N-glycosylation of SCAP exacerbates hepatocellular inflammation and lipid accumulation via ACSS2-mediated histone H3K27 acetylation.

Sterol regulatory element binding protein (SREBP) cleavage-activating protein (SCAP) is a widely expressed membrane glycoprotein that acts as an important modulator of lipid metabolism and inflammatory stress. N-glycosylation of SCAP has been suggested to modulate cancer development, but its role in nonalcoholic steatohepatitis (NASH) is poorly understood. In this study, the N-glycosylation of SCAP was analyzed by using sequential trypsin proteolysis and glycosidase treatment. The liver cell lines expressing wild-type and N-glycosylation sites mutated SCAP were constructed to investigate the N-glycosylation role of SCAP in regulating inflammation and lipid accumulation as well as the underlying mechanisms. The hepatic SCAP protein levels were significantly increased in C57BL/6J mice fed with Western diet and sugar water (WD + SW) and diabetic db/db mice, which exhibited typical liver steatosis and inflammation accompanied with hyperglycemia. In vitro, the enhanced N-glycosylation by high glucose increased the protein stability of SCAP and hence increased its total protein levels, whereas the ablation of N-glycosylation significantly decreased SCAP protein stability and alleviated lipid accumulation and inflammation in hepatic cell lines. Mechanistically, SCAP N-glycosylation increased not only the SREBP-1-mediated acetyl-CoA synthetase 2 (ACSS2) transcription but also the AMPK-mediated S659 phosphorylation of ACCS2 protein, causing the enhanced ACSS2 levels in nucleus and hence increasing the histone H3K27 acetylation (H3K27ac), which is a key epigenetic modification associated with NASH. Modulating ACSS2 expression or its location in the nuclear abolished the effects of SCAP N-glycosylation on H3K27ac and lipid accumulation and inflammation. In conclusion, SCAP N-glycosylation aggravates inflammation and lipid accumulation through enhancing ACSS2-mediated H3K27ac in hepatocytes.NEW & NOTEWORTHY N-glycosylation of SCAP exacerbates inflammation and lipid accumulation in hepatocytes through ACSS2-mediated H3K27ac. Our data suggest that SCAP N-glycosylation plays a key role in regulating histone H3K27 acetylation and targeting SCAP N-glycosylation may be a new strategy for treating nonalcoholic steatohepatitis (NASH).

Targeting CD38/ ADP-ribosyl cyclase as a novel therapeutic strategy for identification of three potent agonists for leukopenia treatment.

Leukopenia is the most common side effect of chemotherapy and radiotherapy. It potentially deteriorates into a life-threatening complication in cancer patients. Despite several agents being approved for clinical administration, there are still high incidences of pathogen-related disease due to a lack of functional immune cells. ADP-ribosyl cyclase of CD38 displays a regulatory effect on leukopoiesis and the immune system. To explore whether the ADP-ribosyl cyclase was a potential therapeutic target of leukopenia. We established a drug screening model based on an ADP-ribosyl cyclase-based pharmacophore generation algorithm and discovered three novel ADP-ribosyl cyclase agonists: ziyuglycoside II (ZGSII), brevifolincarboxylic acid (BA), and 3,4-dihydroxy-5-methoxybenzoic acid (DMA). Then, in vitro experiments demonstrated that these three natural compounds significantly promoted myeloid differentiation and antibacterial activity in NB4 cells. In vivo, experiments confirmed that the compounds also stimulated the recovery of leukocytes in irradiation-induced mice and zebrafish. The mechanism was investigated by network pharmacology, and the top 12 biological processes and the top 20 signaling pathways were obtained by intersecting target genes among ZGSII, BA, DMA, and leukopenia. The potential signaling molecules involved were further explored through experiments. Finally, the ADP-ribosyl cyclase agonists (ZGSII, BA, and DMA) has been found to regenerate microbicidal myeloid cells to effectively ameliorate leukopenia-associated infection by activating CD38/ADP-ribosyl cyclase-Ca2+-NFAT. In summary, this study constructs a drug screening model to discover active compounds against leukopenia, reveals the critical roles of ADP-ribosyl cyclase in promoting myeloid differentiation and the immune response, and provides a promising strategy for the treatment of radiation-induced leukopenia.

Impact of Preoperative Anemia on Hospitalization, Death, and Overall Survival in Patients With Peripheral Artery Disease Undergoing Endovascular Therapy: A Retrospective Cohort Study in the United States and Canada.

PURPOSE: Preoperative anemia is associated with adverse outcomes after cardiac and noncardiac surgeries, but outcomes after an endovascular peripheral vascular intervention (PVI) are not well established. We aimed to assess the association of preoperative anemia with 30 day death, hospital length of stay (LOS), and overall (long term) survival in patients undergoing an endovascular PVI for peripheral artery disease. MATERIALS AND METHODS: In this retrospective, cohort study in the United States and Canada, we queried the national Vascular Quality Initiative database for all endovascular PVIs performed between 2010 and 2019, and outcomes were correlated with patients' hemoglobin (Hb) levels. Anemia was classified as mild (Hb=10-13 g/dL for men and 10-12 g/dL for women), moderate (Hb=8-9.9 g/dL), and severe (Hb<8 g/dL). RESULTS: A total of 79 707 adult patients who met study criteria underwent endovascular PVI. The mean age was 68 years, and 59% of patients were male. Anemia was documented in 38 543 patients (48%) and was mild in 27 435 (71%), moderate in 9783 (25%), and severe in 1325 (4%). The median follow-up duration was 4 years (range, 1.25-5.78 years). On univariate analysis, 30 day mortality, total LOS, and overall survival were significantly associated with the level of preoperative anemia. These associations persisted in the multivariate models. Kaplan-Meier survival analysis demonstrated an association of death with degree of anemia (p<0.001). CONCLUSION: The presence and degree of preoperative anemia were independently associated with increased 30 day mortality and LOS and decreased overall survival for patients with peripheral artery disease who had undergone endovascular PVI. CLINICAL IMPACT: The findings from this study have many implications for how to approach vascular surgery in patients with variable hemoglobin levels. Our findings will strengthen our ability to conduct accurate preoperative risk stratification for patients undergoing peripheral vascular interventions. This may also mitigate healthcare expenditures if findings are applied in a way that can lower patient length of postoperative stay while also maintaining quality of care and patient safety. Our results will also serve as guidance for clinical trials, and future prospective trials should evaluate the effect of preoperative optimization of hemoglobin as a potentially modifiable risk factor for outcomes.

Giant cell tumor of tendon sheath: A report of 216 cases.

BACKGROUND: In this article on giant cell tumor of tendon sheath (GCTTS), we intend to summarize and analyze the clinical and pathological features of GCTTS hoping to improve clinical management and patient treatment. METHODS: The study retrospectively reviewed 216 patients of GCTTS, registered at the Affiliated Hospital of Southwest Medical University from January 2010 to December 2020. These cases were diagnosed by surgical excision. The clinicopathological features and the prognosis were reviewed in the light of the current literature. RESULTS: Of these 216 GCTTS patients, 72 were males (33.3%) and 144 females (66.7%), with a ratio male-to-female of 1:2. The patients' age ranged from 5 to 82, the average being 41.5 years at diagnosis. A total of 96 cases (44.4%) occurred in the hand region, followed by 35 cases (16.2%) in the knee, 32 cases (14.8%) in the foot, 25 cases (11.6%) in the ankle, 12 cases (5.6%) in the wrist, 12 cases (5.6%) in the leg, 2 cases (0.9%) in the head, 1 case (0.5%) in the forearm, and 1 case (0.5%) inside and outside the spinal channel. Histopathology mainly revealed large synovial-like monocytes, small monocytes, and osteoclast-like giant cells. CONCLUSION: Our results confirm that GCTTS predominantly occurs in the hands of young women. Complete surgical resection with long-term follow-up is the preferred management.

What are the Minimum Clinically Important Difference Values for the PROMIS and QuickDASH After Carpal Tunnel Release? A Prospective Cohort Study.

BACKGROUND: To better define the clinical significance of patient-reported outcomes, the concept of a minimum clinically important difference (MCID) exists. The MCID is the minimum change that a patient will perceive as meaningful. Prior attempts to determine the MCID after carpal tunnel release are limited by methodologic concerns, including the lack of a true anchor-based MCID calculation. QUESTIONS/PURPOSES: To address previous methodologic concerns in existing studies, as well as establish a clinically useful value for clinicians, we asked: What are the MCID values for the Patient-Reported Outcomes Measurement Information System (PROMIS) Upper Extremity (UE), PROMIS Pain Interference (PI), and the QuickDASH after carpal tunnel release? METHODS: We conducted a prospective cohort study at an urban, Midwest, multihospital, academic health system. One hundred forty-seven adult patients undergoing unilateral carpal tunnel release between September 2020 and February 2022 were identified. PROMIS UE, PI, and QuickDASH scores were collected preoperatively and 3 months postoperatively. We also collected responses to an anchor-based question: "Since your treatment, how would you rate your overall function?" (much worse, worse, slightly worse, no change, slightly improved, improved, or much improved). Patients who did not respond to the 3-month postoperative surveys were excluded. A total of 122 patients were included in the final analysis (83% response proportion [122 of 147]). The mean age was 57 years (range 23 to 87 years), and 68% were women. The MCID was calculated using both anchor-based and distribution-based methods. Although anchor-based calculations are generally considered more clinically relevant because they consider patients' perceptions of improvement, an estimation of the minimum detectable change (which represents measurement error) relies on a distribution-based calculation. We determined a range of MCID values to propose a final MCID value for all three instruments. A negative MCID value for the PROMIS PI instrument represents a decrease in pain, whereas a positive value for the PROMIS UE instrument represents an improvement in function. A negative value for the QuickDASH instrument represents an increase in function. RESULTS: The final proposed MCID values were 6.2 (interquartile range [IQR] 5.4 to 9.0) for the PROMIS UE, -7.8 (IQR -6.1 to -8.5) for the PROMIS PI, and -18.2 (IQR -13.3 to -34.1) for the QuickDASH. CONCLUSION: We recommend that clinicians use the following values as the MCID after carpal tunnel release: 6 for the UE, -8 for the PI, and -18 for the QuickDASH. Surgeons may find these values useful when counseling patients postoperatively regarding improvement. Future studies could examine whether a single MCID (or small range) for PROMIS instruments is applicable to a variety of conditions and interventions. LEVEL OF EVIDENCE: Level II, therapeutic study.

Value of cytopathology in the diagnosis of adenoid cystic carcinoma and an analysis of misdiagnoses.

BACKGROUND: The diagnosis of adenoid cystic carcinoma (ACC) by cytopathology can be challenging. This study was aimed at testing the effectiveness of this technique and at assessing possible differences in the coincidence rate of fine-needle aspiration cytology(FNAC) and brush exfoliation. METHODS: The pathology database of Southwest Medical University( Luzhou, China) was searched for patients who had undergone surgery or biopsy for ACC between January 2017 and January 2022 and had preoperative cytopathologic results. Their cytologic and histologic data were then analyzed retrospectively and the coincidence rates of cytopathology in the diagnosis of ACC were calculated. RESULTS: Compared with histopathology, the total coincidence rate of the cytologic diagnosis of ACC was 76.8%, that of FNAC was 78.9%, and that of brush exfoliation was 55.6%. CONCLUSION: In the diagnosis of ACC, cytopathology is an effective tool; this is especially true of FNAC, which plays an important role in the diagnosis of ACC. The authors further suggest that it is advisable for diagnosticians to master the cytopathological features of ACC to reduce the possibility of preoperative misdiagnoses.

Toll-like Receptors and Thrombopoiesis.

Platelets are the second most abundant blood component after red blood cells and can participate in a variety of physiological and pathological functions. Beyond its traditional role in hemostasis and thrombosis, it also plays an indispensable role in inflammatory diseases. However, thrombocytopenia is a common hematologic problem in the clinic, and it presents a proportional relationship with the fatality of many diseases. Therefore, the prevention and treatment of thrombocytopenia is of great importance. The expression of Toll-like receptors (TLRs) is one of the most relevant characteristics of thrombopoiesis and the platelet inflammatory function. We know that the TLR family is found on the surface or inside almost all cells, where they perform many immune functions. Of those, TLR2 and TLR4 are the main stress-inducing members and play an integral role in inflammatory diseases and platelet production and function. Therefore, the aim of this review is to present and discuss the relationship between platelets, inflammation and the TLR family and extend recent research on the influence of the TLR2 and TLR4 pathways and the regulation of platelet production and function. Reviewing the interaction between TLRs and platelets in inflammation may be a research direction or program for the treatment of thrombocytopenia-related and inflammatory-related diseases.

Macrophage cell membrane-based nanoparticles: a new promising biomimetic platform for targeted delivery and treatment.

Synthetic nanoparticles with surface bioconjugation are promising platforms for targeted therapy, but their simple biological functionalization is still a challenging task against the complex intercellular environment. Once synthetic nanoparticles enter the body, they are phagocytosed by immune cells by the immune system. Recently, the cell membrane camouflage strategy has emerged as a novel therapeutic tactic to overcome these issues by utilizing the fundamental properties of natural cells. Macrophage, a type of immune system cells, plays critical roles in various diseases, including cancer, atherosclerosis, rheumatoid arthritis, infection and inflammation, due to the recognition and engulfment function of removing substances and pathogens. Macrophage membranes inherit the surface protein profiles and biointerfacing properties of source cells. Therefore, the macrophage membrane cloaking can protect synthetic nanoparticles from phagocytosis by the immune cells. Meanwhile, the macrophage membrane can make use of the natural correspondence to accurately recognize antigens and target inflamed tissue or tumor sites. In this review, we have summarized the advances in the fabrication, characterization and homing capacity of macrophage membrane cloaking nanoparticles in various diseases, including cancers, immune diseases, cardiovascular diseases, central nervous system diseases, and microbial infections. Although macrophage membrane-camouflaged nanoparticles are currently in the fetal stage of development, there is huge potential and challenge to explore the conversion mode in the clinic.

Exploring of InDel in bovine PSAP gene and their association with growth traits in different development stages.

PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics.

Methyl Gallate Alleviates Acute Ulcerative Colitis by Modulating Gut Microbiota and Inhibiting TLR4/NF-κB Pathway.

Ulcerative colitis (UC) is a complex immune-mediated inflammatory disease. In recent years, the incidence of UC has increased rapidly, however, its exact etiology and mechanism are still unclear. Based on the definite anti-inflammatory and antibacterial activities of Sanguisorba officinalis L., we studied its monomer, methyl gallate (MG). In this study, we employed flow cytometry and detected nitric oxide production, finding MG regulated macrophage polarization and inhibited the expression of proinflammatory cytokines in vitro. MG also exhibited anti-inflammatory activity accompanying with ameliorating body weight loss, improving colon length and histological damage in dextran sulfate sodium-induced UC mice. Meanwhile, transcription sequencing and 16S rRNA sequencing analyzed the key signaling pathways and changes in the gut microbiota of MG for UC treatment, proving that MG could alleviate inflammation by regulating the TLR4/NF-κB pathway in vivo and in vitro. Additionally, MG altered the diversity and composition of the gut microbiota and changed the abundance of metabolic products. In conclusion, our results are the first to demonstrate that MG has obvious therapeutic effects against acute UC, which is related to macrophage polarization, improved intestinal flora dysbiosis and inhibition of TLR4/NF-κB signaling pathway, and MG may be a promising therapeutic agent for UC treatment.

Targeting TLR2/Rac1/cdc42/JNK Pathway to Reveal That Ruxolitinib Promotes Thrombocytopoiesis.

BACKGROUND: Thrombocytopenia has long been considered an important complication of chemotherapy and radiotherapy, which severely limits the effectiveness of cancer treatment and the overall survival of patients. However, clinical treatment options are extremely limited so far. Ruxolitinib is a potential candidate. METHODS: The impact of ruxolitinib on the differentiation and maturation of K562 and Meg-01 cells megakaryocytes (MKs) was examined by flow cytometry, Giemsa and Phalloidin staining. A mouse model of radiation-injured thrombocytopenia (RIT) was employed to evaluate the action of ruxolitinib on thrombocytopoiesis. Network pharmacology, molecular docking, drug affinity responsive target stability assay (DARTS), RNA sequencing, protein blotting and immunofluorescence analysis were applied to explore the targets and mechanisms of action of ruxolitinib. RESULTS: Ruxolitinib can stimulate MK differentiation and maturation in a dose-dependent manner and accelerates recovery of MKs and thrombocytopoiesis in RIT mice. Biological targeting analysis showed that ruxolitinib binds directly to Toll Like Receptor 2 (TLR2) to activate Rac1/cdc42/JNK, and this action was shown to be blocked by C29, a specific inhibitor of TLR2. CONCLUSIONS: Ruxolitinib was first identified to facilitate MK differentiation and thrombocytopoiesis, which may alleviate RIT. The potential mechanism of ruxolitinib was to promote MK differentiation via activating the Rac1/cdc42/JNK pathway through binding to TLR2.

Detection of key gene InDels in TGF-ß pathway and its relationship with growth traits in four sheep breeds.

TGF-ß signaling pathway plays an important role in regulating cell proliferation and differentiation, embryonic development, bone formation, etc. LTBP1, THBS1, SMAD4 and other genes are important members of TGF-ß signaling pathway. LTBP1 binds to TGF-ß, while THBS1 binds to LTBP1, which is an important signal transduction molecule in the TGF-ß pathway. In order to explore the effects of the insertion/deletion variation of three genes (LTBP1, THBS1, SMAD4) in the TGF-ß signaling pathway on the growth traits such as body length and body weight of sheep, a total of 625 healthy individuals from 4 breeds of the Tong sheep, Hu sheep, small-tail Han sheep and Lanzhou fat-tail sheep were identified and analyzed. In this study, we identified 4 InDel loci: one loci of LTBP1, two loci of THBS1, and one loci of SMAD4, respectively named as: InDel-1 (deletion 13 bp), InDel-2 (deletion 16 bp), InDel-3 (deletion 22 bp), InDel-4 (deletion 7 bp). Among the 4 analyzed breeds, association analysis showed that all new InDel polymorphisms were significantly associated with 10 different growth traits (p < 0.05), which may provide a theoretical basis for sheep breeding to accelerate the progression of marker-assisted selection in sheep breeding.

Relationship between volatile compounds of Picea likiangensis var. linzhiensis cone and host selection of Dioryctria abietella.

This study aimed to determine the relationship between volatile compounds of Picea likiangensis var. linzhiensis cone and host selection of Dioryctria abietella. During the infestation of P. likiangensis var. linzhiensis by D. abietella, their cones and branches emitted volatile compounds, which were extracted using CH2 Cl2 extraction and XAD2 adsorption methods, and were analyzed using gas chromatography-mass spectrometry. Before and after overwintering, D. abietella larva preferred annually infested cones and their extracts, and adult D. abietella preferred to lay eggs on annually infested cones and healthy cones of the year, and the oviposition rate of adult D. abietella was 72% on branches with healthy cones of the year, and no egg was laid on branches with annually healthy cones or branches without cones. The volatile compounds after infestation, α- and ß-pinene, were significantly higher in cones than those in other tissues; however, myrcene in cones was significantly lower than those in other tissues. The annually infested cones produced ß-caryophyllene and (1S)-(-)-ß-pinene, while the annually healthy cones and branches produced myrcene and 3-carene. The annually infested cones and their extracts attracted D. abietella larvae, while that of healthy cones and annually infested cones attracted the adults, indicating that the terpene compounds: α-pinene, ß-pinene, (1S)-(-)-ß-pinene, limonene, and ß-caryophyllene are attractive to D. abietella, and the terpene compounds-myrcene and 3-carene-from the branch tissues may be repulsive to D. abietella.

Patient-shared TCRß-CDR3 clonotypes correlate with favorable prognosis in chronic hepatitis B.

The presence of shared T-cell clonotypes was found in several different diseases, but its relationship with the progression of disease remains unclear. By sequencing the complementary determining region 3 of T-cell receptor (TCR) ß chains from the purified antigen-experienced CD8+ T cells, we characterized the T-cell repertoire in a prospective cohort study among 75 patients with chronic hepatitis B in China, as well as a healthy control and a validation cohort. We found that most T-cell clones from patients harbored the "patient-specific" TCR sequences. However, "patient-shared" TCR clonotypes were also widely found, which correlated with the favorable turnover of disease. Interestingly, the frequency of the "patient-shared" clonotypes can serve as a biomarker for favorable prognosis. Based on the clonotypes in those patients with favorable outcomes, we created a database including several clusters of protective anti-HBV CD8+ T-cell clonotypes that might be a reasonable target for therapeutic vaccine development or adoptive cell transfer therapy. These findings were validated in an additional independent cohort of patients. These results suggest that the "patient-shared" TCR clonotypes may serve as a valuable prognostic tool in the treatment of chronic hepatitis B and possibly other chronic viral diseases.

Analysis of T cell receptor repertoire in monozygotic twins concordant and discordant for chronic hepatitis B infection.

Due to their identical inheritance and shared surroundings, identical twins have been the recommended group for studying the susceptibility and prognosis of diseases. Here, CD8+ T cell receptor beta (TCRß) chains were analyzed by high-throughput sequencing in three pairs of healthy identical twins and chronic hepatitis B patients. The data showed a high level of similarity in the TCR repertoire of each pair in terms of average TCR Vß segment expression and frequency of the complementary determining region 3 (CDR3) pattern and skewed or oligoclonal clonotypes. Notably, the level of similarity in TCR Vß expression between the twins appeared to be independent of the consistency or inconsistency of chronic HBV infection, although the detailed CDR3 pattern and frequency were related to disease prognosis. There were more immunodominant clonotypes in patients with HBV antigen seroconversion, which showed an increased abundance. These immunodominant clonotypes may be used as favorable prognostic biomarkers and potential targets for immunotherapy. Thus, delineating the CD8+ T cell repertoire of identical twins with concordant chronic viral infections provides a promising means to screen protective TCR genes for immunotherapy.

π-Bridge modification of thiazole-bridged DPP polymers for high performance near-IR OSCs.

Thiophene-bridged and thiazole-bridged diketopyrrolopyrrole (DPP) polymers for near-infrared (near-IR) photovoltaic applications have been investigated via density functional theory (DFT) and Marcus charge transfer theory. Compared with thiophene-bridged DPP polymers, thiazole-bridged polymers have higher ionization potentials (IPs) but poorer optical absorption and worse charge transport capability. Different beneficial substituents replaced the hydrogen atoms (H) on the thiazole rings for the sake of reversing the disadvantages of thiazole-bridged DPP polymers and making these compounds better near-infrared absorbing materials. In order to gain deep insight into the impact of π-bridge modification on the photoelectronic properties of DPP polymers, their electronic structures, absorption capabilities, intramolecular charge transfer properties and charge transport performances have been analyzed. The calculated results reveal that π-bridge modification is a feasible way to improve the light-absorbing capability, electron excitation properties and charge transport performance of thiazole-bridged DPP polymers. It is expected that π-bridge modification can also work for other polymers containing π-bridge units. We hope that our research efforts will be helpful in the designing of new near-IR absorbing materials and could motivate further improvement of organic solar cells.

The spin-dependent Seebeck effect and the charge and spin figure of merit in a hybrid structure of single-walled carbon nanotubes and zigzag-edge graphene nanoribbons.

A hybrid structure of carbon nanotubes and graphene nanoribbons was predicted and synthesized (Y. Li et al., Nat. Nanotechnol., 2012, 7, 394-400; P. Lou, J. Phys. Chem. C, 2014, 118, 4475-4482). Herein, using the non-equilibrium Green's function (NEGF) combined with density functional theory (DFT), the thermal spin transport properties and the figure of merit (a material constant proportional to the efficiency of a thermoelectric couple made with the material) of a composite of single-walled carbon nanotubes and zigzag-edge graphene nanoribbons, labeled (6,6)SWCNT/n-ZGNR, are investigated for n = 1, 2, 3, and 8. The results manifest that spin-dependent currents with opposite flow directions were generated when a temperature gradient was applied between two electrodes, indicating the occurrence of the spin-dependent Seebeck effect (SDSE). Remarkably, when n = 3, the charge current is equal to zero, meaning that a perfect SDSE is observed. Moreover, a pure spin-dependent Seebeck diode (SDSD) effect can be observed. Finally, we notice that the device presents an n-type characteristic when n = 1, while the device has a p-type feature when n = 2. In particular, the spin-up thermopower is equal to the spin-down thermopower when n = 3; as a consequence, the charge thermopower is equal to zero, further demonstrating that a perfect SDSE is generated. These discoveries indicate that the (6,6)SWCNT/n-ZGNR is a promising candidate for spin caloritronics devices.

Is Statin Use Associated With Tendon Rupture? A Population-Based Retrospective Cohort Analysis.

Previous case reports and small studies have suggested that 3-hydroxy-3-methylglutaryl-CoA reductase inhibitors (HMG-CoA-Is) may increase the risk of tendon rupture. We conducted a population-based retrospective cohort evaluation to better assess this relationship. From approximately 800,000 enrollees of a private insurance database, those who were aged ≤64 years with at least 1 year of continuous enrollment were selected. Exposure was defined as initiation of HMG-CoA-I after the beginning of the study period. Each exposed person was matched with 2 controls of similar age and gender. Baseline characteristics, including known risk factors for tendon rupture, were compared between exposed and control cohorts with fidelity to the study's matched design. After adjusting for differences in follow-up and baseline characteristics, incidence rate ratios for tendon rupture was assessed in HMG-CoA-I users and nonusers. A total of 34,749 exposed patients were matched with 69,498 controls. There was no difference in the occurrence of tendon ruptures in HMG-CoA-I users versus nonusers. The results remained unchanged after adjustment for age and gender. In conclusion, this population-based retrospective cohort evaluation suggests that use of HMG-CoA-Is as a group are not associated with tendon rupture.

Theoretical Strategy To Design Novel n-Type Copolymers Based on Anthracene Diimide and Pyrido[2,3-g]quinoline Diimide for Organic Solar Cells.

The design and synthesis of efficient electron-transporting materials have been an active area of research in the area of organic solar cells (OSCs), organic field-effect transistors (OFETs), and organic light-emitting diodes (OLEDs). This paper is focused on designing novel n-type donor-acceptor (D-A) copolymers as electron-transporting materials for replacing the widely used fullerene acceptor materials in OSC applications. We first present a strategy which can remarkably improve the photovoltaic performances of D-A copolymer acceptors by means of adjusting the molecular planarity and intensifying the electron-withdrawing ability of electron-deficient units. Then we further analyze the role played by the D-A copolymer acceptor in the light-absorbing performance of the active layer. On the basis of two reported two D-A copolymer acceptors (PNDIT and P(NDI2OD-T2)) which are composed of an electron-deficient naphthalene diimide (NDI) unit and different electron-rich units of thiophene or bithiophene, replacement of the NDI unit with an anthracene diimide (ADI) unit and a pyrido[2,3-g]quinoline diimide (PQD) unit can produce two types of copolymer acceptors (P2, P3 and P2a, P3a). From the calculated results, the introduction of ADI and PQD units to replace the NDI unit can significantly improve the optoelectronic properties, light-absorbing efficiencies, and intermolecular electron transport abilities of the copolymers as well as exciton separation efficiencies at donor/acceptor interface. Finally, this study would give us a theoretical guidance to design efficient D-A copolymer acceptors for replacing fullerene acceptors in organic solar cells.

Glucocorticoid use is associated with increase in HDL and no change in other lipids in rheumatoid arthritis patients.

The aim of this article was to examine the association of glucocorticoid use and dose and changes in the lipid profile in rheumatoid arthritis (RA) patients. RA patients between January 1, 2001, and November 30, 2011, who received oral or intravenous glucocorticoids and who had lipid levels within 1 year before and 1 year after ongoing (at least 3 months) glucocorticoids use along with RA patients who did not take glucocorticoids (controls) were included. Glucocorticoid exposure was calculated as a weighted daily dose in prednisone equivalents and analyzed using as cutoff dose prednisone equivalent of 7.5 mg/day. Outcomes were changes in high-density lipoprotein (HDL), low-density lipoprotein (LDL), total cholesterol (TC), triglycerides, and TC/HDL ratio and were calculated in linear regression models adjusting for relevant confounders. In total, 202 subjects on glucocorticoids and 436 controls were included. The glucocorticoid group of ≥7.5 mg/day had the greatest increase in HDL of 6.0 mg/dL (p = 0.003 compared to controls) with lower increases of 3.1 and 2.4 mg/dL in the glucocorticoid group of <7.5 mg/day and controls, respectively. There were no significant differences in other parameters of the lipid profile between the two glucocorticoid groups and controls. In this RA cohort, glucocorticoid dose equivalent of prednisone ≥7.5 mg/day was associated with increased HDL and no change in LDL or TC/HDL ratio compared to no glucocorticoid use These results suggest that this glucocorticoid dose is not associated with an atherogenic lipid profile in RA, a finding that is important in this patient population at high risk for cardiovascular disease.