Fractional averaging theory for discrete fractional-order system with impulses.

In this paper, we improve the averaging theory on both finite and infinite time intervals for discrete fractional-order systems with impulses. By employing new techniques, generalized impulsive discrete fractional-order Gronwall inequality is introduced. In addition, the closeness of solutions for the discrete fractional-order systems with impulses and the averaged discrete fractional-order systems with impulses is derived. Finally, three examples are provided to illustrate the efficiency of our main results.

Detection of functional networks within white matter using independent component analysis.

Spontaneous fluctuations in MRI signals from gray matter (GM) in the brain are interpreted as originating from variations in neural activity, and their inter-regional correlations may be analyzed to reveal functional connectivity. However, most studies of intrinsic neuronal activity have ignored the spontaneous fluctuations that also arise in white matter (WM). In this work, we explore spontaneous fluctuations in resting state MRI signals in WM based on spatial independent component analyses (ICA), a data-driven approach that separates signals into independent sources without making specific modeling assumptions. ICA has become widely accepted as a valuable approach for identifying functional connectivity within cortex but has been rarely applied to derive equivalent structures within WM. Here, BOLD signal changes in WM of a group of subjects performing motor tasks were first detected using ICA, and a spatial component whose time course was consistent with the task was found, demonstrating the analysis is sensitive to evoked BOLD signals in WM. Secondly, multiple spatial components were derived by applying ICA to identify those voxels in WM whose MRI signals showed similar temporal behaviors in a resting state. These functionally-related structures are grossly symmetric and coincide with corresponding tracts identified from diffusion MRI. Finally, functional connectivity was quantified by calculating correlations between pairs of structures to explore the synchronicity of resting state BOLD signals across WM regions, and the experimental results revealed that there exist two distinct groupings of functional correlations in WM tracts at rest. Our study provides further insights into the nature of activation patterns, functional responses and connectivity in WM, and support previous suggestions that BOLD signals in WM show similarities with cortical activations and are characterized by distinct underlying structures in tasks and at rest.

Voxel-wise detection of functional networks in white matter.

Functional magnetic resonance imaging (fMRI) depicts neural activity in the brain indirectly by measuring blood oxygenation level dependent (BOLD) signals. The majority of fMRI studies have focused on detecting cortical activity in gray matter (GM), but whether functional BOLD signal changes also arise in white matter (WM), and whether neural activities trigger hemodynamic changes in WM similarly to GM, remain controversial, particularly in light of the much lower vascular density in WM. However, BOLD effects in WM are readily detected under hypercapnic challenges, and the number of reports supporting reliable detections of stimulus-induced activations in WM continues to grow. Rather than assume a particular hemodynamic response function, we used a voxel-by-voxel analysis of frequency spectra in WM to detect WM activations under visual stimulation, whose locations were validated with fiber tractography using diffusion tensor imaging (DTI). We demonstrate that specific WM regions are robustly activated in response to visual stimulation, and that regional distributions of WM activation are consistent with fiber pathways reconstructed using DTI. We further examined the variation in the concordance between WM activation and fiber density in groups of different sample sizes, and compared the signal profiles of BOLD time series between resting state and visual stimulation conditions in activated GM as well as activated and non-activated WM regions. Our findings confirm that BOLD signal variations in WM are modulated by neural activity and are detectable with conventional fMRI using appropriate methods, thus offering the potential of expanding functional connectivity measurements throughout the brain.

Exome-wide association study identifies four novel loci for systemic lupus erythematosus in Han Chinese population.

OBJECTIVES: Systemic lupus erythematosus (SLE) is a chronic autoimmune disease of considerable genetic predisposition. Genome-wide association studies have identified tens of common variants for SLE. However, the majority of them reside in non-coding sequences. The contributions of coding variants have not yet been systematically evaluated. METHODS: We performed a large-scale exome-wide study in 5004 SLE cases and 8179 healthy controls in a Han Chinese population using a custom exome array, and then genotyped 32 variants with suggestive evidence in an independent cohort of 13 246 samples. We further explored the regulatory effect of one novel non-coding single nucleotide polymorphism (SNP) in ex vivo experiments. RESULTS: We discovered four novel SLE gene regions (LCT, TPCN2, AHNAK2 and TNFRSF13B) encompassing three novel missense variants (XP_016859577.1:p.Asn1639Ser, XP_016859577.1:p.Val219Phe and XP_005267356.1:p.Thr4664Ala) and two non-coding variants (rs10750836 and rs4792801) with genome-wide significance (pmeta <5.00×10-8). These variants are enriched in several chromatin states of primary B cells. The novel intergenic variant rs10750836 exhibited an expression quantitative trait locus effect on the TPCN2 gene in immune cells. Clones containing this novel SNP exhibited gene promoter activity for TPCN2 (P=1.38×10-3) whose expression level was reduced significantly in patients with SLE (P<2.53×10-2) and was suggested to be further modulated by rs10750836 in CD19+ B cells (P=7.57×10-5) in ex vivo experiments. CONCLUSIONS: This study identified three novel coding variants and four new susceptibility gene regions for SLE. The results provide insights into the biological mechanism of SLE.

Practical stability in terms of two measures for set differential equations on time scales.

We present a new comparison principle by introducing a notion of upper quasi-monotone nondecreasing and obtain the practical stability criteria for set valued differential equations in terms of two measures on time scales by using the vector Lyapunov function together with the new comparison principle.

Exome sequencing identified a missense mutation of EPS8L3 in Marie Unna hereditary hypotrichosis.

BACKGROUND: Marie Unna hereditary hypotrichosis (MUHH) is an autosomal dominant disorder characterised by coarse, wiry, twisted hair developed in early childhood and subsequent progressive hair loss. MUHH is a genetically heterogeneous disorder. No gene in 1p21.1-1q21.3 region responsible for MUHH has been identified. METHODS: Exome sequencing was performed on two affected subjects, who had normal vertex hair and modest alopecia, and one unaffected individual from a four-generation MUHH family of which our previous linkage study mapped the MUHH locus on chromosome 1p21.1-1q21.3. RESULTS: We identified a missense mutation in EPS8L3 (NM_024526.3: exon2: c.22G->A:p.Ala8Thr) within 1p21.1-1q21.3. Sanger sequencing confirmed the cosegregation of this mutation with the disease phenotype in the family by demonstrating the presence of the heterozygous mutation in all the eight affected and absence in all the seven unaffected individuals. This mutation was found to be absent in 676 unrelated healthy controls and 781 patients of other disease from another unpublished project of our group. CONCLUSIONS: Taken together, our results suggest that EPS8L3 is a causative gene for MUHH, which was helpful for advancing us on understanding of the pathogenesis of MUHH. Our study also has further demonstrated the effectiveness of combining exome sequencing with linkage information for identifying Mendelian disease genes.

An intronic splice-site variant in MBTPS2 underlies ichthyosis follicularis with atrichia and photophobia syndrome.

Ichthyosis follicularis with atrichia and photophobia (IFAP) syndrome is a rare genodermatosis characterized by a classic triad of follicular ichthyosis, alopecia, and photophobia. We report a Chinese patient displaying features of IFAP triad along with painful palmoplantar keratoderma, recurrent infections, periorificial keratotic plaques, nail dystrophy, and pachyonychia. Whole-exome sequencing revealed an intronic variant (NM_015884.3: exon7:c.970+5G>A) in the gene MBTPS2. Sanger sequencing confirmed that the variant segerated with phenotype in the family. Sequencing of cDNAs derived from the patient indicated the variant introduced a new splice donor site, leading to partial skipping of exon 7 (r.951_970del). An in vitro mini-gene assay also revealed abnormal splicing of exon 7. This study presents a case complicated with X-linked IFAP syndrome and Olmsted syndrome, and highlights the significance of using validation assays to identify the pathogenicity of intronic variants in MBTPS2.

A single nucleotide polymorphism rs9468925 of MHC region is associated with clinical features of generalized vitiligo in Chinese Han population.

BACKGROUND: Vitiligo has been found to be associated with different HLA antigens in different ethnic groups. In our previous genome-wide association study (GWAS), we identified independent association signal of rs9468925 (P = 2.21 × 10(-33), OR = 0.74) within HLA-C-HLA-B region. OBJECTIVES: To explore the association between rs9468925 polymorphism within MHC and the clinical features of generalized vitiligo. METHODS: The study, using 5566 cases and 6462 controls from previous GWA study investigated the single and combined (GA + GG) genotypic distribution of rs9468925 in subsets of vitiligo patients having different clinical features. We performed a QTL analysis (quantitative trait locus) for age of onset with genotype of rs9468925. RESULTS: The GA + GG genotypic distribution of SNP rs9468925 tested with an additive model was found to be significantly different in subgroups of patients of >20 vs. <20 years old (genotypic P = 2.57 × 10(-4), combined P = 3.0 × 10(-3), OR = 0.77, 95% CI: 0.64-0.92), and in patients with different clinical subtypes of vitiligo (genotypic P = 0.03, combined P = 5.0 × 10(-3)). However, there was no statistical significance for familial history, halo nevi involvement and autoimmune disease involvement. CONCLUSIONS: Allele G of rs9468925 on HLA-C-HLA-B may be associated with a higher risk of vitiligo. Our study showed a significant genotypic variation between patients with age of onset ≤ 20 years and age of onset >20 years. Obvious clinical differences of generalized vitiligo related to genotypic variation found in the Chinese Han population were confirmed in this study.

Corrigendum: Case report: Challenges in the diagnosis of a case of Mal de Meleda and a therapeutic attempt of ixekizumab and Adalimumab.

[This corrects the article DOI: 10.3389/fmed.2022.821301.].

A novel mutation in SPINK5 gene underlies a case of atypical Netherton syndrome.

Netherton syndrome (NS, OMIM #256500) is a rare autosomal recessive disease characterized by a triad of congenital ichthyosiform erythroderma (CIE) or ichthyosis linearis circumflexa (ILC), trichorrhexis invaginata (TI), and atopic predisposition. The disease is caused by a mutation in the SPINK5 gene (serine protease inhibitor of Kazal type 5) encoding LEKTI (lymphoepithelial Kazal type-related inhibitor). We performed whole-exome sequencing on one Chinese NS family and made genotype-phenotype correlation analysis on the patients clinically diagnosed with NS or congenital ichthyosis erythroderma. We identified a novel frameshift mutation c.2474_2475del (p.Glu825Glyfs*2) in the SPINK5 gene. The N-terminal mutations of LEKTI cause a severer phenotype, while the C-terminal mutations of LEKT1 are related to a milder phenotype. Our findings suggest that Netherton syndrome may be underestimated clinically, and our findings further expand the reservoir of SPINK5 mutations in Netherton syndrome.

Case Report: Challenges in the Diagnosis of a Case of Mal de Meleda and a Therapeutic Attempt of Ixekizumab and Adalimumab.

Background: Mal de Meleda (MDM, OMIM 248300) is an autosomal recessive disease characterized by symmetrical and progressive palmoplantar hyperkeratosis soon after birth. Mutations in SLURP1 gene could lead to MDM. Clinically, MDM is easily misdiagnosed as other types of keratoderma due to phenotypic variation and overlap. Objective and Methods: A patient with suspected MDM was confirmed by the combination of next-generation sequencing and Exomiser, and the patient was attempted with the treatment of Ixekizumab and Adalimumab. Results: A homozygous mutation c.256G>A (p.Gly86Arg) in the SLURP1 gene was identified in the patient. The inflammatory erythemas on his hands, feet and buttocks were mildly relieved after the treatment of high dose of Ixekizumab. Conclusions: Our findings helps to enhance the understanding of MDM. Ixekizumab may be a potential strategy to treat MDM.

Case Report: Chanarin-Dorfman Syndrome: A Novel Homozygous Mutation in ABHD5 Gene in a Chinese Case and Genotype-Phenotype Correlation Analysis.

The Chanarin-Dorfman syndrome (CDS) is a rare, autosomal recessively inherited genetic disease, whch is associated with a decrease in the lipolysis activity in multiple tissue cells. The clinical phenotype involves multiple organs and systems, including liver, eyes, ears, skeletal muscle and central nervous system. Mutations in ABHD5/CGI58 gene have been confirmed to be associated with CDS. We performed whole exome sequencing on a Chinese CDS patient with skin ichthyosis features mimicking lamellar ichthyosis, ectropion, sensorineural hearing loss, and lipid storage in peripheral blood neutrophils. A novel homozygous missense mutation (p.L154R) in ABHD5 gene was detected in this patient. Genotype-phenotype analysis in reported CDS patients revealed no particular correlation. Our findings further enrich the reservoir of ABHD5 mutations in CDS.

Down-regulated expression of IKZF1 mRNA in peripheral blood mononuclear cells from patients with systemic lupus erythematosus.

Systemic lupus erythematosus (SLE) is a multi-system autoimmune disease with complex genetic inheritance. IKZF1 was established as a new susceptibility gene for SLE in a recent genome-wide association study (GWAS) in Chinese Han population. In order to examine whether expression levels of IKZF1 contribute to the pathogenesis of SLE, we estimated IKZF1 mRNA expression levels in peripheral blood mononuclear cells (PBMCs) via fluorescent quantitative reverse transcription polymerase chain reaction (RT-PCR) in 60 patients with SLE and 60 controls. We also explored whether the IKZF1 mRNA expression levels are associated with the variant of the SNP rs4917014 and the SLE Disease Activity Index (SLEDAI). The expression levels of IKZF1 mRNA in patients with SLE were significantly decreased compared with those in healthy controls (P<0.001). No significant differences were found between IKZF1 mRNA expression levels and SLEDAI scores, SNP rs4917014. Our results suggest that decreased expression of IKZF1 mRNA may be correlated with the pathogenesis of SLE.

Case Report: A Case of Hailey-Hailey Disease Mimicking Condyloma Acuminatum and a Novel Splice-Site Mutation of ATP2C1 Gene.

Hailey-Hailey disease (HHD) is a rare autosomal-dominant blistering disorder characterized by recurrent vesicular and erosive lesions at intertriginous sites. We described a 24-year-old male who presented with multiple bright red verrucous papules in his mons pubis, bilateral groins, scrotum, perineum, and crissum, clinically resembling condyloma acuminatum. The histopathology showed extensive acantholysis with the characteristic appearance of a dilapidated brick-wall. The mutation analysis revealed a novel splice-site mutation in the ATP2C1 gene. The patient was definitely diagnosed with HHD. The antibacterial treatments resulted in a dramatic improvement. Our findings help to broaden the understanding of clinical manifestations of HHD and improve the clinical diagnosis and treatment of this disease.

Food and feed trade has greatly impacted global land and nitrogen use efficiencies over 1961-2017.

International trade of agricultural products has complicated and far-reaching impacts on land and nitrogen use efficiencies. We analysed the productivity of cropland and livestock and associated use of feed and fertilizer efficiency for over 240 countries, and estimated these countries' cumulative contributions to imports and exports of 190 agricultural products for the period 1961-2017. Crop trade has increased global land and partial fertilizer nitrogen productivities in terms of protein production, which equalled savings of 2,270 Mha cropland and 480 Tg synthetic fertilizer nitrogen over the analysed period. However, crop trade decreased global cropland productivity when productivity is expressed on an energy (per calorie) basis. Agricultural trade has generally moved towards optimality, that is, has increased global land and nitrogen use efficiencies during 1961-2017, but remains at a relatively low level. Overall, mixed impacts of trade on resource use indicate the need to rethink trade patterns and improve their optimality.

Identification of a Novel Mutation in SASH1 Gene in a Chinese Family With Dyschromatosis Universalis Hereditaria and Genotype-Phenotype Correlation Analysis.

Dyschromatosis universalis hereditaria (DUH) is a rare genodermatosis characterized by mottled hyperpigmented and hypopigmented macules. SASH1 and ABCB6 have been identified as the causative genes for this disorder. We performed whole exome sequencing on a Chinese family with DUH and genotype-phenotype correlation analysis in DUH and lentiginous phenotype patients. A novel heterozygous missense mutation p.Q518P in SASH1 gene was detected in this family. A majority of patients with SASH1 mutations presented as a distinct clinical phenotype clearly different from that in patients with ABCB6 mutations. Our findings further enrich the reservoir of SASH1 mutations in DUH. The clinical phenotypic difference between SASH1 and ABCB6 variants is suggestive of a close phenotype-genotype link in DUH.

Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype-Phenotype: A Correlation Analysis.

BACKGROUND: This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients. METHODS: Whole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ 2- and Fisher's tests were used to analyze the genotype-phenotype correlations. RESULTS: (1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype-phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021). CONCLUSIONS: This study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling.

Annular epidermolytic ichthyosis with palmoplantar keratosis: a unique phenotype associated with interfamilial phenotypic heterogeneity.

BACKGROUND: Annular epidermolytic ichthyosis (AEI) is a rare autosomal dominant ichthyosis that was recently described in 10 separate families in the English literature. There are no reports on the phenotypic heterogeneity of AEI. OBJECTIVES: We investigated, for the first time, a large Chinese AEI pedigree exhibiting interfamilial phenotypic heterogeneity. MATERIALS AND METHODS: We collected clinical data and DNA from the members of the family, and skin lesions were obtained from two patients with different phenotypes. Skin imaging examinations were performed. Whole-exome sequencing (WES) and Sanger sequencing were used to detect gene mutations. RESULTS: The characteristic features of granular layer degeneration in the two biopsies were verified via histological methods. The missense mutation c.1436T > C in KRT1 was detected in all nine patients. CONCLUSION: This study demonstrates that AEI may present with different clinical phenotypes and that mutation analysis for suspected cases is necessary to obtain a precise diagnosis.

Subsets of T lymphocytes in the lesional skin of pityriasis rosea.

BACKGROUND: Pityriasis rosea is a common papulosquamous disorder. However, its etiology and pathogenesis remain unclear. OBJECTIVE: We investigate the types of inflammatory cells infiltrating the lesional skin of pityriasis rosea and demonstrate whether T-cell-mediated immunity is involved in the pathogenesis of this condition or not. METHODS: The biopsies were taken from the lesional skin of 35 cases of patients diagnosed with pityriasis rosea. The specimens were prepared in paraffin sections, then submitted to routine immunohistochemistry procedures using monoclonal antibodies directed against CD3, CD4, CD8, CD20 and CD45RO and horseradish peroxidase-labeled goat anti-human antibodies. The positive sections were determined by the ratio and staining intensity of positive inflammatory cells. RESULTS: The mean score of positive CD3, CD4, CD8, and CD45RO staining was respectively 3.74±3.88, 5.67±4.40, 2.94±3.42 and 7.68±4.33 in these pityriasis rosea patients (P<0.001). The percentage of positive staining was 54.29% (19/35), 69.7% (23/33), 40% (14/35) and 79.41% (27/34) (P<0.05). However, the staining of CD20 was negative in all samples. The mean score of CD3 staining in patients with time for remission ≤60 days (4.90±4.21) was higher than that in patients with time for remission >60 days (2.00±2.5) (P<0.05), whereas no statistical difference in the mean score of CD4, CD8 and CD45RO staining was observed. study liMitations: The sample size and the selected monoclonal antibody are limited, so the results reflect only part of the cellular immunity in the pathogenesis of pityriasis rosea. CONCLUSION: Our findings support a predominantly T-cell mediated immunity in the development of pityriasis rosea.

Association of HLA-DQA1 and DQB1 alleles with keloids in Chinese Hans.

BACKGROUND: Some studies have suggested that human HLA status might potentiate development of keloids phenotype, and exists ethnic differences. No report has been published about HLA-DQA1 and DQB1 alleles associated with keloids in Chinese Hans. OBJECTIVES: To investigate whether HLA-DQA1 and DQB1 alleles are associated with genetic susceptibility to keloids in Chinese Hans. METHODS: Polymerase chain reaction-sequence-specific primer (PCR-SSP) method was used to analyze the distribution of HLA-DQA1 and DQB1 alleles among 192 patients with keloids and 273 healthy controls in Chinese Hans. RESULTS: (1) The frequencies of HLA-DQA1*0104, DQB1*0501 and DQB1*0503 (OR = 2.13, P(c) = 0.0063; OR = 14.42, P(c) < 10(-7) and OR = 6.09, P(c) < 10(-7), respectively) were significantly higher, while the frequencies of DQA1*0501, DQB1*0201 and DQB1*0402 (OR = 0.46, P(c) = 0.0099; OR = 0.24, P(c) < 10(-4) and OR = 0.10, P(c)=0.0054, respectively) were lower in patients than in controls. (2) In this study significant susceptibility haplotypes to keloids were DQA1*0104-DQB1*0501 and DQA1*0104-DQB1*0503. (3) HLA-DQB1*0501 and DQB1*0503 were positively associated with all subgroups of keloid patients. However, the DQA1*0104 (OR = 2.51, P(c) = 0.0009; OR = 2.22, P(c) = 0.0090 and OR = 2.20, P(c) = 0.0117, respectively) was only prevalent in keloid patients with single site, moderate severity and negative family history. (4) HLA-DQB1*0201 (OR = 0.27, P(c) = 0.0018 and OR = 0.27, P(c) = 0.0012, respectively) and DQB1*0402 (OR = 0.07, P(c) = 0.0270 and OR = 0.07, P(c) = 0.0306, respectively) were negatively associated with moderate severity and negative family history in keloids, moreover, HLA-DQB1*0201 (OR = 0.23, P(c) = 0.0003) and DQA1*0501 (OR = 0.43, P(c) = 0.0234) were less prevalent in patients with single site. CONCLUSION: This study demonstrated the positive association of HLA-DQA1 and DQB1 alleles and haplotypes with keloids.