Detection of these small fragments provided evidence that illegitimate recombination was most likely mediated by a synthesis-dependent strand-annealing mechanism that resulted in transgene scrambling. Taken together, these results indicate that transgene locus formation involves the concerted action of several DNA break-repair mechanisms.