Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 4 de 4
Filtrar
Más filtros

Banco de datos
Tipo del documento
Intervalo de año de publicación
1.
Rhinology ; 62(2): 202-207, 2024 Apr 01.
Artículo en Inglés | MEDLINE | ID: mdl-37999634

RESUMEN

BACKGROUND: Increased blood eosinophil count (BEC) is common in patients under dupilumab treatment for chronic rhinosinusitis with nasal polyps (CRSwNP). This study investigated the prevalence and consequences of hypereosinophilia and to help define patients at risk. METHODS: Real-life, prospective observational cohort study of patients treated with dupilumab for severe CRSwNP. Eligible patients were adult and biological-naive (N=334). All BEC values at baseline and during treatment were reported. Patients with a follow-up of >= 1 year were included to define patients at risk for hypereosinophilia by comparing baseline BEC values (N=218). Furthermore, clinical characteristics and therapeutic consequences for patients with BEC >= 3.0 were noted. RESULTS: Hypereosinophilia developed in a minority of patients, with a peak at week 12 (16.2% with BEC >= 1.5, and 1.7% >= 3.0) in cross-sectional analysis. BEC >= 1.5 developed in 28.9% and BEC >=3.0 in 4.6% of cases with a minimal 1-year follow-up. Baseline BEC was significantly higher for patients developing BEC >= 1.5 and BEC >=3.0, with an optimal cut-off point of 0.96 to predict developing BEC >= 3.0. CONCLUSIONS: Blood eosinophil count (BEC) >= 1.5 is transient and usually abates with no therapeutic interventions and BEC >= 3.0 is rare. Hypereosinophilic syndrome did not occur and switching to a different biological was rarely employed. A baseline BEC of >=1.0 can be a reason for extra caution.


Asunto(s)
Anticuerpos Monoclonales Humanizados , Eosinofilia , Pólipos Nasales , Rinitis , Rinosinusitis , Sinusitis , Adulto , Humanos , Pólipos Nasales/complicaciones , Pólipos Nasales/tratamiento farmacológico , Pólipos Nasales/epidemiología , Estudios Transversales , Estudios Prospectivos , Rinitis/complicaciones , Rinitis/tratamiento farmacológico , Sinusitis/complicaciones , Sinusitis/tratamiento farmacológico , Sinusitis/epidemiología , Enfermedad Crónica
2.
Rhinology ; 62(4): 403-409, 2024 Aug 01.
Artículo en Inglés | MEDLINE | ID: mdl-38775362

RESUMEN

BACKGROUND: There is no known predictor for olfactory function recovery with dupilumab treatment in chronic rhinosinusitis with nasal polyps (CRSwNP). This study assessed whether patient-reported recovery of olfactory function on oral corticosteroids (OCS) is a prognostic factor. METHODS: Retrospective analysis of pre-biological OCS-responsiveness on olfactory functioning (OCS-responsive or OCS-unresponsive; OCS-r and OCR-u, respectively) as predictor for olfactory functioning after 6 months of dupilumab therapy for severe CRSwNP. RESULTS: 212 CRSwNP patients treated with dupilumab were divided between OCS-r (reported improvement of olfactory function with OCS before dupilumab treatment, n = 152), and OCS-u (OCS-unresponsive; no such improvement, n = 60). Olfactory function was tested with Sniffin's Sticks Identification Test (12 pens; SSIT-12). At baseline, both groups had a median SSIT-12 score of 3 / 12 indicating anosmia. Hyposmia and normosmia rates were also comparable (5.9% and 3.3% in OCS-r, respectively; 5.0% and 1.7% in OCS-u, respectively). After 6 months of dupilumab treatment, OCS-r showed higher olfactory scores (median SSIT-12: 8/12; 52.6% hyposmia and 17.8% normosmia) than OCS-u (median SSIT-12: 5/12; 31.7% hyposmia and 3.3% normosmia). The positive predictive value of OCS-responsiveness on scoring <7 (normosmia/hyposmia) on the SSIT-12 after 6 months of dupilumab treatment was 70.4%. Conversely, the negative predictive value of OCS-unresponsiveness on scoring <7 (anosmia) on the SSIT-12 after 6 months of dupilumab treatment was 65.0%. CONCLUSION: Patients who report olfactory function improvement on OCS have a higher chance of recovery of olfactory function during the first six months of treatment with dupilumab than patients who do not.


Asunto(s)
Anticuerpos Monoclonales Humanizados , Pólipos Nasales , Rinitis , Sinusitis , Humanos , Anticuerpos Monoclonales Humanizados/uso terapéutico , Estudios Retrospectivos , Sinusitis/tratamiento farmacológico , Pólipos Nasales/tratamiento farmacológico , Pólipos Nasales/complicaciones , Masculino , Femenino , Persona de Mediana Edad , Rinitis/tratamiento farmacológico , Enfermedad Crónica , Recuperación de la Función , Adulto , Olfato/efectos de los fármacos , Corticoesteroides/uso terapéutico , Trastornos del Olfato/tratamiento farmacológico , Resultado del Tratamiento
3.
Science ; 246(4934): 1158-61, 1989 Dec 01.
Artículo en Inglés | MEDLINE | ID: mdl-2588000

RESUMEN

The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.


Asunto(s)
Calcitriol/farmacología , ADN/genética , Expresión Génica/efectos de los fármacos , Glucocorticoides/farmacología , Osteocalcina/genética , Regiones Promotoras Genéticas/genética , Animales , Secuencia de Bases , Cloranfenicol O-Acetiltransferasa/genética , Dexametasona/farmacología , Humanos , Datos de Secuencia Molecular , Ratas , Mapeo Restrictivo , Homología de Secuencia de Ácido Nucleico , Transfección , Células Tumorales Cultivadas
4.
Biochem Biophys Res Commun ; 152(2): 825-9, 1988 Apr 29.
Artículo en Inglés | MEDLINE | ID: mdl-3365253

RESUMEN

The kinetics of activation of protein kinase C by oleic acid have been reinvestigated, using highly purified preparations of the rat brain and bovine spleen enzymes. Activation of both enzymes by oleic acid is enhanced dramatically by diolein, contrary to previous reports. In the presence of 9.7 microM diolein, the concentrations of oleic acid required for half-maximal activation are 5 microM and 9 microM for the rat brain and bovine spleen enzymes respectively, indicating that the system is much more sensitive to activation by fatty acids than previously recognized. Both enzymes also exhibit a pronounced lag in the activation at low concentrations of oleic acid. The kinetics of activation are very similar to those reported by Hannun et al. (J. Biol. Chem 260, 10039-10043), who characterized the activation of the rat brain enzyme by mixed micelles containing Triton X-100, phosphatidylserine and diolein.


Asunto(s)
Diglicéridos/farmacología , Glicéridos/farmacología , Ácidos Oléicos/farmacología , Proteína Quinasa C/metabolismo , Animales , Encéfalo/enzimología , Bovinos , Sinergismo Farmacológico , Activación Enzimática/efectos de los fármacos , Ácido Oléico , Ratas , Bazo/enzimología
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA