RESUMEN
The common fig (Ficus carica) is one of the earliest plants domesticated by humans. It has been cultivated in China ever since the early seventh century. Fig fruit is an important traditional Chinese medicine and a fine health food, featuring a unique flavor and rich nutrients. In addition to its great medicinal values, its abundant availability in the Xinjiang province of China has made the fig one of the most popular fruits in the country. One of the major diseases that affect figs is the fig mosaic disease (FMD) (1,4), which was reported in China in 1935 (3). A causal agent of this disease is associated with the Fig mosaic virus (FMV), a negative-strand RNA virus with six RNA segments (2). In 2013, and later during a survey in 2014, fig plants in several orchards in Xinjiang displayed symptoms of a virus-like disease, which was characterized as FMD. These symptoms included chlorotic clearing as well as banding of leaf veins along with various patterns of discoloration, severely distorted leaves, and deformed fruits. Total RNA extracts (TRIzol reagent, Ambion) from 18 symptomatic and four asymptomatic leaf samples were subjected to reverse reaction (RT) assays using M-MLV reverse transcriptase (Promega, Fitchburg, WI) with primer FMV-GP-R (TATTACCTGGATCAACGCAG). PCR analysis of the synthesized cDNA was performed using FMV-specific primers FMV-GP-F (ACTTGCAAAGGCAGATGATA) and FMV-GP-R. Amplicons of 706 bp produced by RT-PCR assays were obtained from most (15 out of 18) of the symptomatic samples; however, none was obtained from the four asymptomatic leaves. The purified amplicons were cloned and sequenced. BLAST analysis of these sequences revealed more than 94% nucleotide identity with glycoprotein precursor (GP) genes of an FMV-Serbia isolate (SB1). One sequence was deposited in NCBI databases, and one sequence was submitted to GenBank (Accession No. KM034915). RNA segments 2 to 6 of FMV were also amplified by RT-PCR and sequenced. These sequences showed 94 to 96% identity with FMV sequences deposited in the NCBI databases. The collected samples were further detected by Northern-blot hybridization with a digoxigenin-labeled RNA probe, which targets the RNA1 genome of the FMV. The result was in line with RT-PCR detection. To our knowledge, this is the first report of FMV in fig trees in China. Considering the economic importance of fig plants and the noxious nature of FMV, this virus poses a great threat to the economy of the fig industry of Xinjiang. Thus, it is important to develop immediate effective quarantine and management of this virus to reduce any further predictable loss. References: (1) T. Elbeaino et al. J. Gen. Virol. 90:1281, 2009. (2) K. Ishikawa et al. J. Gen. Virol. 93:1612, 2012. (3) H. A. Pittman. J. West Aust. Dept. Agric. 12:196, 1935. (4) J. J. Walia et al. Plant Dis. 93:4, 2009.
RESUMEN
Ref-1/APE1 (Redox Effector/Apurinic Endonuclease 1) is a multifunctional enzyme that serves as a redox factor for several transcription factors (TFs), e.g., NF-kB, HIF-1α, which in an oxidized state fail to bind DNA. Conversion of these TFs to a reduced state serves to regulate various biological responses such as cell growth, inflammation, and cellular metabolism. The redox activity involves a thiol exchange reaction for which Cys65 (C65) serves as the nucleophile. Using CRISPR editing in human pancreatic ductal adenocarcinoma (PDAC) cells, we changed C65 to Ala (C65A) in Ref-1 to evaluate alteration of Ref-1 redox dynamics as well as chronic loss of Ref-1 redox activity on cell signaling pathways, specifically those regulated by NF-kB and HIF-1α. The redox activity of Ref-1 requires partial unfolding to expose C65, which is buried in the folded structure. Labeling of Ref-1 with polyethylene glycol-maleimide (PEGm) provides a readout of reduced Cys residues in Ref-1 and thereby an assessment of partial unfolding in Ref-1. In comparing Ref-1WT vs Ref-1C65A cell lines, we found an altered distribution of oxidized versus reduced states of Ref-1. Accordingly, activation of NF-kB and HIF-1α in Ref-1C65A lines was significantly lower compared to Ref-1WT lines. The bioinformatic data revealed significant downregulation of metabolic pathways including OXPHOS in Ref-1C65A expressing clones compared to Ref-1WT line. Ref-1C65A also demonstrated reduced cell proliferation and use of tricarboxylic acid (TCA) substrates compared to Ref-1WT lines. A subcutaneous as well as PDAC orthotopic in vivo model demonstrated a significant reduction in tumor size, weight, and growth in the Ref-1C65A lines compared to the Ref-1WT lines. Moreover, mice implanted with Ref-1C65A redox deficient cells demonstrate significantly reduced metastatic burden to liver and lung compared to mice implanted with Ref-1 redox proficient cells. These results from the current study provide direct evidence that the chronic absence of Cys65 in Ref-1 results in redox inactivity of the protein in human PDAC cells, and subsequent biological results confirm a critical involvement of Ref-1 redox signaling and tumorigenic phenotype.