A sodium/potassium switch for G4-prone G/C-rich sequences.

Metal ions are essential components for the survival of living organisms. For most species, intracellular and extracellular ionic conditions differ significantly. As G-quadruplexes (G4s) are ion-dependent structures, changes in the [Na+]/[K+] ratio may affect the folding of genomic G4s. More than 11000 putative G4 sequences in the human genome (hg19) contain at least two runs of three continuous cytosines, and these mixed G/C-rich sequences may form a quadruplex or a competing hairpin structure based on G-C base pairing. In this study, we examine how the [Na+]/[K+] ratio influences the structures of G/C-rich sequences. The natural G4 structure with a 9-nt long central loop, CEBwt, was chosen as a model sequence, and the loop bases were gradually replaced by cytosines. The series of CEB mutations revealed that the presence of cytosines in G4 loops does not prevent G4 folding or decrease G4 stability but increases the probability of forming a competing structure, either a hairpin or an intermolecular duplex. Slow conversion to the quadruplex in vitro (in a potassium-rich buffer) and cells was demonstrated by NMR. 'Shape-shifting' sequences may respond to [Na+]/[K+] changes with delayed kinetics.

DNA i-motif formation at neutral pH is driven by kinetic partitioning.

Cytosine-rich DNA regions can form four-stranded structures based on hemi-protonated C.C+ pairs, called i-motifs (iMs). Using CD, UV absorption, NMR spectroscopy, and DSC calorimetry, we show that model (CnT3)3Cn (Cn) sequences adopt iM under neutral or slightly alkaline conditions for n > 3. However, the iMs are formed with long-lasting kinetics under these conditions and melt with significant hysteresis. Sequences with n > 6 melt in two or more separate steps, indicating the presence of different iM species, the proportion of which is dependent on temperature and incubation time. At ambient temperature, kinetically favored iMs of low stability are formed, most likely consisting of short C.C+ blocks. These species act as kinetic traps and prevent the assembly of thermodynamically favored, fully C.C+ paired iMs. A higher temperature is necessary to unfold the kinetic forms and enable their substitution by a slowly developing thermodynamic structure. This complicated kinetic partitioning process considerably slows down iM folding, making it much slower than the timeframes of biological reactions and, therefore, unlikely to have any biological relevance. Our data suggest kinetically driven iM species as more likely to be biologically relevant than thermodynamically most stable iM forms.

Structural Optimization of Azacryptands for Targeting Three-Way DNA Junctions.

Transient melting of the duplex-DNA (B-DNA) during DNA transactions allows repeated sequences to fold into non-B DNA structures, including DNA junctions and G-quadruplexes. These noncanonical structures can act as impediments to DNA polymerase progression along the duplex, thereby triggering DNA damage and ultimately jeopardizing genomic stability. Their stabilization by ad hoc ligands is currently being explored as a putative anticancer strategy since it might represent an efficient way to inflict toxic DNA damage specifically to rapidly dividing cancer cells. The relevance of this strategy is only emerging for three-way DNA junctions (TWJs) and, to date, no molecule has been recognized as a reference TWJ ligand, featuring both high affinity and selectivity. Herein, we characterize such reference ligands through a combination of in vitro techniques comprising affinity and selectivity assays (competitive FRET-melting and TWJ Screen assays), functional tests (qPCR and Taq stop assays), and structural analyses (molecular dynamics and NMR investigations). We identify novel azacryptands TrisNP-amphi and TrisNP-ana as the most promising ligands, interacting with TWJs with high affinity and selectivity. These ligands represent new molecular tools to investigate the cellular roles of TWJs and explore how they can be exploited in innovative anticancer therapies.

DNA Quadruplex Structure with a Unique Cation Dependency.

DNA quadruplex structures provide an additional layer of regulatory control in genome maintenance and gene expression and are widely used in nanotechnology. We report the discovery of an unprecedented tetrastranded structure formed from a native G-rich DNA sequence originating from the telomeric region of Caenorhabditis elegans. The structure is defined by multiple properties that distinguish it from all other known DNA quadruplexes. Most notably, the formation of a stable so-called KNa-quadruplex (KNaQ) requires concurrent coordination of K+ and Na+ ions at two distinct binding sites. This structure provides novel insight into G-rich DNA folding under ionic conditions relevant to eukaryotic cell physiology and the structural evolution of telomeric DNA. It highlights the differences between the structural organization of human and nematode telomeric DNA, which should be considered when using C. elegans as a model in telomere biology, particularly in drug screening applications. Additionally, the absence/presence of KNaQ motifs in the host/parasite introduces an intriguing possibility of exploiting the KNaQ fold as a plausible antiparasitic drug target. The structure's unique shape and ion dependency and the possibility of controlling its folding by using low-molecular-weight ligands can be used for the design or discovery of novel recognition DNA elements and sensors.

A thermosensitive gel matrix for bioreactor-assisted in-cell NMR of nucleic acids and proteins.

Introducing the flow through the bioreactor has revolutionized in-cell NMR spectroscopy by prolonging the measurement time available to acquire spectral information about biomacromolecules in metabolically active cells. Bioreactor technology relies on immobilizer matrices, which secure cells in the active volume of the NMR coil and enable uniform perfusion of the growth medium, supplying fresh nutrients to the cells while removing toxic byproducts of their metabolism. The main drawbacks of commonly used matrices include the inability to recover intact cells post-measurement for additional analyses and/or requirements for specific operating temperatures. Here, we report on the development and characterization of a set of thermosensitive and nontoxic triblock copolymers based on poly(D,L-lactide)-b-poly(ethylene glycol)-b-poly(D,L-lactide) (PLA-PEG-PLA). Here, we show for the first time that these copolymers are suitable as immobilizer matrices for the acquisition of in-cell NMR spectra of nucleic acids and proteins over a commonly used sample temperature range of 15-40 °C and, importantly, allow recovery of cells after completion of in-cell NMR spectra acquisition. We compared the performances of currently used matrices in terms of cell viability (dye exclusion assays), cellular metabolism (1D 31P NMR), and quality of in-cell NMR spectra of two model biomacromolecules (hybrid double-stranded/i-motif DNA and ubiquitin). Our results demonstrate the suitability and advantages of PLA-PEG-PLA copolymers for application in bioreactor-assisted in-cell NMR.

Insight into formation propensity of pseudocircular DNA G-hairpins.

We recently showed that Saccharomyces cerevisiae telomeric DNA can fold into an unprecedented pseudocircular G-hairpin (PGH) structure. However, the formation of PGHs in the context of extended sequences, which is a prerequisite for their function in vivo and their applications in biotechnology, has not been elucidated. Here, we show that despite its 'circular' nature, PGHs tolerate single-stranded (ss) protrusions. High-resolution NMR structure of a novel member of PGH family reveals the atomistic details on a junction between ssDNA and PGH unit. Identification of new sequences capable of folding into one of the two forms of PGH helped in defining minimal sequence requirements for their formation. Our time-resolved NMR data indicate a possibility that PGHs fold via a complex kinetic partitioning mechanism and suggests the existence of K+ ion-dependent PGH folding intermediates. The data not only provide an explanation of cation-type-dependent formation of PGHs, but also explain the unusually large hysteresis between PGH melting and annealing noted in our previous study. Our findings have important implications for DNA biology and nanotechnology. Overrepresentation of sequences able to form PGHs in the evolutionary-conserved regions of the human genome implies their functionally important biological role(s).

Fibroblast growth factor receptor influences primary cilium length through an interaction with intestinal cell kinase.

Vertebrate primary cilium is a Hedgehog signaling center but the extent of its involvement in other signaling systems is less well understood. This report delineates a mechanism by which fibroblast growth factor (FGF) controls primary cilia. Employing proteomic approaches to characterize proteins associated with the FGF-receptor, FGFR3, we identified the serine/threonine kinase intestinal cell kinase (ICK) as an FGFR interactor. ICK is involved in ciliogenesis and participates in control of ciliary length. FGF signaling partially abolished ICK's kinase activity, through FGFR-mediated ICK phosphorylation at conserved residue Tyr15, which interfered with optimal ATP binding. Activation of the FGF signaling pathway affected both primary cilia length and function in a manner consistent with cilia effects caused by inhibition of ICK activity. Moreover, knockdown and knockout of ICK rescued the FGF-mediated effect on cilia. We provide conclusive evidence that FGF signaling controls cilia via interaction with ICK.

Role of folding kinetics of secondary structures in telomeric G-overhangs in the regulation of telomere maintenance in Saccharomyces cerevisiae.

The ends of eukaryotic chromosomes typically contain a 3' ssDNA G-rich protrusion (G-overhang). This overhang must be protected against detrimental activities of nucleases and of the DNA damage response machinery and participates in the regulation of telomerase, a ribonucleoprotein complex that maintains telomere integrity. These functions are mediated by DNA-binding proteins, such as Cdc13 in Saccharomyces cerevisiae, and the propensity of G-rich sequences to form various non-B DNA structures. Using CD and NMR spectroscopies, we show here that G-overhangs of S. cerevisiae form distinct Hoogsteen pairing-based secondary structures, depending on their length. Whereas short telomeric oligonucleotides form a G-hairpin, their longer counterparts form parallel and/or antiparallel G-quadruplexes (G4s). Regardless of their topologies, non-B DNA structures exhibited impaired binding to Cdc13 in vitro as demonstrated by electrophoretic mobility shift assays. Importantly, whereas G4 structures formed relatively quickly, G-hairpins folded extremely slowly, indicating that short G-overhangs, which are typical for most of the cell cycle, are present predominantly as single-stranded oligonucleotides and are suitable substrates for Cdc13. Using ChIP, we show that the occurrence of G4 structures peaks at the late S phase, thus correlating with the accumulation of long G-overhangs. We present a model of how time- and length-dependent formation of non-B DNA structures at chromosomal termini participates in telomere maintenance.

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly.

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

Elucidation of protein interactions necessary for the maintenance of the BCR-ABL signaling complex.

Many patients with chronic myeloid leukemia in deep remission experience return of clinical disease after withdrawal of tyrosine kinase inhibitors (TKIs). This suggests signaling of inactive BCR-ABL, which allows the survival of cancer cells, and relapse. We show that TKI treatment inhibits catalytic activity of BCR-ABL, but does not dissolve BCR-ABL core signaling complex, consisting of CRKL, SHC1, GRB2, SOS1, cCBL, p85a-PI3K, STS1 and SHIP2. Peptide microarray and co-immunoprecipitation results demonstrate that CRKL binds to proline-rich regions located in C-terminal, intrinsically disordered region of BCR-ABL, that SHC1 requires pleckstrin homology, src homology and tyrosine kinase domains of BCR-ABL for binding, and that BCR-ABL sequence motif located in disordered region around phosphorylated tyrosine 177 mediates binding of three core complex members, i.e., GRB2, SOS1, and cCBL. Further, SHIP2 binds to the src homology and tyrosine kinase domains of BCR-ABL and its inositol phosphatase activity contributes to BCR-ABL-mediated phosphorylation of SHC1. Together, this study characterizes protein-protein interactions within the BCR-ABL core complex and determines the contribution of particular BCR-ABL domains to downstream signaling. Understanding the structure and dynamics of BCR-ABL interactome is critical for the development of drugs targeting integrity of the BCR-ABL core complex.

Parallel G-triplexes and G-hairpins as potential transitory ensembles in the folding of parallel-stranded DNA G-Quadruplexes.

Guanine quadruplexes (G4s) are non-canonical nucleic acids structures common in important genomic regions. Parallel-stranded G4 folds are the most abundant, but their folding mechanism is not fully understood. Recent research highlighted that G4 DNA molecules fold via kinetic partitioning mechanism dominated by competition amongst diverse long-living G4 folds. The role of other intermediate species such as parallel G-triplexes and G-hairpins in the folding process has been a matter of debate. Here, we use standard and enhanced-sampling molecular dynamics simulations (total length of ∼0.9 ms) to study these potential folding intermediates. We suggest that parallel G-triplex per se is rather an unstable species that is in local equilibrium with a broad ensemble of triplex-like structures. The equilibrium is shifted to well-structured G-triplex by stacked aromatic ligand and to a lesser extent by flanking duplexes or nucleotides. Next, we study propeller loop formation in GGGAGGGAGGG, GGGAGGG and GGGTTAGGG sequences. We identify multiple folding pathways from different unfolded and misfolded structures leading towards an ensemble of intermediates called cross-like structures (cross-hairpins), thus providing atomistic level of description of the single-molecule folding events. In summary, the parallel G-triplex is a possible, but not mandatory short-living (transitory) intermediate in the folding of parallel-stranded G4.

Towards Profiling of the G-Quadruplex Targeting Drugs in the Living Human Cells Using NMR Spectroscopy.

Recently, the 1H-detected in-cell NMR spectroscopy has emerged as a unique tool allowing the characterization of interactions between nucleic acid-based targets and drug-like molecules in living human cells. Here, we assess the application potential of 1H and 19F-detected in-cell NMR spectroscopy to profile drugs/ligands targeting DNA G-quadruplexes, arguably the most studied class of anti-cancer drugs targeting nucleic acids. We show that the extension of the original in-cell NMR approach is not straightforward. The severe signal broadening and overlap of 1H in-cell NMR spectra of polymorphic G-quadruplexes and their complexes complicate their quantitative interpretation. Nevertheless, the 1H in-cell NMR can be used to identify drugs that, despite strong interaction in vitro, lose their ability to bind G-quadruplexes in the native environment. The in-cell NMR approach is adjusted to a recently developed 3,5-bis(trifluoromethyl)phenyl probe to monitor the intracellular interaction with ligands using 19F-detected in-cell NMR. The probe allows dissecting polymorphic mixture in terms of number and relative populations of individual G-quadruplex species, including ligand-bound and unbound forms in vitro and in cellulo. Despite the probe's discussed limitations, the 19F-detected in-cell NMR appears to be a promising strategy to profile G-quadruplex-ligand interactions in the complex environment of living cells.

Thermal and pH Stabilities of i-DNA: Confronting in vitro Experiments with Models and In-Cell NMR Data.

Recent studies indicate that i-DNA, a four-stranded cytosine-rich DNA also known as the i-motif, is actually formed in vivo; however, a systematic study on sequence effects on stability has been missing. Herein, an unprecedented number of different sequences (271) bearing four runs of 3-6 cytosines with different spacer lengths has been tested. While i-DNA stability is nearly independent on total spacer length, the central spacer plays a special role on stability. Stability also depends on the length of the C-tracts at both acidic and neutral pHs. This study provides a global picture on i-DNA stability thanks to the large size of the introduced data set; it reveals unexpected features and allows to conclude that determinants of i-DNA stability do not mirror those of G-quadruplexes. Our results illustrate the structural roles of loops and C-tracts on i-DNA stability, confirm its formation in cells, and allow establishing rules to predict its stability.

Metabolic stress regulates ERK activity by controlling KSR-RAF heterodimerization.

Altered cell metabolism is a hallmark of cancer, and targeting specific metabolic nodes is considered an attractive strategy for cancer therapy. In this study, we evaluate the effects of metabolic stressors on the deregulated ERK pathway in melanoma cells bearing activating mutations of the NRAS or BRAF oncogenes. We report that metabolic stressors promote the dimerization of KSR proteins with CRAF in NRAS-mutant cells, and with oncogenic BRAF in BRAFV600E-mutant cells, thereby enhancing ERK pathway activation. Despite this similarity, the two genomic subtypes react differently when a higher level of metabolic stress is induced. In NRAS-mutant cells, the ERK pathway is even more stimulated, while it is strongly downregulated in BRAFV600E-mutant cells. We demonstrate that this is caused by the dissociation of mutant BRAF from KSR and is mediated by activated AMPK. Both types of ERK regulation nevertheless lead to cell cycle arrest. Besides studying the effects of the metabolic stressors on ERK pathway activity, we also present data suggesting that for efficient therapies of both genomic melanoma subtypes, specific metabolic targeting is necessary.

Analysis of binding interfaces of the human scaffold protein AXIN1 by peptide microarrays.

Intrinsically disordered regions (IDRs) are protein regions that lack persistent secondary or tertiary structure under native conditions. IDRs represent >40% of the eukaryotic proteome and play a crucial role in protein-protein interactions. The classical approach for identification of these interaction interfaces is based on mutagenesis combined with biochemical techniques such as coimmunoprecipitation or yeast two-hybrid screening. This approach either provides information of low resolution (large deletions) or very laboriously tries to precisely define the binding epitope via single amino acid substitutions. Here, we report the use of a peptide microarray based on the human scaffold protein AXIN1 for high-throughput and -resolution mapping of binding sites for several AXIN1 interaction partners in vitro For each of the AXIN1-binding partners tested, i.e. casein kinase 1 ϵ (CK1ϵ); c-Myc; peptidyl-prolyl cis/trans isomerase, NIMA-interacting 1 (Pin1); and p53, we found at least three different epitopes, predominantly in the central IDR of AXIN1. We functionally validated the specific AXIN1-CK1ϵ interaction identified here with epitope-mimicking peptides and with AXIN1 variants having deletions of short binding epitopes. On the basis of these results, we propose a model in which AXIN1 competes with dishevelled (DVL) for CK1ϵ and regulates CK1ϵ-induced phosphorylation of DVL and activation of Wnt/ß-catenin signaling.

Monitoring DNA-Ligand Interactions in Living Human Cells Using NMR Spectroscopy.

Studies on DNA-ligand interactions in the cellular environment are problematic due to the lack of suitable biophysical tools. To address this need, we developed an in-cell NMR-based approach for monitoring DNA-ligand interactions inside the nuclei of living human cells. Our method relies on the acquisition of NMR data from cells electroporated with preformed DNA-ligand complexes. The impact of the intracellular environment on the integrity of the complexes is assessed based on in-cell NMR signals from unbound and ligand-bound forms of a given DNA target. This technique was tested on complexes of two model DNA fragments and four ligands, namely, a representative DNA minor-groove binder (netropsin) and ligands binding DNA base-pairing defects (naphthalenophanes). In the latter case, we demonstrate that two of the three in vitro-validated ligands retain their ability to form stable interactions with their model target DNA in cellulo, whereas the third one loses this ability due to off-target interactions with genomic DNA and cellular metabolites. Collectively, our data suggest that direct evaluation of the behavior of drug-like molecules in the intracellular environment provides important insights into the development of DNA-binding ligands with desirable biological activity and minimal side effects resulting from off-target binding.

Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes.

Ionizing radiation produces clustered damage to DNA which is difficult to repair and thus more harmful than single lesions. Clustered lesions have only been investigated in dsDNA models. Introducing the term 'clustered damage to G-quadruplexes' we report here on the structural effects of multiple tetrahydrofuranyl abasic sites replacing loop adenines (A/AP) and tetrad guanines (G/AP) in quadruplexes formed by the human telomere d[AG3(TTAG3)3] (htel-22) and d[TAG3(TTAG3)3TT] (htel-25) in K+ solutions. Single to triple A/APs increased the population of parallel strands in their structures by stabilizing propeller type loops, shifting the antiparallel htel-22 into hybrid or parallel quadruplexes. In htel-25, the G/APs inhibited the formation of parallel strands and these adopted antiparallel topologies. Clustered G/AP and A/APs reduced the thermal stability of the wild-type htel-25. Depending on position, A/APs diminished or intensified the damaging effect of the G/APs. Taken together, clustered lesions can disrupt the topology and stability of the htel quadruplexes and restrict their conformational space. These in vitro results suggest that formation of clustered lesions in the chromosome capping structure can result in the unfolding of existing G-quadruplexes which can lead to telomere shortening.

An inactivating mutation in intestinal cell kinase, ICK, impairs hedgehog signalling and causes short rib-polydactyly syndrome.

The short rib polydactyly syndromes (SRPS) are a group of recessively inherited, perinatal-lethal skeletal disorders primarily characterized by short ribs, shortened long bones, varying types of polydactyly and concomitant visceral abnormalities. Mutations in several genes affecting cilia function cause SRPS, revealing a role for cilia function in skeletal development. To identify additional SRPS genes and discover novel ciliary molecules required for normal skeletogenesis, we performed exome sequencing in a cohort of patients and identified homozygosity for a missense mutation, p.E80K, in Intestinal Cell Kinase, ICK, in one SRPS family. The p.E80K mutation abolished serine/threonine kinase activity, resulting in altered ICK subcellular and ciliary localization, increased cilia length, aberrant cartilage growth plate structure, defective Hedgehog and altered ERK signalling. These data identify ICK as an SRPS-associated gene and reveal that abnormalities in signalling pathways contribute to defective skeletogenesis.

Evaluation of the Stability of DNA i-Motifs in the Nuclei of Living Mammalian Cells.

C-rich DNA has the capacity to form a tetra-stranded structure known as an i-motif. The i-motifs within genomic DNA have been proposed to contribute to the regulation of DNA transcription. However, direct experimental evidence for the existence of these structures in vivo has been missing. Whether i-motif structures form in complex environment of living cells is not currently known. Herein, using state-of-the-art in-cell NMR spectroscopy, we evaluate the stabilities of i-motif structures in the complex cellular environment. We show that i-motifs formed from naturally occurring C-rich sequences in the human genome are stable and persist in the nuclei of living human cells. Our data show that i-motif stabilities in vivo are generally distinct from those in vitro. Our results are the first to interlink the stability of DNA i-motifs in vitro with their stability in vivo and provide essential information for the design and development of i-motif-based DNA biosensors for intracellular applications.

Structure of a Stable G-Hairpin.

In this study, we report the first atomic resolution structure of a stable G-hairpin formed by a natively occurring DNA sequence. An 11-nt long G-rich DNA oligonucleotide, 5'-d(GTGTGGGTGTG)-3', corresponding to the most abundant sequence motif in irregular telomeric DNA from Saccharomyces cerevisiae (yeast), is demonstrated to adopt a novel type of mixed parallel/antiparallel fold-back DNA structure, which is stabilized by dynamic G:G base pairs that transit between N1-carbonyl symmetric and N1-carbonyl, N7-amino base-pairing arrangements. Although the studied sequence first appears to possess a low capacity for base pairing, it forms a thermodynamically stable structure with a rather complex topology that includes a chain reversal arrangement of the backbone in the center of the continuous G-tract and 3'-to-5' stacking of the terminal residues. The structure reveals previously unknown principles of the folding of G-rich oligonucleotides that could be applied to the prediction of natural and/or the design of artificial recognition DNA elements. The structure also demonstrates that the folding landscapes of short DNA single strands is much more complex than previously assumed.