Physiological traits of endornavirus-infected and endornavirus-free common bean (Phaseolus vulgaris) cv Black Turtle Soup.

This study evaluated the physiological traits of eight lines of common bean (Phaseolus vulgaris) cv. Black Turtle Soup, four of which were double-infected with Phaseolus vulgaris endornavirus 1 and Phaseolus vulgaris endornavirus 2, and four of which were endornavirus-free. Plants from all eight lines were morphologically similar and did not show statistically significant differences in plant height, wet weight, number of days to flowering and pod formation, pods per plant, pod thickness, seed size, number of seeds per pod, and anthocyanin content. However, the endornavirus-infected lines had faster seed germination, longer radicle, lower chlorophyll content, higher carotene content, longer pods, and higher weight of 100 seeds, all of which were statistically significant. The endornaviruses were not associated with visible pathogenic effects.

First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana.

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5'TATCCCTATGTGCTTGAGAG3') and TRS-R (5'CATAGACCACCAGAGTCACA3'), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

A novel monopartite dsRNA virus from rhododendron.

A dsRNA molecule of 3.4 kbp was extracted from two great rhododendron samples from Great Smoky Mountains National Park. Sequencing of this molecule suggests that it represents the genome of an undescribed virus, for which the provisional name rhododendron virus A (RhVA) is proposed. In phylogenetic analyses, this virus clustered together with southern tomato virus and related viruses, forming a coherent and distinct clade among dsRNA viruses. RhVA likely belongs to a yet-to-be-established taxon of viruses with a non-segmented dsRNA genome.

First Report of Sweet potato virus G and Sweet potato virus 2 Infecting Sweet Potato in Spain.

Sweet potato feathery mottle virus (SPFMV), Sweet potato virus G (SPVG), and Sweet potato virus 2 (SPV2) (also known as Ipomoea vein mosaic virus (2) and Sweet potato virus Y) are members of the genus Potyvirus (family Potyviridae), which can synergistically interact with Sweet potato chlorotic stunt virus (SPCSV; genus Crinivirus, family Closteroviridae), increasing symptom severity on sweet potato (Ipomoea batatas (L.) Lam.) (1,2,3). During 2002, 2006, and 2007, vine cuttings from sweet potato plants were collected in Malaga (southern Spain), Tenerife, and Lanzarote (Canary Islands, Spain) to be tested for the presence of viruses. Sampled plants ranged from asymptomatic to severely affected by symptoms of sweet potato virus disease (SPVD), caused by dual infection with SPFMV or other potyviruses with SPCSV. Scions collected during 2002 were grafted to the indicator host I. setosa. Foliar samples from I. setosa were used for nitrocellulose membrane (NCM)-ELISA testing with antisera specific to SPVG or SPV2 (provided by C. A. Clark, Louisiana State University) following described procedures (2). NCM-ELISA testing indicated that SPVG was present in samples from Malaga, Tenerife, and Lanzarote, whereas SPV2 was only found in samples from Malaga. Reverse-transcription (RT)-PCR was performed on RNA extracts from sweet potato or I. setosa leaves using primer pairs MA541 (5'-AACAATTCCAGATAGTAGAGGGGTTG-3')/MA542(5'-TGTGGGGACAGCATGATCCAATAG-3') and MA540 (5'-AACCCCAACACCAGCAAAATCAGTTAAG-3')/MA542 corresponding to the capsid protein (CP) genes of SPVG and SPV2, respectively. Thirteen of 47 samples from Malaga and 4 of 30 from the Canary Islands yielded the expected 483-bp DNA fragment with the primers for SPVG. Fifteen of 47 samples from Malaga yielded the expected 627-bp DNA fragment with primers for SPV2. Two RT-PCR amplicons of SPVG, one from Malaga and one from Tenerife, were sequenced. Their nucleotide sequences (GenBank Accession Nos. EF577438 and EF577439, respectively) showed 98% identity to SPVG isolates from Louisiana (2) and China. Sequencing of one RT-PCR amplicon of SPV2 from Malaga resulted in a nucleotide sequence (GenBank Accession No. EF577437) with 99% identity to SPV2 from Lousiana and Australia (3). The presence of SPVG and SPV2 increases the already existing risk of SPVD, since the main viruses involved in the synergism, SPFMV and SPCSV, are present in Spain (4). SPCSV was also detected in some of the plants infected with SPVG or SPV2, in some cases, in coinfection with SPFMV. References: (1) C. D. Kokkinos and C. A. Clark. Plant Dis. 90:1347, 2006. (2) E. R. Souto et al. Plant Dis. 87:1226, 2003. (3) F. Tairo et al. Plant Dis. 90:1120, 2006. (4) R. A. Valverde et al. Plant Dis. 88:428, 2004.

First Report of a Begomovirus Infecting Sweetpotato in Kenya.

Previous surveys for viruses in sweetpotatoes (Ipomoea batatas) in Africa did not assay for the presence of begomoviruses such as Sweet potato leaf curl virus (SPLCV), which have been found recently in the Americas and Asia. Symptomatic sweetpotato plants, including some with leaf curling symptoms similar to those observed in SPLCV-infected sweet-potato plants (2), were collected from a germplasm collection plot at Kakamega Research Station in Western Kenya during February 2005. Whiteflies, the vectors for begomoviruses, were observed in the same plots. Ipomoea setosa plants graft-inoculated with scions from the symptomatic sweetpotato developed leaf curl, leaf roll, interveinal chlorosis, and stunting symptoms similar to those caused by infection with SPLCV alone or in combination with Sweet potato feathery mottle virus. Total DNA was isolated from 10 I. setosa plants using the GenElute Plant Genomic DNA Kit (Sigma-Aldrich Inc., St. Louis, MO). Sweetpotato cuttings from 39 clones, selected from the Kenyan germplasm collection for their resistance or susceptibility to sweetpotato virus disease (SPVD), were sent to the Plant Germplasm Quarantine Office of USDA-ARS. The cuttings were planted in a greenhouse. Total DNA was extracted from sweetpotato leaves 1 month later using a cetyltrimethylammoniumbromide (CTAB) extraction method (1). Degenerate primers SPG1/SPG2, developed for PCR detection of begomoviruses (1), amplified a 912-bp DNA fragment from 3 of 10 DNA extracts from I. setosa and 5 of 39 sweetpotato plants held in quarantine. The primers anneal to regions of open reading frame (ORF) AC2 and ORF AC1 that are highly conserved in begomoviruses infecting sweetpotato. SPLCV-specific primers PW285-1/PW285-2 (2) amplified a 512-bp DNA fragment of ORF AC1 from seven samples (two from I. setosa and five from I. batatas). Amplicons from three independent PCR assays of two samples and single PCR assays of four additional samples were cloned into the pGEM-T Easy vector. Clone inserts were sequenced, and compared with sequences deposited in GenBank using the basic local alignment search tool (BLAST). Sequences were closely related to SPLCV (GenBank Accession No. AF104036) with nucleotide sequence identities varying from 93% (GenBank Accession No. DQ361004) to 97% (GenBank Accession No. DQ361005). The presence of the virus poses a challenge to the dissemination of planting materials in the region because begomovirus-infected plants often do not show symptoms. To our knowledge, this is the first report of a begomovirus infecting sweetpotato in Kenya or the East African Region. References: (1) R. Li et al. Plant Dis. 88:1347, 2004. (2) P. Lotrakul et al. Plant Dis. 82:1253, 1998.

Corticotropin-releasing hormone-binding protein: biochemistry and function from fishes to mammals.

Corticotropin-releasing hormone (CRH) plays multiple roles in vertebrate species. In mammals, it is the major hypothalamic releasing factor for pituitary adrenocorticotropin secretion, and is a neurotransmitter or neuromodulator at other sites in the central nervous system. In non-mammalian vertebrates, CRH not only acts as a neurotransmitter and hypophysiotropin, it also acts as a potent thyrotropin-releasing factor, allowing CRH to regulate both the adrenal and thyroid axes, especially in development. The recent discovery of a family of CRH-like peptides suggests that multiple CRH-like ligands may play important roles in these functions. The biological effects of CRH and the other CRH-like ligands are mediated and modulated not only by CRH receptors, but also via a highly conserved CRH-binding protein (CRH-BP). The CRH-BP has been identified not only in mammals, but also in non-mammalian vertebrates including fishes, amphibians, and birds, suggesting that it is a phylogenetically ancient protein with extensive structural and functional conservation. In this review, we discuss the biochemical properties of the characterized CRH-BPs and the functional roles of the CRH-BP. While much of the in vitro and in vivo data to date support an 'inhibitory' role for the CRH-BP in which it binds CRH and other CRH-like ligands and prevents the activation of CRH receptors, the possibility that the CRH-BP may also exhibit diverse extra- and intracellular roles in a cell-specific fashion and at specific times in development is also discussed.

Biochemical characterization and expression analysis of the Xenopus laevis corticotropin-releasing hormone binding protein.

Corticotropin-releasing hormone (CRH) plays a key role in the regulation of responses to stress. The presence of a high affinity binding protein for CRH (CRH-BP) has been reported in mammals. We have characterized the biochemical properties and expression of CRH-BP in the South African clawed frog, Xenopus laevis. Apparent inhibition constants (K(i[app])) for different ligands were determined by competitive binding assay. Xenopus CRH-BP (xCRH-BP) exhibited a high affinity for xCRH (K(i[app])=1.08 nM) and sauvagine (1.36 nM). Similar to rodent and human CRH-BPs, the frog protein binds urotensin I and urocortin with high affinity, and ovine CRH with low affinity. RT-PCR analysis showed that xCRH-BP is expressed in brain, pituitary, liver, tail, and intestine. Brain xCRH-BP mRNA is expressed at a relatively constant level throughout metamorphosis and increases slightly in the metamorphic frog. By contrast, the gene is strongly upregulated in the tail at metamorphic climax. Thus, regulation of xCRH-BP gene expression is tissue specific. Because xCRH-BP binds CRH-like peptides with high affinity the protein may regulated, the bioavailability of CRH in amphibia as it does in mammals.

Biological and Molecular Properties of a Begomovirus from Dicliptera sexangularis.

ABSTRACT Sixangle foldwing, Dicliptera sexangularis (Acanthaceae), showing severe yellow mottle and leaf distortion symptoms was collected from the shoreline of Calusa Island (Lee County, FL). The putative virus was transmitted from infected D. sexangularis to healthy seedlings by mechanical, whitefly (Bemisia tabaci biotype B), and graft-inoculations. Different forms of geminivirus-like DNAs were detected in total DNA extracted from infected plants by Southern blot hybridization analyses using DNA-A and -B of Bean golden mosaic virus (BGMV) from Guatemala as probes. Preliminary polymerase chain reaction experiments and sequence comparisons indicated that the virus was a distinct bipartite begomovirus. The virus was designated Dicliptera yellow mottle virus (DiYMV). Replicative dsDNAs of DiYMV were extracted, digested with selected restriction enzymes, and cloned into a plasmid vector. Both DNA-A and -B were sequenced and compared with those of other begomoviruses. Phylogenetic analyses using AV1, AC1, and BV1 nucleotide sequences indicated that DiYMV has a close relationship with the New World begomoviruses, especially those distributed in the nearby geographic areas of the Florida coast and the Caribbean Basin. However, different percent nucleotide sequence identities and phylogenetic relationships were detected when different open reading frames (ORFs) of DiYMV were compared with their counterparts from begomoviruses from the Caribbean Basin. Based on phylogenetic analyses of the AC1 and BV1 ORFs, DiYMV was closely related to BGMV type II isolates, whereas sequence comparisons of the common region and the AC4-derived amino acid sequences indicated its close relationship with Potato yellow mosaic virus from Venezuela.

First Report of Oidium sp. Powdery Mildew and Tomato spotted wilt virus on Melampodium divaricatum.

Melampodium divaricatum (Rich. ex Pers.) DC. (=M. paludosum H.B.K.), a member of the family Asteraceae and native to South America, is a recent introduction for use as a summer bedding ornamental. In September 1999, melampodium plants in multiple Baton Rouge landscapes were observed with signs of powdery mildew and symptoms of a virus-like disease. Powdery mildew spread throughout one of the plantings by late November and infected flowers and leaves. An Oidium species sporulated on both leaf surfaces but was more common on the adaxial surface. Ellipsoid conidia were produced in chains, lacked fibrosin bodies, and averaged 31 × 19 µm. No sexual stage was observed. Eight of 63 plants (cv. Derby) in one of the plantings showed virus disease symptoms that included severe leaf mosaic, leaf malformation, and stunting. Leaves from infected plants were used to sap inoculate seedling plants of melampodium and Nicotiana benthamiana. Melampodium seedlings developed typical mosaic symptoms after 48 to 56 days. N. benthamiana developed severe chlorosis and mosaic, then wilted and died after 14 days. Noninoculated plants of both species remained healthy. The virus in both plant species was identified as Tomato spotted wilt virus (TSWV) by enzyme-linked immunosorbent assay (ELISA) (Agdia, Elkhart, IN). ELISA tests for presence of Impatiens necrotic spot virus were negative. This is the first report of powdery mildew and TSWV on M. divaricatum.

Whitefly Transmission of Sweetpotato chlorotic stunt virus.

The genus Crinivirus of the plant virus family Closteroviridae include members that are bipartite and whitefly-transmitted (2). The Crinivirus, Sweetpotato chlorotic stunt virus (SPCSV), was described from sweetpotato (Ipomoea batatas) in Nigeria (1). Vector transmission studies of SPCSV were conducted using two whitefly species, the sweetpotato whitefly (Bemisia tabaci biotype B) and the bandedwinged whitefly (Trialeurodes abutilonea). Whitefly colonies were reared in the laboratory on cotton plants in plexiglass cages. To evaluate transmission efficiency, single whiteflies were used in all experiments. Whiteflies were given 2-day acquisition access periods on I. batatas cv. White Bunch co-infected with SPCSV and Sweetpotato feathery mottle virus (SPFMV). Single whiteflies were then placed on individual healthy I. nil cv. Scarlet O'Hara seedlings for 2-day inoculation access periods. Plants then were sprayed with imidacloprid insecticide and placed in the greenhouse. Four independent tests were performed with each whitefly species. Seven to 10 days after exposing test plants to B. tabaci, 6 of 35, 4 of 28, 5 of 30, and 3 of 25 I. nil plants showed symptoms that consisted of leaf distortion and yellowing. In similar experiments conducted with T. abutilonea, 1 of 33, 0 of 32, 1 of 30, and 2 of 28 I. nil plants showed symptoms. Two weeks after inoculations, reverse transcription- polymerase chain reaction assays were performed with all 22 symptomatic and five randomly selected symptomless plants using primers that amplify the SPCSV heat shock protein 70 (HSP70) homolog gene fragment (446 bp). All 22 symptomatic plants were positive while the five symptomless plants tested were negative. Lower transmission rates were obtained with T. abutilonea (3.2%) when compared with B. tabaci (15.2%). These two whiteflies are present in sweetpotato fields in Louisiana and may play an important role in the spread of SPCSV. This represents the first report of transmission of SPCSV by the bandedwinged whitefly References: (1) S. Winter et al. Phytopathology 82:869-875, 1992. (2) G. C. Wisler et al. Plant Dis. 82:270-280, 1998.

First Report of Tomato yellow leaf curl virus in Louisiana.

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (Geminiviridae) that causes a serious disease of tomato throughout the world. In 1997, the strain from Israel of TYLCV (TYLCV-IS) was found infecting tomatoes in Florida for the first time in the United States (1). During late spring of 2000, approximately 90% of the tomato plants (Lycopersicon esculentum) in a farm near New Orleans exhibited severe stunting, leaf cupping, and chlorosis. Symptoms were similar to those caused by TYLCV. Whiteflies (Bemisia tabaci biotype B) were present in the field but in relatively low numbers. The effect on yield reduction varied from negligible (late infections) to 100% (early infections). Six selected plants showing symptoms were assayed by polymerase chain reaction (PCR) using begomovirus-specific primers. Capsicum frutescens infected with an isolate of Texas pepper virus from Costa Rica was used as positive control. DNA was extracted using Plant DNAzol Reagent (GIBCO BRL). PCR was conducted using degenerate primers AV494/AC1048 that amplify the core coat protein region of most begomoviruses (2). PCR yielded a DNA fragment of approximately 550 bp, suggesting that a begomovirus was associated with the disease. The amplified DNA of one field isolate was cloned and the nucleotide (nt) sequence determined. Sequence comparisons with other begomoviruses in the GenBank Database indicated that the Louisiana isolate shared 100% nt identity with TYLCV-IS (GenBank Accession X76319). Successful transmission (100%) to Bonny Best tomato were obtained with four groups of 10 whiteflies each (B. tabaci biotype B) that fed on TYLCV-IS infected tomato plants. Acquisition and transmission feedings were for 2 days. In all cases, the virus was diagnosed by the ability to reproduce typical TYLCV-like symptoms in tomato and PCR. The virus was also successfully graft-transmitted to tomato cv. Bonny Best, Nicotiana benthamiana, and tomatillo (Physalis ixocarpa) using scions from tomato plants infected with a whitefly transmitted virus isolate. This is the first report of TYLCV-IS in Louisiana. References: (1) J. E. Polston et al. Plant Dis. 83:984-988, 1999. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288-1293, 1996.

First Report on Natural Occurrence of Tomato Spotted Wilt Tospovirus in Basil (Ocimum basilicum).

Virus-like symptoms were observed on basil plants (Ocimum basilicum L. 'Mrs. Burns Lemon' [MBL]) growing in containers and a demonstration plot at the Louisiana State University Burden Research Plantation, Baton Rouge, during July 1998. Symptoms consisted of ring spots, leaf distortion, and severe mosaic. Mechanical transmission of the suspect virus by sap inoculation from infected MBL to basil cvs. MBL, Aussie Sweet, Cinnamon, Siam Queen, and Sweet Dani was successful. Symptoms were similar to those on infected MBL. Nicotiana benthamiana Domin. reacted with local chlorotic spots followed by severe yellows, necrosis, and death. Electron microscopy of thin sections of infected basil revealed virus inclusions but no virus particles. However, infected N. benthamiana revealed the presence of 82-nm membrane-bound particles in the cytoplasm. The virus was identified from basil and N. benthamiana as the common strain of tomato spotted wilt tospovirus (TSWV) by enzyme-linked immunosorbent assay (Agdia, Elkhart, IN). An outbreak of thrips insects during the summer drought in 1998 was probably responsible for the occurrence of TSWV in basil. This is the first report of the occurrence of TSWV in basil (1). Reference: (1) A. A. Brunt et al., eds. 1996. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Published online by Australian National University, Canberra.

First Report of Sweet potato chlorotic stunt virus and Sweet potato feathery mottle virus Infecting Sweet Potato in Spain.

Sweet potato chlorotic stunt virus (SPCSV), family Closteroviridae and Sweet potato feathery mottle virus (SPFMV), family Potyviridae are whitefly and aphid transmitted, respectively, which in double infections cause sweet potato virus disease (SPVD) that is a serious sweet potato (Ipomoea batatas Lam.) disease in Africa (2). During the past decade, sweet potato plants showing symptoms similar to SPVD have been observed in most areas of Spain. Nevertheless, not much information is available about the identity of the viruses infecting this crop in Spain. During the summer of 2002, sweet potato plants with foliar mosaic, stunting, leaf malformation, chlorosis, and ringspot symptoms were observed in several farms in Málaga (southern Spain) and Tenerife and Lanzarote (Canary Islands, Spain). Vine cuttings were collected from 21 symptomatic plants in Málaga and from eight plants on Lanzarote and six on Tenerife. Scions were grafted to the indicator hosts, Brazilian morning glory (I. setosa) and I. nil cv. Scarlett O'Hara. Three weeks after graft inoculations, all plants showed various degrees of mosaic, chlorosis, leaf malformation, and stunting. Four field collections (two from Málaga, one from Tenerife, and one from Lanzarote) with severe symptoms on I. setosa were selected for whitefly (Bemisia tabaci biotype Q) transmission experiments. Acquisition and transmission periods were 48 h. I. setosa was the acquisition host, and I. nil was the transmission host. For each isolate, groups of 10 whiteflies per I. nil plant were used. All I. nil plants used as transmission hosts with the four, field collections showed chlorosis and leaf malformation. Reverse-transcription polymerase chain reaction (RT-PCR) was performed on I. setosa (grafted with the four selected field collections) and I. nil plants (from the whitefly transmission experiments) with primers for the HSP70h gene of SPCSV. A 450-bp DNA fragment was obtained with all I. setosa and I. nil samples. Sequencing of the 450-bp DNA from two samples from Málaga yielded a nucleotide sequence with 98 to 99% similarity to the HSP70h gene of West African SPCSV isolates. Foliar samples from I. setosa, originally grafted with the 21 vine cuttings, were used for nitrocellulose membrane enzyme-linked immunosorbent assay (NCM-ELISA) testing with antiserum specific to SPFMV-RC (provided by J. Moyer, North Carolina State University, Raleigh). Positive control was sap extract from I. setosa that was infected with the common strain of SPFMV. Procedures for NCM-ELISA were as described (4). NCM-ELISA testing suggested that SPFMV was present in all samples. RT-PCR was conducted with degenerate primers POT1/POT2 (1). The nucleotide sequence that was amplified by these two primers spans part of the NIb protein and part of the coat protein gene of potyviruses. All samples yielded the expected 1.3-kb DNA. Sequencing of the RT-PCR products of two isolates from Malaga and sequence comparisons yielded nucleotide sequences with 97% similarity to two East African isolates (Nam 1 and Nam 3) of SPFMV (3). These results confirm the presence of SPCSV and SPFMV in sweet potato in Spain. References: (1) D. Colinet and J. Kummert. J. Virol. Methods 45:149, 1993. (2) R. W. Gibson et al. Plant Pathol. 47:95, 1998. (3) J. F. Kreuze et al. Arch. Virol. 145:567, 2000. (4) E. R. Souto et al. Plant Dis. 87:1226, 2003.

Properties of Strains of Sweet potato feathery mottle virus and Two Newly Recognized Potyviruses Infecting Sweet Potato in the United States.

Some biological and molecular properties of six potyvirus isolates (LSU-1, -2, -3, and -5; 95-2; and 95-6) from sweet potato (Ipomoea batatas) were evaluated. Isolates LSU-1 and -3 and 95-2 were transmitted by Aphis gossypii and Myzus persicae while LSU-2 and -5 were not transmitted by either aphid. The partial nucleotide sequence of the nuclear inclusion b (NIb) and the coat protein (CP) genes of these six isolates were compared with the corresponding sequences of 17 Sweet potato feathery mottle virus (SPFMV) strains and 18 other potyviruses. LSU-1 and -3 had high sequence similarity to the published sequences for Sweet potato virus G (SPVG), did not react with antisera to other known sweet potato viruses, and caused distinct symptoms. We propose to designate these two isolates as SPVG. This report documents the occurrence of this virus in the United States and provides the first characterization of its biological properties. LSU-2 and -5 were distinct in symptomatology; partial Nib, CP nucleotide, and derived amino acid sequence; and serology to other viruses. We propose to call this virus (LSU isolates 2 and 5) Ipomoea vein mosaic virus. The present study revealed a high degree of sequence similarity between 95-6 and the common strain of SPFMV, and between 95-2 and the russet crack strain of SPFMV. Results from this study suggest not only that at least two strains of SPFMV occur in the United States, but that two other potyviruses also are present.

Detection of a Geminivirus Infecting Sweet Potato in the United States.

In 1994, a sweet potato sample showing leaf curl symptoms was collected from the field in Louisiana. When graft-inoculated, Ipomoea nil cv. Scarlett O'Hara reacted with severe leaf distortion and chlorosis symptoms. I. aquatica reacted with a bright yellow mottle. The virus isolated was designated the United States isolate of sweet potato leaf curl virus (SPLCV-US). It was transmitted to I. nil by the sweet potato whitefly, Bemisia tabaci biotype B. DNA probes prepared with component A of pepper Huasteco geminivirus, with an isolate of bean golden mosaic geminivirus from Guatemala, with an isolate of tomato mottle geminivirus from Florida, and with an isolate of tomato yellow leaf curl geminivirus from the Dominican Republic (TYLCV-DR) hybridized with a 2.6-kb DNA band present in DNA extracts from plants infected with SPLCV-US. Probes prepared with the B component of these geminiviruses did not hybridize with these DNA extracts. We were unable to amplify SPLCV-US DNA products by polymerase chain reaction (PCR) in quantities that could be visualized by ethidium bromide staining. However, Southern blots from amplifications with primers AV494/AC1048 revealed PCR products of approximately 600 bp and 550 bp when hybridized with the TYLCV-DR probe. These results were consistently obtained from infected I. cordatotriloba and less consistently from I. aquatica or I. setosa. Fibrillar inclusions were occasionally seen, and granular aggregates of viruslike particles were observed in the nucleus of infected I. cordatotriloba. These results suggest that the virus isolated from sweet potato with leaf curl symptoms belongs to the geminivirus group.

Basal and stress-induced corticosterone levels in olive ridley sea turtles (Lepidochelys olivacea) in relation to their mass nesting behavior.

Adrenocortical responsiveness to turning stress was examined in wild, reproductively-active olive ridley sea turtles (Lepidochelys olivacea) in relation to their mass nesting (arribada) behavior. We hypothesized that the high sensitivity threshold (HST) observed in ovipositing sea turtles is associated with a diminished sensitivity of the hypothalamo-pituitary-adrenal (HPA) axis to stressful stimuli in arribada females. We tested this hypothesis by determining whether arribada females exhibited an increased activation threshold of the HPA axis to an imposed stressor (turning stress). Mean basal corticosterone (B) and glucose levels were below 1.0 ng/ml and 60 mg/dl, respectively. Basal B remained unchanged throughout a 24-hr period in basking females. Most animals responded to turning stress with elevated mean B levels (up to 6.5 ng/ml after 6 hr) and no increase in circulating glucose. Nearly 50% of females (and none of the males) were refractory to the stimulation. Males exhibited the most rapid response, with B levels significantly elevated by 20 min over basal levels. Among females, arribada and solitary nesters exhibited a slower rate of response than basking, non-nesting animals. These results demonstrate that olive ridleys exhibit stress-induced changes in circulating B which are slower than those observed in most reptilian and in mammalian, avian, and piscine species. Furthermore, the presence of refractory females and the relatively slower increase in B in arribada and solitary nesters indicate a hyporesponsiveness of the HPA axis to turning stress in nesting olive ridleys. The hyporesponsiveness may be part of a mechanism to facilitate arribada nesting. J. Exp. Zool. 284:652-662, 1999.