RESUMEN
Mental health task shifting is a potential way to address the burgeoning treatment gap for mental illness. Easily available and accessible digital technology can be utilised to continuously engage grassroot level health workers (for example, Accredited Social Health Activists (ASHAs). However, the impact of such a strategy is not yet systematically evaluated. In this randomised controlled trial, longitudinal hybrid training of ASHAs [1 day in-person classroom training and seven online sessions (ECHO model), aimed to screen and refer to commonly prevalent mental health issues in communities] was compared with traditional one-day in-person classroom training. ASHAs (n = 75) from six Primary Health Centres in Ramanagara district, Karnataka, India were randomized into study (SG-ASHAs) and control (CG-ASHAs) groups. After excluding drop-outs, 26 ASHAs in each group were included in the final analysis of the scores on their Knowledge, attitude, and practices (KAP) in mental health. Two house-to-house surveys were conducted by both groups to identify and refer possible cases. The number of screen positives (potential persons with mental illnesses) and the KAP scores formed the outcome measures. Online sessions for SG-ASHAs were completed over 18 months, the COVID-19 pandemic being the main disruptor. SG-ASHAs identified significantly higher number of persons with potential alcohol use disorders [n = 873 (83%); p ≤ 0.001] and common mental disorders [n = 96(4%); p = 0.018], while CG-ASHAs identified significantly higher number of those with potential severe mental disorders [n = 61(61.61%); p ≤ 0.001]. As regards KAP, after controlling for baseline scores, the time effect in RMANOVA favoured SG-ASHAs. Mean total KAP score increased from 16.76 to18.57 (p < 0·01) in SG-ASHAs and from 18.65 to 18.84 (p = 0.76) in CG-ASHAs. However, the Time-group interaction effect did not favour either (F = 0.105; p = 0.748). Compared to traditional training, mentoring ASHAs for extended periods is more impactful. Easily accessible digital technology makes the latter feasible. Scaling up such initiatives carry the potential to considerably improve treatment access for those in need.
Asunto(s)
Alcoholismo , COVID-19 , Humanos , Salud Mental , Pandemias , India , Tecnología , Agentes Comunitarios de Salud/educaciónRESUMEN
Berseem (Trifolium alexandrinum) is a winter season legume fodder crop widely cultivated in the central and northern parts of India. It is considered the 'King of fodder' for its high quality green fodder, which is a rich source of protein and low in fibre. Symptoms similar to collar rot were observed in experimental sites at the ICAR-Indian Grassland and Fodder Research institute (IGFRI), Jhansi (N25º 52' 749.20â³, E78º 55' 452.70â³), Uttar Pradesh, India in March 2019. The incidence of disease was ranged from 18 to 22% during 2019. Symptoms included dark colored water-soaked lesions at the base of stems, stem thinning (resembles wire stem) and eventually wilting of the whole plant. A white mycelial mat was observed on the stem and collar region and light brown to tan colored sclerotial bodies formed as disease progressed. To determine the etiology of the infection, 30 diseased plants with typical symptoms were collected from the 3 different fields and used for the isolation of causal agent. Infected stem portion were cut in to small pieces (5mm), surface sterilized with 2% sodium hypochlorite (NaOCl) for 2 minutes, washed three times with sterile distilled water and air dried. The sterilized infected tissues were cultured on potato dextrose agar amended with streptomycin sulphate @ 50µg/ml and incubated at 28±1º C for 3 days. After four days, hyaline septate mycelia ranging 2-3µm in diameter grow radially over the whole plate (90 mm). Sclerotia formation started 6 days after incubation. Sclerotia were initially white and later turned brownish to tan as they matured. The number of sclerotia per plate ranged from 55 to 120 (n=5) at 12 days after inoculation. The diameter of matured sclerotial bodies ranged from 0.1mm to 1.35mm (n=25). Genomic DNA was extracted from mycelium using the CTAB method (Murray and Thompson, 1980). Three regions of rDNA viz., internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) were used to identify the etiology of the disease. The isolate was amplified with ITS1 (5'CGGATCTCTTGGTTCTGGGA3')/ ITS4 (5'GACGCTCGAACATGCC3') described by White et al. (1990) and sequenced. The ITS sequence (NCBI GenBank Accession No: MT026581) showed 98.21 % similar to Athelia rolfsii (MH514001.1). The isolate also amplified with primers LSU (LROR: ACCCGCTGAACTTAAGC/ LR5: TCCTGAGGGAAACTTCG) and SSU (NS1: GTAGTCATATGCTTGTCTC/ NS4: CTTCCGTCAATTCCTTTAAG). The LSU (MT225781) and SSU (MT225782) sequences showed 99.90 % and 100 % similarity to Athelia rolfsii (AY635773.1) and Athelia rolfsii (AY635773.1) respectively. Based on the morphological and molecular characteristics, the pathogen responsible for collar rot in berseem was identified as Athelia rolfsii (Anamorph: Sclerotium rolfsii) (Mordue, 1974). To confirm pathogenicity, inoculum was prepared by inoculating mycelial plugs of pathogen into autoclaved corn sand meal (5:95) and incubated at 28±1º C for 12 days. The inoculum (30g) was placed at stem portion of 15 day old seedlings (n=30) of berseem (Cv. Wardan) raised in pots filled with sterilized soil. Seedlings (n=25) inoculated with sterilized corn sand meal (30g) served as the control. The pots were placed inside of a plant growth chamber (26±2º C, 65% RH) for 15 days. Water soaked spots with white mycelium were observed on the collar region after 3 days. After 7 days, stems were completely covered by mycelia and death of seedlings was observed 14 days after inoculation. The pathogen was recovered from the artificially inoculated berseem seedlings (n=15). No symptoms were observed in control plants. Based on morphological and molecular characterization, the present isolate was confirmed as Sclerotium rolfsii. To the best of our knowledge, this is the first report of S. rolfsii causing collar rot of berseem in India.
RESUMEN
OBJECTIVE: To compare the effects of inhaled milrinone and levosimendan on pulmonary and systemic hemodynamics in patients with pulmonary hypertension. DESIGN: Prospective, double-blind, randomized controlled study. SETTING: Tertiary care cardiac institute with 650 beds. PARTICIPANTS: The study comprised 150 adult patients with pulmonary hypertension undergoing mitral valve surgery. INTERVENTIONS: Patients were assigned randomly into 1 of the following 3 groups: milrinone (M), levosimendan (L), or control (C); n = 50 per group. In group M, inhaled milrinone (50 µg/kg); in group L, inhaled levosimendan (24 µg/kg); and in group C, normal saline was administered when the patient arrived in the recovery room. Pre-inhalation and post-inhalation hemodynamics (mean arterial pressure [MAP], pulse rate, and systemic vascular resistance [SVR]) were noted until 24 hours of inhalation of the drug. The change in pulmonary artery pressures (pulmonary artery systolic pressure [PASP] and mean pulmonary artery pressure [MPAP]) and the duration for which they remained decreased compared with the control group, were noted. MEASUREMENTS AND MAIN RESULTS: MAP, pulse rate, and SVR were comparable in the 3 groups at various time intervals. PASP and MPAP decreased comparably after inhalation of levosimendan and milrinone. However, they reached levels near the control group values after 2.5 to 3 hours in group L and after 0.5 hours in group M. CONCLUSIONS: Because inhaled levosimendan causes a decrease in PASP and MPAP without causing a decrease in SVR and MAP, the authors conclude that inhaled levosimendan is a selective pulmonary vasodilator. It is as effective as milrinone in reducing pulmonary artery pressures. In addition, it has advantage over inhaled milrinone because it is has a longer duration of action.
Asunto(s)
Enfermedades de las Válvulas Cardíacas/cirugía , Hipertensión Pulmonar/terapia , Milrinona/administración & dosificación , Válvula Mitral/cirugía , Presión Esfenoidal Pulmonar/efectos de los fármacos , Simendán/administración & dosificación , Resistencia Vascular/efectos de los fármacos , Administración por Inhalación , Adulto , Presión Sanguínea/efectos de los fármacos , Cardiotónicos/administración & dosificación , Relación Dosis-Respuesta a Droga , Método Doble Ciego , Femenino , Estudios de Seguimiento , Enfermedades de las Válvulas Cardíacas/complicaciones , Enfermedades de las Válvulas Cardíacas/fisiopatología , Humanos , Hipertensión Pulmonar/etiología , Hipertensión Pulmonar/fisiopatología , Masculino , Proyectos Piloto , Estudios Prospectivos , Resultado del TratamientoRESUMEN
The present study relates to the food processing machinery and, more specifically machine for producing boneless comminuted meat from raw fish fillet. This machine is of belt and drum type meat bone separator designed for small scale fish processing in a continuous mode. The basic principal involved in this machine is compression force. The electric geared motor consists of 1HP and the conveyor belt has a linear velocity of 19 to 22 m min(-1), which was sufficient to debone the fish effectively. During the meat bone separation trials an efficiency up to 75 % on dressed fish weight basis was observed and with a capacity to separate 70 kg h(-1) of meat from fish at the machine speed of 25 rpm. During the trials, it was demonstrated that there was no significant change in the proximate composition of comminuted fish meat when compared to unprocessed fish meat. This design has a greater emphasis on hygiene, provision for cleaning-in-place (CIP) and gives cost effective need and reliability for small scale industries to produce fish meat in turn used for their value added products.
RESUMEN
This research aims to investigate the potential of utilizing pomegranate peel powder (PPP) as a natural preservative in muffin preparation. Pomegranate peel is a rich source of bioactive compounds, including phenolics, flavonoids, and tannins, which possess high antioxidant and antimicrobial properties. The In-Vitro antifungal activity of pomegranate peel powder (8% PPP), potassium sorbate (0.1% PS) and calcium propionate (0.5% CP) was assessed against Penicillium sp. and Aspergillus sp. using poison food technique. The PPP showed the anti-fungal activity by delaying the growth of microorganism on media plate similar to the PS and CP. The effect of utilization of PPP on quality characteristics of muffins were compared with the muffins with chemical preservatives (0.1% PS and 0.5% CP). The viscosity and specific gravity of batter significantly increased from 7.98 to 11.87 Pa s and 1.089-1.398 respectively on addition of 8% PPP. The optical microscopic structure of PPP added batter revealed the decrease in the number of air cells from 24 to 12 with radius range of 6.42-72.72 µm and area range of 511.03-15,383.17 µm2. The functional properties of flour with PPP had higher water absorption capacity, foaming stability, emulsification activity and emulsion stability than others. The addition of PPP significantly increase the weight (32.83 g), and decrease the height (31.3 mm), volume (61.43 cm3), specific volume (1.67 cm3/g) and baking loss (10.19%). The 418.36% increase in fibre content, 14.46% and 18.46% decrease in carbohydrates and energy value was observed in muffin with 8% PPP as compared to control respectively. The total phenols was increased from 0.92 to 12.5 mg GAE/100 g, total tannin from 0.2 to 8.27 mg GAE/100 g, In-vitro antioxidant activity by DPPH from 6.97 to 29.34% and In-vitro antioxidant activity by FRAP from 0.497 to 2.934 mg AAE/100 g in muffins added with 8% PPP. The muffin with PPP was softer than control and muffin with 0.1% PS. The addition of PPP resulted to improve in muffin texture but taste slightly bitter. During the storage of muffins at room temperature (27-30 °C), the moisture content of muffin with PPP was reduced from 17.04 to 13.23% which was higher than the rest of the treatments. Similarly, the hardness of sample with PPP was higher than the sample with 0.5% CP, but lowers than control and sample with 0.1% PS throughout the storage period. The results suggest that pomegranate peel powder can be successfully used as a natural preservative in place of chemical preservatives in muffins, to extend the shelf life. This study provides the opportunity to use PPP as functional ingredient and natural preservative in different bakery products.
Asunto(s)
Conservación de Alimentos , Conservantes de Alimentos , Granada (Fruta) , Polvos , Conservantes de Alimentos/farmacología , Conservantes de Alimentos/química , Granada (Fruta)/química , Conservación de Alimentos/métodos , Penicillium/efectos de los fármacos , Antioxidantes/farmacología , Antioxidantes/química , Antifúngicos/farmacología , Antifúngicos/química , Aspergillus/efectos de los fármacos , Aspergillus/crecimiento & desarrollo , Frutas/química , Almacenamiento de Alimentos/métodos , Extractos Vegetales/farmacología , Extractos Vegetales/químicaRESUMEN
All 10 genome segments (Seg-1 to 10-a total of 19,188 bp) were sequenced from a strain of bluetongue virus serotype 3 (BTV-3) from India (strain IND2003/08). Sequence comparisons showed that nine of the genome segments from this virus group with other eastern topotype strains. Genome Seg-2 and Seg-6 group with eastern BTV-3 strains from Japan. However, Seg-5 (the NS1 gene) from IND2003/08 belongs to a western lineage, demonstrating that IND2003/08 is a reassortant between eastern and western topotype bluetongue viruses. This confirms that western BTV strains have been imported and are circulating within the subcontinent.
Asunto(s)
Virus de la Lengua Azul/genética , Genoma Viral , ARN Viral/genética , Virus Reordenados/genética , Análisis de Secuencia de ADN , Animales , Virus de la Lengua Azul/aislamiento & purificación , India , Datos de Secuencia Molecular , Filogenia , Virus Reordenados/aislamiento & purificación , Homología de SecuenciaRESUMEN
The full genome sequence (19,177 bp) of an Indian strain (IND1988/02) of bluetongue virus (BTV) serotype 23 was determined. This virus was isolated from a sheep that had been killed during a severe bluetongue outbreak that occurred in Rahuri, Maharashtra State, western India, in 1988. Phylogenetic analyses of these data demonstrate that most of the genome segments from IND1988/02 belong to the major "eastern" BTV topotype. However, genome segment 5 belongs to the major "western" BTV topotype, demonstrating that IND1988/02 is a reassortant. This may help to explain the increased virulence that was seen during this outbreak in 1988. Genome segment 5 of IND1988/02 shows >99% sequence identity with some other BTV isolates from India (e.g., BTV-3 IND2003/08), providing further evidence of the existence and circulation of reassortant strains on the subcontinent.
Asunto(s)
Virus de la Lengua Azul/genética , Lengua Azul/virología , Genoma Viral , Virus Reordenados/genética , Animales , Secuencia de Bases , Virus de la Lengua Azul/clasificación , Virus de la Lengua Azul/aislamiento & purificación , India , Datos de Secuencia Molecular , Virus Reordenados/clasificación , Virus Reordenados/aislamiento & purificación , OvinosRESUMEN
Bluetongue virus type 2, isolated in India in 1982 (IND1982/01), was obtained from the Orbivirus Reference Collection at IAH Pirbright (http://www.reoviridae.org/dsRNA_virus_proteins/ReoID/btv-2.htm#IND1982/01). Full genome sequencing and phylogenetic analyses show that IND1982/01 is a reassortant virus containing genome segments derived from both eastern and western topotypes. These data will help to identify further reassortment events involving this or other virus lineages in the subcontinent.
Asunto(s)
Virus de la Lengua Azul/genética , Lengua Azul/virología , Genoma Viral , Recombinación Genética , Animales , Secuencia de Bases , Virus de la Lengua Azul/clasificación , Virus de la Lengua Azul/aislamiento & purificación , India , Datos de Secuencia Molecular , Filogenia , RumiantesRESUMEN
Bluetongue virus is the type species of the genus Orbivirus in the family Reoviridae. We report the first complete genome sequence of an isolate (IND2004/01) of bluetongue virus serotype 10 (BTV-10) from Andhra Pradesh, India. This isolate, which is stored in the Orbivirus Reference Collection (ORC) at IAH Pirbright, shows >99% nucleotide identity in all 10 genome segments with a vaccine strain of BTV-10 from the United States.
Asunto(s)
Virus de la Lengua Azul/genética , Lengua Azul/virología , Genoma Viral , Secuencia de Bases , Virus de la Lengua Azul/clasificación , Virus de la Lengua Azul/aislamiento & purificación , India , Datos de Secuencia Molecular , Estados Unidos , Vacunas Virales/genéticaRESUMEN
Bluetongue virus serotype 2 (IND2003/02) was isolated in Tiruneveli City, Tamil Nadu State, India, and is stored in the Orbivirus Reference Collection at the Institute for Animal Health, Pirbright, United Kingdom. The entire genome of this isolate was sequenced, showing that it is composed of a total of 19,203 bp (all 10 genome segments). This is the first report of the entire genome sequence of a western strain of BTV-2 isolated in India, indicating that this virus has been introduced and is circulating in the region. These data will aid in the development of diagnostics and molecular epidemiology studies of BTV-2 in the subcontinent.
Asunto(s)
Virus de la Lengua Azul/genética , Genoma Viral , Animales , Virus de la Lengua Azul/aislamiento & purificación , India , Anotación de Secuencia Molecular , Datos de Secuencia MolecularRESUMEN
We report the full-genome sequence of an Indian isolate of bluetongue virus serotype 1 (BTV-1), strain IND1992/01. This is the first report of the entire genome sequence (Seg-1 to Seg-10) of an Eastern (e) strain of BTV-1. These sequence data provide a reference for BTV-1e that will help to define the phylogenetic relationships and geographic origins of distinct Indian lineages of BTV-1 as well as their relationships with other BTV strains from around the world. The availability of data for all 10 genome segments of this strain will also help to identify reassortment events involving this and other virus lineages.
Asunto(s)
Virus de la Lengua Azul/clasificación , Virus de la Lengua Azul/genética , Genoma Viral , India , Datos de Secuencia Molecular , SerotipificaciónRESUMEN
The entire genome of the reference strain of bluetongue virus (BTV) serotype 16 (strain RSArrrr/16) was sequenced (a total of 23,518 base pairs). The virus was obtained from the Orbivirus Reference Collection (ORC) at IAH, Pirbright, United Kingdom. The virus strain, which was previously provided by the Onderstepoort Veterinary Research Institute in South Africa, was originally isolated from the Indian subcontinent (Hazara, West Pakistan) in 1960. Previous phylogenetic comparisons show that BTV RNA sequences cluster according to the geographic origins of the virus isolate/lineage, identifying distinct BTV topotypes. Sequence comparisons of segments Seg-1 to Seg-10 show that RSArrrr/16 belongs to the major eastern topotype of BTV (BTV-16e) and can be regarded as a reference strain of BTV-16e for phylogenetic and molecular epidemiology studies. All 10 genome segments of RSArrrr/16 group closely with the vaccine strain of BTV-16 (RSAvvvv/16) that was derived from it, as well as those recently published for a Chinese isolate of BTV-16 (>99% nucleotide identity), suggesting a very recent common ancestry for all three viruses.
Asunto(s)
Virus de la Lengua Azul/genética , Animales , Lengua Azul/virología , Virus de la Lengua Azul/clasificación , Genoma Viral , India , Datos de Secuencia Molecular , Filogenia , SerotipificaciónAsunto(s)
Ecocardiografía Transesofágica/métodos , Defectos del Tabique Interatrial/diagnóstico por imagen , Defectos del Tabique Interatrial/cirugía , Falla de Prótesis/efectos adversos , Venas Pulmonares/diagnóstico por imagen , Venas Pulmonares/cirugía , Manejo de la Enfermedad , Femenino , Humanos , Persona de Mediana Edad , Venas Pulmonares/anomalíasRESUMEN
Treatment gaps of 60-70%, reflecting, amongst many other factors, Human Resources shortfalls means that 150 million India never accessed mental healthcare. In Punjab, mental health training is required in primary health centers. A short-term synchronous training was conceptualized by the National Institute of Mental Health and Neurosciences. A total of 114 primary care doctors participated for the training. Substantial positive changes in knowledge, attitudes and practices were noted. Task sharing and capacity building initiatives can be undertaken during the pandemic to meet the demand for mental healthcare service delivery.
Asunto(s)
COVID-19 , Humanos , Salud Mental , Pandemias , Atención Primaria de Salud , SARS-CoV-2RESUMEN
Sheep and goats sampled in Kuwait during February 2010 were seropositive for bluetongue virus (BTV). BTV isolate KUW2010/02, from 1 of only 2 sheep that also tested positive for BTV by real-time reverse transcription-PCR, caused mild clinical signs in sheep. Nucleotide sequencing identified KUW2010/02 as a novel BTV serotype.
Asunto(s)
Virus de la Lengua Azul/clasificación , Virus de la Lengua Azul/aislamiento & purificación , Lengua Azul/virología , Animales , Virus de la Lengua Azul/genética , Proteínas de la Cápside/genética , Cabras , Kuwait , Filogenia , ARN Viral/genética , Homología de Secuencia , Serotipificación , OvinosRESUMEN
Background: Upper thoracic epidural analgesia (TEA) is compared with lower thoracic epidural analgesia for the perioperative pain management and fast tracking in patients undergoing off pump coronary artery bypass grafting (OPCAB) surgery for the intraoperative hemodynamic, quality of analgesia, incentive spirometry, time to awakening & extubation and intensive care unit (ICU) duration. Materials and Methods: A prospective, randomized comparative clinical study was conducted with total of 60 patients randomized to either Group U: Upper TEA (n = 30) or Group L: Lower TEA (n = 30). Visual analog scale (VAS) was recorded in both the groups during rest and deep breathing at the various time intervals postextubation. Both the groups were also compared for intraoperative hemodynamics, incentive spirometry, time to awakening, and extubation and ICU duration. Statistical analysis was performed using the independent Student's t-test. A value of P < 0.05 was considered statistically significant. Results: Postextubation VAS score at rest and deep breathing at 0, 3, 6, 12, 24, 36, and 48 h were statistically significant in both groups (P ≤ 0.05). Incentive spirometry, time to awakening and extubation and duration of ICU stay were also statistically significant (P ≤ 0.05) between the groups. Conclusion: Lower thoracic epidural was better than upper thoracic epidural in perioperative pain management and fast tracking in OPCAB surgery.
Asunto(s)
Analgesia Epidural/métodos , Puente de Arteria Coronaria Off-Pump , Fentanilo/uso terapéutico , Manejo del Dolor/métodos , Dolor Postoperatorio/tratamiento farmacológico , Analgésicos Opioides/administración & dosificación , Analgésicos Opioides/uso terapéutico , Anestésicos Locales/administración & dosificación , Anestésicos Locales/uso terapéutico , Bupivacaína/administración & dosificación , Bupivacaína/uso terapéutico , Quimioterapia Combinada , Femenino , Fentanilo/administración & dosificación , Humanos , Masculino , Persona de Mediana Edad , Estudios Prospectivos , Factores de Tiempo , Resultado del TratamientoRESUMEN
Background: Right ventricular (RV) has a vital role in maintaining optimal tissue perfusion. Assessment of portal venous flow characteristics can be alternative and emerging technique to assess RV function. Aims: To investigate if portal venous pulsatility fraction (PF) could serve as effective and complementary tool in identifying RV dysfunction. Materials and Methods: Thirty adult patients aged 18-65 years undergoing cardiac surgery under general anesthesia were enrolled in study. Intraoperative transesophageal echocardiographic examination was performed. Tricuspid annular plane systolic excursion (TAPSE), RV fractional area change (FAC), RV ejection fraction (EF), and portal vein flow pulsatility were assessed. Portal vein PF was used to quantify degree of pulsatility. Results: Portal vein was demonstrated in 27 patients (90%). 27 values of portal vein PF, RV EF, FAC, and TAPSE were analyzed. Portal vein PF demonstrated significant linear correlation with TAPSE (r = -0.55, P = 0.003), RV FAC (r = -0.44, P = 0.02), and RV EF (r = -0.53, P = 0.004). ROC curve was constructed to calculate sensitivity and specificity of portal vein PF for assessing RV function. Portal vein PF value of ≥45% indicated RV dysfunction with sensitivity of 92.3%, specificity of 71.4%, positive predictive value of 75%, and negative predictive value of 90.9%. Area under ROC curve was 0.819 (95% confidence interval = 0.624 - 0.939, P = 0.0006). Conclusion: Portal vein PF is simple and feasible method for assessment of RV function. It complements the existing echocardiographic measures to diagnose RV dysfunction.
Asunto(s)
Procedimientos Quirúrgicos Cardíacos , Ecocardiografía Transesofágica/métodos , Vena Porta/fisiopatología , Disfunción Ventricular Derecha/diagnóstico , Disfunción Ventricular Derecha/fisiopatología , Adolescente , Adulto , Anciano , Velocidad del Flujo Sanguíneo , Femenino , Ventrículos Cardíacos/fisiopatología , Humanos , Masculino , Persona de Mediana Edad , Vena Porta/diagnóstico por imagen , Sensibilidad y Especificidad , Adulto JovenRESUMEN
The article is a report on a series of workshops conducted by the National Institute of Mental Health And Neurosciences (NIMHANS), Bengaluru, India in collaboration with the Government of Maharashtra for the local leaders responsible for leading, organizing and delivering public mental health services throughout the state of Maharashtra. The overarching aim of these workshops was to sensitize and orient the participants on the mental health services offered/provided by NIMHANS, the collaborative activities between NIMHANS and Govt. of Karnataka to further the cause of public mental health and also to showcase the scope of DMHP (District Mental Health Program) activities in Karnataka. The professionals were divided into 5 batches as per their specialty or role i.e. Psychiatrists, Psychologists and Social Work besides the health administrators (Civil Surgeons and District Health Officers). Each batch underwent the training 2-3 days. Major areas covered included: Farmers' suicide, programs, policies and laws for the elderly, orientation to the new Mental Health Care Act 2017 and a fully functioning District Mental Health Program (DMHP).
Asunto(s)
Educación , Personal de Salud/educación , Liderazgo , Servicios de Salud Mental , Adulto , Curriculum , Educación Continua , Humanos , IndiaRESUMEN
Background: The deceleration time of the pulmonary venous diastolic flow has been well-correlated with invasive pulmonary capillary wedge pressure in several studies regardless of left ventricular systolic function. This study was conducted to correlate deceleration time of pulmonary venous diastolic wave, DT(D), and left atrial pressure (LAP), obtained noninvasively from mitral early diastolic inflow velocity-to-early diastolic mitral annulus velocity ratio (E/e'), and to assess the ease of each method in patients with coronary artery disease undergoing off-pump coronary artery bypass grafting (OPCAB) by transesophageal echocardiography. Methods: Forty-five adult patients with coronary artery disease, with left ventricular ejection fraction of ≥50% posted for elective OPCAB were enrolled in the study. Results: Forty values of LAP and DT(D) were analyzed. A significant linear correlation (r = -0.64) was found between DT(D) and LAP. Area under the curve of DT(D) of ≤183 ms for predicting elevated LAP (>15) was 0.903 (95% confidence interval: 0.767 to 0.974, P < 0.0001). Conclusion: Deceleration time of pulmonary venous flow diastolic waveform, DT(D), feasible promising echocardiographic measure in determining elevated LAP and DT(D)≤183 ms predicts elevated LAP.
Asunto(s)
Presión Atrial/fisiología , Puente de Arteria Coronaria , Enfermedad de la Arteria Coronaria/fisiopatología , Enfermedad de la Arteria Coronaria/cirugía , Ecocardiografía Transesofágica/métodos , Venas Pulmonares/fisiopatología , Velocidad del Flujo Sanguíneo/fisiología , Femenino , Humanos , Masculino , Persona de Mediana Edad , Valor Predictivo de las Pruebas , Venas Pulmonares/diagnóstico por imagen , Reproducibilidad de los ResultadosRESUMEN
Background: Medullary hypoxia is the initial critical event for kidney injury during cardiopulmonary bypass, and therefore urinary PO2 with its potential of detecting medullary oxygenation for its management. Therefore, we tested the role of urinary PO2 in predicting kidney injury in those undergoing conventional versus combined (conventional and modified) ultrafiltration during cardiac surgery in adults. Methodology: We prospectively evaluated 32 adults between 18 and 65 years of age undergoing elective on-pump cardiac surgery with ejection fraction >35% by conventional (group C) versus combined ultrafiltration (group CM). Urine samples were analyzed for PO2 after induction, 30 min, 3 h, and 6 h post filtration along with blood urea and serum creatinine after induction, at 6 h, 24 h, and 48 h post filtration. Demographic variables, cardiopulmonary bypass duration, flow rates, inotropic score, ventilation duration, diuretic use, and intensive care unit (ICU) stay were assessed between two groups. Results: Both the groups (16 in each group) had comparable urinary PO2 after induction (P = 0.387) with significant decrease in group C at 30 min, 3 h, and 6 h post filtration (P < 0.05). There was a statistically significant increase in serum creatinine (mg/dL) at 48 h in group C compared with group CM (1.57 vs. 1.25, respectively; P ≤ 0.05). There was an increased diuretic usage and length of ICU stay in group C. Conclusion: Combined ultrafiltration technique had renoprotective effect in cardiac surgery analyzed by urinary PO2 levels.