Borylation via iridium catalysed C-H activation: a new concise route to duocarmycin derivatives.

The synthesis of the ethyl ester analogue of the ultrapotent antitumour antibiotic seco-duocarmycin SA has been achieved in eleven linear steps from commercially available starting materials. The DSA alkylation subunit can be made in ten linear steps from the same precursor. The route involves C-H activation at the equivalent of the C7 position on indole leading to a borylated intermediate 9 that is stable enough for peptide coupling reactions but can be easily converted to the free hydroxyl analogue.

Suramin: Effectiveness of analogues reveals structural features that are important for the potent trypanocidal activity of the drug.

Suramin was the first effective drug for the treatment of human African sleeping sickness. Structural analogues of the trypanocide have previously been shown to be potent inhibitors of several enzymes. Therefore, four suramin analogues lacking the methyl group on the intermediate rings and with different regiochemistry of the naphthalenetrisulphonic acid groups and the phenyl rings were tested to establish whether they exhibited improved antiproliferative activity against bloodstream forms of Trypanosomes brucei compared to the parent compound. The four analogues exhibited low trypanocidal activity and weak inhibition of the antitrypanosomal activity of suramin in competition experiments. This indicates that the strong trypanocidal activity of suramin is most likely due to the presence of methyl groups on its intermediate rings and to the specific regiochemistry of naphthalenetrisulphonic acid groups. These two structural features are also likely to be important for the inhibition mechanism of suramin because DNA distribution and nucleus/kinetoplast configuration analyses suggest that the analogues inhibit mitosis while suramin inhibits cytokinesis.

Suramin analogues protect cartilage against osteoarthritic breakdown by increasing levels of tissue inhibitor of metalloproteinases 3 (TIMP-3) in the tissue.

Osteoarthritis is a chronic degenerative joint disease affecting millions of people worldwide, with no disease-modifying drugs currently available to treat the disease. Tissue inhibitor of metalloproteinases 3 (TIMP-3) is a potential therapeutic target in osteoarthritis because of its ability to inhibit the catabolic metalloproteinases that drive joint damage by degrading the cartilage extracellular matrix. We previously found that suramin inhibits cartilage degradation through its ability to block endocytosis and intracellular degradation of TIMP-3 by low-density lipoprotein receptor-related protein 1 (LRP1), and analysis of commercially available suramin analogues indicated the importance of the 1,3,5-trisulfonic acid substitutions on the terminal naphthalene rings for this activity. Here we describe synthesis and structure-activity relationship analysis of additional suramin analogues using ex vivo models of TIMP-3 trafficking and cartilage degradation. This showed that 1,3,6-trisulfonic acid substitution of the terminal naphthalene rings was also effective, and that the protective activity of suramin analogues depended on the presence of a rigid phenyl-containing central region, with para/para substitution of these phenyl rings being most favourable. Truncated analogues lost protective activity. The physicochemical characteristics of suramin and its analogues indicate that approaches such as intra-articular injection would be required to develop them for therapeutic use.

Structural Basis of the Negative Allosteric Modulation of 5-BDBD at Human P2X4 Receptors.

The P2X4 receptor is a ligand-gated ion channel activated by extracellular ATP. P2X4 activity is associated with neuropathic pain, vasodilation, and pulmonary secretion and is therefore of therapeutic interest. The structure-activity relationship of P2X4 antagonists is poorly understood. Here we elucidate the structure-activity of 5-(3-bromophenyl)-1,3-dihydro-2H-benzofuro[3,2-e]-1,4-diazepin-2-one (5-BDBD) at human P2X4 by combining pharmacology, electrophysiology, molecular modeling, and medicinal chemistry. 5-BDBD antagonized P2X4 in a noncompetitive manner but lacked effect at human P2X2. Molecular modeling and site-directed mutagenesis suggested an allosteric binding site for 5-BDBD located between two subunits in the body region of P2X4, with M109, F178, Y300, and I312 on one subunit and R301 on the neighboring subunit as key residues involved in antagonist binding. The bromine group of 5-BDBD was redundant for the antagonist activity of 5-BDBD, although an interaction between the carbonyl group of 5-BDBD and R301 in P2X4 was associated with 5-BDBD activity. 5-BDBD could inhibit the closed channel but poorly inhibited the channel in the open/desensitizing state. We hypothesize that this is due to constriction of the allosteric site after transition from closed to open channel state. We propose that M109, F178, Y300, R301, and I312 are key residues for 5-BDBD binding; provide a structural explanation of how they contribute to 5-BDBD antagonism; and highlight that the limited action of 5-BDBD on open versus closed channels is due to a conformational change in the allosteric site. SIGNIFICANCE STATEMENT: Activity of P2X4 receptor is associated with neuropathic pain, inflammation, and vasodilatation. Molecular information regarding small-molecule interaction with P2X4 is very limited. Here, this study provides a structural explanation for the action of the small-molecule antagonist 5-BDBD at the human P2X4 receptor.

Junctions in DNA: underexplored targets for therapeutic intervention.

DNA has been a key target for cancer therapy, with a range of compounds able to bind and either impair its processing or induce damage. Targeting DNA with small molecules in a truly sequence specific way, to impair gene specific processes, remains out of reach. The ability of DNA to assume different structures from the classical double helix allows access to more specific ligand binding modes and, potentially, to new avenues of treatment. In this review, we illustrate the small molecules that have been reported to bind to three- and four-way junctions.

Probing cytochrome P450 (CYP) bioactivation with chloromethylindoline bioprecursors derived from the duocarmycin family of compounds.

The duocarmycins belong to a class of agent which has great potential for use in cancer therapy. Their exquisite potency means they are too toxic for systemic use, and targeted approaches are required to unlock their clinical potential. In this study, we have explored seco-OH-chloromethylindoline (CI) duocarmycin-based bioprecursors for their potential for cytochrome P450 (CYP)-mediated cancer cell kill. We report on synthetic and biological explorations of racemic seco-CI-MI, where MI is a 5-methoxy indole motif, and dehydroxylated analogues. We show up to a 10-fold bioactivation of de-OH CI-MI and a fluoro bioprecursor analogue in CYP1A1-transfected cells. Using CYP bactosomes, we also demonstrate that CYP1A2 but not CYP1B1 or CYP3A4 has propensity for potentiating these compounds, indicating preference for CYP1A bioactivation.

Active targeting of gold nanoparticles as cancer therapeutics.

Gold nanoparticles (AuNPs) are of increasing interest for their unique properties and their biocompatability, minimal toxicity, multivalency and size tunability make them exciting drug carriers. The functionalisaton of AuNPs with targeting moieties allows for their selective delivery to cancers, with antibodies, proteins, peptides, aptamers, carbohydrates and small molecules all exploited. Here, we review the recent advances in targeted-AuNPs for the treatment of cancer, with a particular focus on these classes of targeting ligands. We highlight the benefits and potential drawbacks of each ligand class and propose directions in which the field could grow.

A Peptide-Duocarmycin Conjugate Targeting the Thomsen-Friedenreich Antigen Has Potent and Selective Antitumor Activity.

Solid-phase synthesis allowed the rapid generation of a peptide-drug conjugate. A peptide targeting the Thomsen-Friedenreich antigen (TFα) was conjugated to the alkylating subunit of the potent cytotoxin duocarmycin SA. The compound, containing a cathepsin B cleavable linker, was shown to be active and selective against TFα expressing tumor cell lines.

Perfluoroarene-based peptide macrocycles that inhibit the Nrf2/Keap1 interaction.

The Nrf2/Keap1 interaction is a target in the development of new therapeutic agents, where inhibition of the interaction activates Nrf2 and leads to the generation of downstream anti-inflammatory effects. Peptides that mimic the ß-turn in the Keap1 active site and are constrained by a disulfide bridge have high affinity for Keap1 but no intracellular activity. The introduction of a perfluoroalkyl-bridging group to constrain the peptides, coupled with a glutamic acid to proline replacement leads to a new peptide with a Ki of 6.1 nM for the Nrf2/Keap1 binding interaction, although this does not translate into intracellular activity.

Cytotoxicity of Pyrazine-Based Cyclometalated (C

The synthesis of a series of cyclometalated gold(III) complexes supported by pyrazine-based (C^N^C)-type pincer ligands is reported, including the crystal structure of a cationic example. The compounds provide a new platform for the study of antiproliferative properties of gold(III) complexes. Seven complexes were tested: the neutral series (C^Npz^C)AuX [X = Cl (1), 6-thioguanine (4), C≡CPh (5), SPh (6)] and an ionic series that included the N-methyl complex [(C^NpzMe^C)AuCl]BF4 (7) and the N-heterocyclic carbene complexes [(C^Npz^C)AuL]+ with L = 1,3-dimethylbenzimidazol-2-ylidene (2) or 1,3,7,9-tetramethylxanthin-8-ylidene (3). Tests against human leukemia cells identified 1, 2, 3, and 4 as particularly promising, whereas protecting the noncoordinated N atom on the pyrazine ring by methylation (as in 7) reduced the cytotoxicity. Complex 2 proved to be the most effective of the entire series against the HL60 leukemia, MCF-7 breast cancer, and A549 lung cancer cell lines, with IC50 values down to submicromolar levels, associated with a lower toxicity toward healthy human lung fibroblast cells. The benzimidazolylidene complex 2 accumulated more effectively in human lung cancer cells than its caffeine-based analogue 3 and the gold(III) chloride 1. Compound 2 proved to be unaffected by glutathione under physiological conditions for periods of up to 6 days and stabilizes the DNA G-quadruplex and i-motif structures; the latter is the first such report for gold compounds. We also show the first evidence of inhibition of MDM2-p53 protein-protein interactions by a gold-based compound and identified the binding mode of the compound with MDM2 using saturation transfer difference NMR spectroscopy combined with docking calculations.

Unveiling the "Three-Finger Pharmacophore" Required for p53-MDM2 Inhibition by Saturation-Transfer Difference (STD) NMR Initial Growth-Rates Approach.

Inhibitors of the p53-MDM2 protein-protein interaction are emerging as a new and validated approach to treating cancer. Herein, we describe the synthesis and inhibitory evaluation of a series of isoquinolin-1-one analogues, and highlight the utility of an initial growth-rates saturation-transfer difference (STD) NMR approach supported by protein-ligand docking to investigate p53-MDM2 inhibition. The approach is illustrated by the study of compound 1, providing key insights into the binding mode of this kind of MDM2 ligands and, more importantly, readily unveiling the previously proposed three-finger pharmacophore requirement for p53-MDM2 inhibition.

Solid-Phase Synthesis of Duocarmycin Analogues and the Effect of C-Terminal Substitution on Biological Activity.

The duocarmycins are potent antitumor agents with potential for use in the development of antibody-drug conjugates (ADCs) as well as being clinical candidates in their own right. In this article, we describe the synthesis of a duocarmycin monomer (DSA) that is suitably protected for utilization in solid-phase synthesis. The synthesis was performed on a large scale, and the resulting racemic protected Fmoc-DSA subunit was separated by supercritical fluid chromatography (SFC) into the single enantiomers; its application to solid-phase synthesis methodology gave a series of monomeric and extended duocarmycin analogues with amino acid substituents. The DNA sequence selectivity was similar to that in previous reports for both the monomeric and extended compounds. Substitution at the C-terminus of duocarmycin caused a decrease in antiproliferative activity for all of the compounds studied. An extended compound containing an alanine at the C-terminus was converted to the primary amide or to an extended structure containing a terminal tertiary amine, but this had no beneficial effects on biological activity.

Identification of a new p53/MDM2 inhibitor motif inspired by studies of chlorofusin.

Previous studies on the natural product chlorofusin have shown that the full peptide and azaphilone structure are required for inhibition of the interaction between MDM2 and p53. In the current work, we utilized the cyclic peptide as a template and introduced an azidonorvaline amino acid in place of the ornithine/azaphilone of the natural product and carried out click chemistry with the resulting peptide. From this small library the first ever non-azaphilone containing chlorofusin analog with MDM2/p53 activity was identified. Further studies then suggested that the simple structure of the Fmoc-norvaline amino acid that had undergone a click reaction was also able to inhibit MDM2/p53 interaction. This is an example where studies of a natural product have led to the serendipitous identification of a new small molecule inhibitor of a protein-protein interaction.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2).

The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5'-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3' using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K(+) ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Light-activated azobenzene peptide inhibitor of the PD-1/PD-L1 interaction.

Inhibiting the PD-1/PD-L1 protein-protein interaction is a key immunotherapy for cancer. Antibodies dominate the clinical space but are costly, with limited applicability and immune side effects. We developed a photo-controlled azobenzene peptide that selectively inhibits the PD-1/PD-L1 interaction when in the cis isomer only. Activity is demonstrated in in vitro and cellular assays.

Non-covalent duplex to duplex crosslinking of DNA in solution revealed by single molecule force spectroscopy.

Small molecules that interact with DNA, disrupting the binding of transcription factors or crosslinking DNA into larger structures, have significant potential as cancer therapies and in nanotechnology. Bisintercalators, including natural products such as echinomycin and rationally designed molecules such as the bis-9-aminoacridine-4-carboxamides, are key examples. There is little knowledge of the propensity of these molecules to crosslink duplex DNA. Here we use single molecule force spectroscopy to assay the crosslinking capabilities of bisintercalators. We show that bis-9-aminoacridine-4-carboxamides with both rigid and flexible linkers are able to crosslink duplex strands of DNA, and estimate the equilibrium free energy of a 9-aminoacridine-4-carboxamide bisintercalator from DNA at 5.03 kJ mol(-1). Unexpectedly, we find that echinomycin and its synthetic analogue TANDEM are capable of sequence-specific crosslinking of the terminal base pairs of two duplex DNA strands. In the crowded environment of the nucleosome, small molecules that crosslink neighbouring DNA strands may be expected to have significant effects on transcription, while a small molecule that facilitates sequence-specific blunt-end ligation of DNA may find applications in the developing field of DNA nanotechnology.

The development of potent, competitive CXCR4 antagonists for the prevention of cancer metastasis.

Cancer metastasis is the cause of up to 90 % of cancer related mortality. The CXCR4 receptor and its cognate ligand, CXCL12, have major roles in enabling cancer metastasis and consequently, the CXCR4 receptor has become an attractive therapeutic target for the prevention of metastasis. Despite this, CXCR4 antagonists have had limited success in clinical trials due to cellular toxicity and poor stability and efficacy. In this study, we developed a novel, competitive CXCR4 antagonist (IS4) that through copper-catalysed-azide-alkyne-cycloaddition can be clicked to other chemical moieties such as fluorescent dyes (IS4-FAM) for CXCR4-based imaging. We determined that these CXCR4 antagonists were non-toxic and could be used to specifically label the CXCR4 receptor. Furthermore, IS4 and IS4-FAM inhibited CXCL12-stimulated cancer cell migration and Ca2+ release in both adherent and suspension cell lines with similar or improved potency as compared to two literature CXCR4 antagonists. Our results highlight the potential of IS4 and IS4-FAM as research tools and as potent CXCR4 antagonists for the prevention of metastasis.

Taspine is a natural product that suppresses P2X4 receptor activity via phosphoinositide 3-kinase inhibition.

BACKGROUND AND PURPOSE: P2X4 is a ligand-gated cation channel activated by extracellular ATP involved in neuropathic pain, inflammation and arterial tone. EXPERIMENTAL APPROACH: Natural products were screened against human or mouse P2X4 activity using fura-2 loaded 1321N1 cells for measurement of intracellular Ca2+ responses. Whole-cell currents were measured by patch clamp. Human primary macrophage chemokine release was used to assess effect of taspine on inflammatory cell function. An enzymatic assay was performed to assess the effect of taspine on recombinant PI3-kinase. KEY RESULTS: A natural product screen identified taspine as an inhibitor of human P2X4 activity. Taspine inhibits human and mouse P2X4-mediated Ca2+ influx in 1321N1 cells expressing receptors but lacked activity at human P2X2, P2X3, P2X2/3 and P2X7 receptors. Taspine inhibited the maximal response at human and mouse P2X4 but effective on ATP potency. Taspine has a slow onset rate (~15 min for half-maximal inhibition), irreversible over 30 min of washout. Taspine inhibits P2X4-mediated Ca2+ signalling in mouse BV-2 microglia cells and human primary macrophage. Taspine inhibited P2X4-mediated CXCL5 secretion in human primary macrophage. Taspine reversed ivermectin-induced potentiation of P2X4 currents in 1321N1 stably expressing cells. The PI3-kinase inhibitor LY294002 mimicked the properties of taspine on P2X4-mediated Ca2+ influx and whole-cell currents. Taspine directly inhibited the enzymatic activity of recombinant PI3-kinase in a competitive manner. CONCLUSION AND IMPLICATIONS: Taspine is a novel natural product P2X4 receptor inhibitor, mediating its effect through PI3-kinase inhibition rather than receptor antagonism. Taspine can inhibit the pro-inflammatory signalling by P2X4 in human primary macrophage.

Design and synthesis of threading intercalators to target DNA.

Threading intercalators are high affinity DNA binding agents that bind by inserting a chromophore into the duplex and locating one group in each groove. The first threading intercalators that can be conjugated to acids, sulfonic acids and peptides to target them to duplex DNA are described, based upon the well studied acridine-3- or 4-carboxamides. Cellular uptake of the parent acridine is rapid and it can be visualized in the nucleus of cells. Both the parent compounds and their conjugates maintain antitumor activity.

Peptide directed phthalocyanine-gold nanoparticles for selective photodynamic therapy of EGFR overexpressing cancers.

Gold nanoparticles, covalently functionalised with the photosensitiser C11Pc and PEG, were actively targeted towards epidermal growth factor receptor overexpressing cancers using the peptide FITC-ßAAEYLRK. Selective phototoxicity was observed at nanomolar concentrations with minimal dark toxicity.