[Susceptible mechanisms of pulmonary mucormycosis in diabetic patients].

Pulmonary mucormycosis is a rare pulmonary fungal infectious disease. Domestic and international studies have shown that diabetes is the most common underlying condition of this disease, especially with poor glycemic control and diabetic ketoacidosis. The susceptible mechanisms of pulmonary mucormycosis in diabetic patients are closely related to hyperglycemia and diabetic ketoacidosis-induced internal environment alterations. The detailed pathogenesis includes respiratory epithelial cell damage, vascular endothelial injury, immune cell dysfunction, coagulation abnormalities, iron-rich, and high keto-acid environment in diabetic patients. Pulmonary mucormycosis always presents atypical manifestations with rapid progress and poor prognosis in patients with diabetes. This article reviews the recent research progress in the susceptible mechanisms of pulmonary mucormycosis in patients with diabetes.

[The expression and clinical significance of Bmi-1 gene in oral leukoplakia with different prognosis].

Objective: To detect the expression of Bmi-1 in oral leukoplakia (OL) cells and tissues, and analyze its role and clinical significance in the malignant transformation of OL. Methods: Immunohistochemistry was used to evaluate Bmi-1 expression in OL samples from 109 patients (51 males, 58 females, age range: 18-74 years) who were treated in the Department of Stomatology, the Affiliated Wuxi People's Hospital of Nanjing Medical University and the Center of Stomatology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, between 1996 and 2018. The correlation between Bmi-1 expression level and clinicopathological parameters and prognosis in patients with OL was analyzed. The mRNA and protein expression levels of Bmi-1 gene in normal oral mucosal epithelial cells, OL cells, oral squamous cell carcinoma (OSCC) cells, OL tissues and paired adjacent normal tissues were detected by real-time PCR and Western blotting. The effects of Bmi-1 on the proliferation, colony formation and apoptosis were investigated by silencing expression of Bmi-1 in OL cell lines Leuk-1. Results: The protein level of Bmi-1 in OL tissue with severe and mild dysplasia was statistically different (6 819±994 vs 4 713±372, P=0.017). The OSCC-free survival rate of OL patients with high Bmi-1 expression was 65.5% (36/55), which was lower than that of OL patients with low Bmi-1 expression (88.9%, 48/54, P=0.003). Multivariate Cox proportional analysis indicated that Bmi-1 expression was the independent predictor for malignant transformation of OL (HR=2.522, 95%CI: 1.128-5.640, P=0.024). The mRNA level of Bmi-1 in OL specimens was 0.455±0.120, which was higher than that in paired adjacent normal tissues (0.063±0.009, P=0.014). The Bmi-1 mRNA level in malignant transformed OL specimens was (1.405±0.397), which was higher than that in untransformed OL specimens (0.145±0.017, P<0.001). After transfection of Bmi-1-shNC and Bmi-1-shRNA2 adenovirus into OL cell line Leuk-1, there were significant differences in the number of clone formation (824±40 vs 414±38, P=0.002) and apoptosis rate (17.7%±2.3% vs 36.0%±2.0%, P=0.004). Conclusions: The up-regulation of Bmi-1 expression promotes the malignant biological behavior of OL cells. Bmi-1 expression can be used as a predictor for malignant transformation of OL.

Role of sonoelastography in assessment of axillary lymph nodes in breast cancer: a systematic review and meta-analysis.

AIM: To evaluate the effectiveness of shear-wave elastography (SWE) and strain elastography (SE) for axillary lymph nodes (ALNs). MATERIALS AND METHODS: PubMed, Embase, and Cochrane Library databases were searched until September 2018. Weighted mean difference was calculated for continuous variables. The accuracy of sonoelastography was assessed by calculating pooled sensitivity, specificity, area under the curve (AUC), positive likelihood ratio (PLR), negative likelihood ratio (NLR), and diagnostic odds ratio (DOR). All data were analysed using Stata 12.0. RESULTS: Ten studies with 1,038 ALNs were included in the meta-analysis. Five studies evaluated the use of SE, and the other five evaluated the SWE. The SWE stiffness values of malignant ALNs were significantly higher than those of benign nodes. Both SE and SWE have relatively high specificity and sensitivity. The max stiffness in SWE showed the highest specificity (0.94; 95% confidence interval [CI], 0.81-0.98), PLR (12.1; 95% CI, 4-36.5), NLR (0.29; 95% CI, 0.12-0.69), AUC (0.94; 95% CI, 0.91-0.96), and DOR (42; 95% CI, 12-154); in contrast, the mean stiffness showed the highest sensitivity (0.80; 95% CI, 0.61-0.91). CONCLUSION: Sonoelastography demonstrated high sensitivity and specificity for differentiating between malignant and benign ALNs. The max and mean stiffness on SWE appeared to exhibit the highest accuracy. Thus, SWE is an effective accompaniment to sentinel node biopsy, and is appropriate for preoperative assessment of ALNs in the post-Z0011 era.

[Effect of artesunate on airway responsiveness and airway inflammation in asthmatic mice].

Objective: To observe the effects of artesunate on airway responsiveness and airway inflammation in asthmatic mice. Methods: Thirty female BALB/c mice aged 6-8 weeks were randomly divided into control group, asthma group and artesunate group. In the asthma group and the artesunate group, the mice were sensitized by intraperitoneal injection of 20 µg of ovalbumin (OVA) and 0.2 ml of aluminum hydroxide suspension (2 mg) on day 0 and 14, respectively, and 1% OVA 10 ml dissolved in sterile phosphate (PBS) buffer was aerosolized for 30 min from the 21st to 28th day. The control group was sensitized with 0.2 ml of 2 mg suspension of aluminum hydroxide on day 0 and 14, and aerosolized by 10 ml of sterile PBS from the 21st to 28th day. Before the challenge, the artesunate group was intraperitoneally injected with 0.2 ml of artesunate. Artesunate was replaced with the same amount of normal saline in the control group and the asthma group. The mice were treated after 24 hours of last stimulation. The airway responsiveness of mice was measured by airway intubation and the changes of airway resistance and compliance were observed. Bronchoalveolar lavage fluid (BALF) was classified by cytology, and pathological changes of left lung tissue were observed and scored. Results: The airway resistance of the three groups increased and the lung compliance decreased with the increase of methacholine (Ach) concentration. The airway resistance and lung compliance of the three groups were different under the same concentration (P<0.05). The airway resistance of the artesunate group at Ach 6.25, 12.5, 25, 50, 100 mg/ml was lower than that of the asthma group at the same concentration [(1.01±0.48) vs (1.30±0.22), (1.06±0.44) vs (1.70±0.31), (1.30±0.64) vs (2.66±0.79), (1.82±0.55) vs (3.38±1.35), (2.49±0.85) vs (4.07±1.34) cmH(2)O·s(-1)·ml(-1)(1 cmH(2)O=0.098 kPa); t=3.862, 7.376, 9.113, 7.051, 6.685, all P<0.05]; the degree of lung compliance decrease at the concentration of Ach 3.125, 6.25, 12.5, 25, 50, 100 mg/ml was lower than that of the asthma group at the same concentration [(3.89±0.55)×10(-2) vs (3.07±0.63)×10(-2), (3.61±0.52)×10(-2) vs (3.04±0.58)×10(-2), (3.48±0.38)×10(-2) vs (2.78±0.57)×10(-2), (3.09±0.52)×10(-2) vs (1.73±0.62)×10(-2), (2.32±0.60)×10(-2) vs (1.29±0.54)×10(-2), (1.87±0.59)×10(-2) vs (1.15±0.44)×10(-2) ml/cmH(2)O; t=-6.295, -4.921, -6.533, -11.135, -8.48, -6.319, all P<0.05]. The proportion of eosinophils in artesunate group in BALF was significantly lower than that in asthma group [(16.63±8.58)% vs (40.44±12.94)%; t=4.336, P<0.05]. In the asthma group, the inflammatory cells infiltration of the bronchi and the perivascular area, the bronchial epithelial edema and degeneration can be observed, and the artesunate could reduce the infiltration of inflammatory cells around the bronchus and blood vessels, and the mucus secretion was also reduced in the artesunate group. Conclusion: Artesunate can improve airway hyperresponsiveness and airway inflammation in asthmatic mice and has a certain therapeutic effect on asthma.

Measurement of acetabular inclination and anteversion via CT generated 3D pelvic model.

BACKGROUND: Inclination and anteversion were the main factors that determined the reliability of the acetabulum. Inclination and anteversion measurements included anatomical, operational and radiographic methods. The aim of our present study was to exhibit divergence of inclination and anteversion via the three measurements. METHODS: Inclination and anteversion were defined according to the definitions put forward by Murray. Three-dimensional models of pelvis of CT data were brought forth. Acetabular axis was determined by the rim of acetabula. Reference planes were established by bone landmarks including anterior superior iliac spine, pubic tubercles and sacral crests. Inclinations and anteversions were calculated according to the definitions. RESULTS: Forty-nine cases were involved in the research. Data of inclination form anatomical, operational and radiographic showed 37.48 ± 11.07, 45.12 ± 14.76 and 48.76 ± 14.36, and anteversion were 18.12 ± 7.59, 24.97 ± 9.68, 14.30 ± 5.64. A substantial deviation was noted in the inclinations (P < 0.01) and anteversions (P < 0.01). CONCLUSION: Our findings suggested that the inclinations and anteversions of the three measurements varied, which might in turn interfere the decision of orthopedists.

Far-reaching geometrical artefacts due to thermal decomposition of polymeric coatings around focused ion beam milled pigment particles.

Focused ion beam and scanning electron microscope (FIB-SEM) instruments are extensively used to characterize nanoscale composition of composite materials, however, their application to analysis of organic corrosion barrier coatings has been limited. The primary concern that arises with use of FIB to mill organic materials is the possibility of severe thermal damage that occurs in close proximity to the ion beam impact. Recent research has shown that such localized artefacts can be mitigated for a number of polymers through cryogenic cooling of the sample as well as low current milling and intelligent ion beam control. Here we report unexpected nonlocalized artefacts that occur during FIB milling of composite organic coatings with pigment particles. Specifically, we show that FIB milling of pigmented polysiloxane coating can lead to formation of multiple microscopic voids within the substrate as far as 5 µm away from the ion beam impact. We use further experimentation and modelling to show that void formation occurs via ion beam heating of the pigment particles that leads to decomposition and vaporization of the surrounding polysiloxane. We also identify FIB milling conditions that mitigate this issue.

[The expression and significance of heparanase in oral squamous cell carcinoma with different metastatic potentials].

Objective: To detect the expression of heparanase (HPSE) in oral squamous cell carcinoma (OSCC) with different metastatic potentials and investigate its clinical significance. Methods: Transcriptional and translational status of HPSE in OSCC cell lines with different metastatic capacities, primary OSCC samples and their paired metastatic cancer tissues were determined using real-time polymerase chain reaction (PCR) and Western blotting analysis. Immunohistochemistry was used to evaluate HPSE expression in 131 OSCC samples. The correlation between HPSE expression pattern and clinicopathological parameters and clinical outcome in patients with OSCC were analyzed. HPSE level was reduced using HPSE-siRNAs in OSCC cell lines and its impact on cell migration and invasion was measured by scratch assay and matrigel invasion assay. Results: The mRNA and protein levels of HPSE were remarkably up-regulated in OSCC cell lines with highly metastatic capacity (P<0.000 1) and metastatic OSCC tissues (P<0.000 1). The protein levels of HPSE were strongly associated with lymph node metastasis (P<0.000 1) and tumor node metastasis stage (P=0.012). Survival analyses revealed that high HPSE expression was associated with worse overall survival (P=0.000 3). Multivariate Cox proportional analyses indicated that HPSE expression was strongly associated with clinical outcome in patients with OSCC (HR=2.203, 95% CI: 1.203-3.988, P=0.009). The siRNA-mediated silencing of HPSE could suppress the migration and invasion (P=0.008) of HN12 cells in vitro. Conclusions: The up-regulation of HPSE contributes to invasion and metastasis of OSCC. HPSE may serve as a useful biomarker for patients with OSCC.

Hepatitis B virus infection is associated with gastric cancer in China: an endemic area of both diseases.

BACKGROUND: Hepatitis B virus (HBV) infection was demonstrated to be a risk factor of several cancers of the digestive system. In addition, liver cirrhosis, which could possibly result from chronic HBV infection, was associated with a higher risk of gastric cancer. However, the association of HBV infection and gastric cancer has not been investigated. METHODS: A retrospective case-control study with 580 cases and 580 controls matched for age, sex and year of diagnosis was conducted. The associations between gastric cancer and HBV infection were explored with univariate and multivariate unconditional logistic regression analysis. RESULTS: Hepatitis B surface antigen (HBsAg) was positively associated with gastric cancer (AOR (95% CI): 1.49 (1.06-2.10)). This association remained significant in patients without family history of gastric cancer (AOR (95% CI): (1.06-2.11)). For HBsAg-negative population, being anti-HBc positive/anti-HBs negative, which possibly indicated occult HBV infection, was also found to have some associations with gastric cancer. In addition, some synergistic effects between HBV infection and blood type A in gastric cancer were identified. CONCLUSIONS: The HBV infection was positively related with gastric cancer, especially for patients without family history of gastric cancer. Further prospective studies are warranted to confirm this relationship.

Molecular testing of 163 patients with Morquio A (Mucopolysaccharidosis IVA) identifies 39 novel GALNS mutations.

Morquio A (Mucopolysaccharidosis IVA; MPS IVA) is an autosomal recessive lysosomal storage disorder caused by partial or total deficiency of the enzyme galactosamine-6-sulfate sulfatase (GALNS; also known as N-acetylgalactosamine-6-sulfate sulfatase) encoded by the GALNS gene. Patients who inherit two mutated GALNS gene alleles have a decreased ability to degrade the glycosaminoglycans (GAGs) keratan sulfate and chondroitin 6-sulfate, thereby causing GAG accumulation within lysosomes and consequently pleiotropic disease. GALNS mutations occur throughout the gene and many mutations are identified only in single patients or families, causing difficulties both in mutation detection and interpretation. In this study, molecular analysis of 163 patients with Morquio A identified 99 unique mutations in the GALNS gene believed to negatively impact GALNS protein function, of which 39 are previously unpublished, together with 26 single-nucleotide polymorphisms. Recommendations for the molecular testing of patients, clear reporting of sequence findings, and interpretation of sequencing data are provided.

Quality of life after surgical resection compared with radiofrequency ablation for small hepatocellular carcinomas.

BACKGROUND: Health-related quality of life (HRQL) is an important outcome measure in studies of cancer therapy. This study aimed to investigate HRQL and survival in patients with small hepatocellular carcinoma (HCC) treated with either surgical resection or percutaneous radiofrequency ablation (RFA). METHODS: Between January 2006 and June 2009, patients with newly diagnosed solitary, small (3 cm or less) HCC were invited to participate in this non-randomized prospective parallel cohort study. The Functional Assessment of Cancer Therapy-Hepatobiliary (FACT-Hep) instrument was used for assessing HRQL. HRQL and survival were compared between the two treatment groups. RESULTS: A total of 389 patients were enrolled. Questionnaires were completed fully by 99.7 per cent of invited participants (388 of 389) at baseline, 98.7 per cent (383 of 388) at 3 months, 99.0 per cent (379 of 383) at 6 months, 98.4 per cent (365 of 371) at 1 year, 96.6 per cent (336 of 348) at 2 years and 95.1 per cent (289 of 304) at 3 years. There were no significant differences in disease-free and overall survival between the two groups. Patients treated with percutaneous RFA had significantly better HRQL total scores after 3, 6, 12, 24 and 36 months than those who had surgical resection (P < 0.001, P < 0.001, P = 0.001, P = 0.003 and P = 0.025 respectively). On multivariable analysis, the presence of concomitant disease, cirrhosis and surgical resection were significant risk factors associated with a worse HRQL score after treatment. CONCLUSION: Percutaneous RFA produced better post-treatment HRQL than surgical resection for patients with solitary small (no more than 3 cm) HCC.

First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China.

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

First Report of Fusarium solani Causing Fusarium Root Rot and Stem Canker on Storage Roots of Sweet Potato in China.

China is the biggest sweet potato (Ipomoea batatas (L.) Lam) producer in the world and its total production is about 100 million tons per year. Surveys for diseases of sweet potato in storage were conducted from 2011 to 2013 in Hebei Province, China. The storage roots from cultivars such as Yizi 138 and Beijing 553 developed lesions on their surface during storage. Typical lesions consisted of alternating light and dark brown concentric rings that were darker than the root surface. The size of the lesions was 49 × 63 mm (11 to 75 × 36 to 80 mm, n = 20) on average. The lesion spot was slightly concave. Cutting the diseased roots revealed the lesions could extend into the center of the roots, often with cavities. It smelled bitter within the necrotic tissues and was dark brown or black. The disease incidence was about 10 to 20%. A Fusarium species was consistently isolated from the diseased roots (n = 20). Mycelial plugs from a pure culture of the pathogen on potato dextrose agar were placed on the surface of disinfected sweet potato roots incubated at 25°C with 80 to 90% relative humidity and uninoculated roots were used as control. The same symptom was observed after 14 days on all roots (n = 20) inoculated with the pathogen. The same Fusarium species was consistently reisolated from all lesions. The pathogen was cultured on carnation leaf agar (CLA) for 10 days at 25°C with a 12-h photoperiod. The fungus produced two types of spores on CLA: microconidia were thin-walled, hyaline, fusiform to ovoid, generally 1- or 2-celled, and 3.1 to 9.4 × 1.3 to 2.9 µm (n = 20); macroconidia were slightly curved with blunt and rounded apical cell and notched basal cells, mostly 4- to 8-celled, and 13.3 to 36.5 × 2.3 to 3.8 µm (n = 40). On the basis of morphological characteristics, the fungal isolates were identified as Fusarium solani (Mart.) Appel & Wollenw. emend. Snyd. & Hans. (1). The genomic DNA of the pathogen cultured in potato dextrose broth for 3 days at 25°C was extracted with the CTAB method. The ITS-rDNA sequence, a fragment of the translation elongation factor 1-alpha (EF-1α) gene sequence, and the beta tubulin gene sequence was amplified using the paired primers ITS1F/ITS4(CTTGGTCATTTAGAGGAAGTAA/TCCTCCGCTTATTGA TATGC), EF-1/EF-2 (ATGGGTAAGGARGACAAGAC/GGARGTACCAGTSATCATGTT) and Bt-1/Bt-2(AACATGCGTGAGATTGTAAGT/TCTGGATGTTGTTGGGAATCC), respectively. Those sequence showed 97% homology with ITS sequence of F. solani (GenBank Accession No. AF178407), 99% homology with EF-1α sequence of F. solani (JX945169, DQ247593, and DQ247354), and 98% homology with beta tubulin gene sequence of F. solani (AB553621), respectively. The new sequences of ITS-rDNA, EF-1α, and beta tubulin were deposited in GenBank (KF255997, KF255995, and KF255996). The pathogen was identified as F. solani based on its morphological and molecular characteristics. To our knowledge, this is the first report of F. solani-induced fusarium root rot and stem canker on sweet potato storage roots in China. A rootlet root rot attributed to F. solani in China was reported previously (2). References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, Blackwell Publishing, Ames, IA, 2006. (2) Q. J. Liu et al. Acta Phytopathol. Sin. 12(3):21,1982.

First Report of Fusarium tricinctum Causing Stem and Root Rot on Lanzhou Lily (Lilium davidii var. unicolor) in China.

Lanzhou lily (Lilium davidii var. unicolor Cotton) is an important bulb edible crop which mostly distributes in middle area of Gansu Province in China (2). Recently, plants of Lanzhou lily developed symptoms of severe wilting. In early autumn of 2012 to 2013, a survey of Lanzhou lily disease was carried out in Yuanjiawan, Caoyuan, Xiguoyuan, and Hutan villages of Lanzhou City and Xuding and Guanshan villages of Linxia Prefecture. Disease symptoms included stem and root rot, vessels showed a brown to dark brown discoloration, plus a progressive yellowing and wilting of leaves from the base. Small pieces of symptomatic leaves, stems, and roots were surface disinfected with 75% ethanol for 30 s, 3% sodium hypochlorite for 5 min, and then washed three times in sterile distilled water. The tissues were placed on Martin Agar at 25°C for 7 days. Three isolates were consistently isolated from diseased tissues and all isolates with morphology similar to Fusarium spp. Isolates were transferred to potato dextrose agar (PDA) and carnation leaf agar (CLA) and incubated at 25°C in darkness. These isolates grew rapidly on PDA and formed abundant dense aerial mycelium, initially white, that became deep pink with age and formed red pigments in the medium. On CLA, macroconidia with 3 to 5 septa were abundant, relatively slender, and curved to lunate. Microconidia were abundant, oval and 0 to 1 septa. Chlamydospores were globose with a smooth outer wall in chains. The rDNA internal transcribed spacer (ITS) region comprising ITS1, ITS2, and 5.8S rDNA was amplified using primers ITS-1 and ITS-4 (3) and sequenced. On the basis of a comparison of 563 bp, all the three isolates had the identical sequence (GenBank Accession No. KF728675). BLASTn analysis of the sequence showed 100% match with the ITS sequences of those F. tricinctum sequences in GenBank (Accession Nos. FJ233196, AY188923, and JF776663). Pathogenicity test was performed by transplanting 2-month-old tissue culture seedlings to plastic pots in a sterile mixture of vermiculite and torf substrate at 1:3 (v/v). Seedlings were inoculated with 6 ml of the conidial suspension (104 conidia/ml) on the roots of plant in each pot, three plants per pot, and three replicates for each treatment. Seedlings treated with sterile water served as controls. The seedlings were placed in a plant growth chamber maintained at 22 ± 3°C, relative humidity >70%, 16 h light per day, and irrigated with sterile water. After 4 weeks, inoculated plants exhibited wilting foliage that with symptoms similar to those observed in the field, while the control plants remained healthy. F. tricinctum was re-isolated from all inoculated plants. The disease has been reported previously in ornamental lily in China (1). However, to the best of our knowledge, this is the first report of F. tricinctum causing wilt on edible Lanzhou lily in China and the disease must be taken into consideration of current disease management. This work supported by NSFC No. 31370447 and Hundred Talents Program of CAS "Molecular mechanism of biological control on plant diseases." References: (1) Y. Y. Li et al. Plant Dis. 97:993, 2013. (2) R. Y. Wang et al. Virol. J. 7:34, 2010. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

[Patient-derived parotid gland pleomorphic adenoma organoid model and its preliminary histological and functional characterization].

Objective: To establish patient-derived organoid models of pleomorphic adenomas (PA) of the parotid gland and preliminarily characterize their histology, related biomarkers and functions. Methods: Fresh tumor tissue specimens were collected from surgical procedures of Oral and Maxillofacial Department. The harvested tissues were processed and cultured in a head and neck tumor organoid culture system to establish organoid models from parotid gland pleomorphic adenomas. The in vitro growth of PA organoids was recorded by light microscopy. The successfully established organoids were passaged and cryopreserved, and the cryopreserved PA organoids were revived and re-cultured to observe their viability and organoid regeneration ability. Histological characterization, as well as characterization and detection of related markers and functional proteins, were performed on the organoids, comparing them with the patient-derived tissues. Results: The constructed organoid model of pleomorphic adenoma exhibited a dense and compact three-dimensional spherical structure. Hematoxylin and eosin staining indicated morphological similarities between the organoid and its tissue of origin. Immunohistochemistry showed positive cytoplasmic staining for Calponin, cytokeratin 7, and epithelial membrane antigen in both the organoid and the source tumor tissue, suggesting consistent histopathological characteristics between the organoid and its tissue of origin. Periodic acid-Schiff staining of the organoid showed positive staining for glycogen, with positive staining located in the interior and periphery of the organoid, indicating that the organoid possessed secretory functions like the salivary gland. Conclusions: This study successfully constructed organoids of pleomorphic adenoma derived from patient samples. This model faithfully replicates the tissue morphology and biomarkers of the source tissue and exhibits biological functions associated with mucus secretion. It serves as a valuable in vitro model for studying the development and progression of salivary gland tumors.

First Report of Lily Blight and Wilt Caused by Fusarium tricinctum in China.

Lily (Lilium spp.) is one of the most well-known horticultural crops, and plays an important economic role in China. In September 2011, wilted plants were observed on Lilium oriental hybrid cultivar 'Sorbonne' growing in Longde County, Ningxia Hui Autonomous Region, China. Disease symptoms included wilting, stem and root rot, brown spots of bulbs and then bulbs rotting and spalling from the basal disc, plus a progressive yellowing and defoliation of the leaves from the base. Diseased plants were sampled from fields. Small pieces of symptomatic bulbs, stems, and roots from 10 different plants were surface disinfected with 75% ethanol for 30 s, 3% sodium hypochlorite for 5 min, and then washed three times in sterilize distilled water. The tissues were placed onto Martin Agar (2) at 25°C for 7 days. Nine isolates with morphology similar to Fusarium were obtained from the diseased tissues. Isolates were transferred to potato dextrose agar (PDA) and carnation leaf agar (CLA) and incubated at 25°C. Seven were identified as Fusarium oxysporum and one was F. solani, which have been reported as pathogens of lily in China (1). The other isolate, when grown on PDA, rapidly produced dense, white aerial mycelium that became pink with age and formed red pigments in the medium. On CLA, macroconidia with three to five septate were abundant, relatively slender, and curved to lunate. Microconidia were abundant, oval or pyriform, and one to two celled. Chlamydospores were in chains with smooth exine. The rDNA internal transcribed spacer (ITS) region and a portion of the translation elongation factor 1-alpha (EF-1α) gene of the fungus were amplified, with universal primers ITS1/ITS4 and EF1/EF2 primers respectively (3) and sequenced. In addition, the ß-tubulin gene (ß-tub) of the fungus was amplified with modified primers Btu-F-F01 (5'-CAGACMGGTCAGTGCGTAA-3') and Btu-F-R01 (5'-TCTTGGGGTCGAACATCTG-3') (4). BLASTn analysis showed that the ITS sequences of the isolate (GenBank Accession No. JX989827) had 98.9% similarity with those of F. tricinctum (EF611092, JF776665, and HM776425) and the EF-1α sequences of the isolate (JX989828) had 98.1% similarity with those of F. tricinctum (EU744837 and JX397850). The ß-tub sequences of the isolate (JX989829) had 99.0% similarity with those of F. tricinctum (EU490236 and AB587077). The isolate was tested for pathogenicity. Two-month-old 'Sorbonne' seedlings were inoculated by placing 5 ml of conidial suspension (about 106 conidia per ml) over the roots of plants in each pot. Control plants were treated with sterile water in the same way. Plants were placed in a greenhouse at 22 to 25°C with a 15-h photoperiod. There were eight plants per pot and three replicates for each treatment. After 3 weeks, 87.5% of the inoculated plants exhibited browning of the root tips, root rot, and yellowing of the leaves, while control plants were symptomless. The pathogen was reisolated from the infected roots and identified as F. tricinctum, thus fulfilling Koch's postulates. To our knowledge, this is the first report of Fusarium wilt of lily caused by F. tricinctum. This information will provide guidance for the control of lily wilt disease and add information useful for the production of lilies. References: (1) C. Li and J. J. Li. Acta Phytopathol. Sin. (in Chinese) 26:192, 1995. (2) J. P. Martin. Soil Sci. 38:215, 1950. (3) K. O'Donnell et al. Proc. Nat. Acad. Sci. U. S. A. 95:2044, 1998. (4) M. Watanabe et al. BMC Evol. Biol. 11:322. 2011.

Cyclophilin A and nuclear factor of activated T cells are essential in cyclosporine-mediated suppression of polyomavirus BK replication.

Immunosuppressants have impacts on the development of polyomavirus-associated nephropathy. We previously demonstrated that cyclosporin A (CsA) suppressed polyomavirus BK (BKV) replication. The role of cyclophilin A (CypA) and nuclear factor of activated T cells (NFAT) in CsA-imposed suppression of BKV replication was determined in this study. Results demonstrated that knockdown of CypA but not CypB significantly reduced BKV large T antigen (TAg) expression and BKV titer. Overexpression of CypA reversed CypA siRNA-induced inhibition in BKV TAg expression. In addition, CypA overexpression attenuated the suppressive effect of CsA on TAg expression, suggesting CypA implicated in CsA-mediated anti-BKV effect. Knockdown of NFATc3 abrogated TAg expression, while overexpression of NFATc3 promoted TAg expression and augmented BKV promoter activity. NFATc3 binding to the BKV promoter was verified by chromatin immunoprecipitation assay and electrophoretic mobility shift assay. Renal histology also displayed an increase in NFATc3 expression in tubulointerstitium of BKV-associated nephropathy. Furthermore, overexpression of NFATc3 rescued CsA-mediated inhibition of BKV load and TAg expression. A CsA analog, NIM811, which cannot block NFAT functionality, failed to suppress TAg expression. In conclusion, CypA and NFAT are indispensable in BKV replication. CsA inhibits BKV replication through CypA and NFAT, which may be potential targets of anti-BKV treatment.

Pearson syndrome: unique endocrine manifestations including neonatal diabetes and adrenal insufficiency.

PURPOSE: Pearson syndrome is a very rare metabolic disorder that is usually present in infancy with transfusion dependent macrocytic anemia and multiorgan involvement including exocrine pancreas, liver and renal tubular defects. The disease is secondary to a mitochondrial DNA deletion that is variable in size and location. Endocrine abnormalities can develop, but are usually not part of the initial presentation. We report two patients who presented with unusual endocrine manifestations, neonatal diabetes and adrenal insufficiency, who were both later diagnosed with Pearson syndrome. METHODS: Medical records were reviewed. Confirmatory testing included: mitochondrial DNA deletion testing and sequencing of the breakpoints, muscle biopsy, and bone marrow studies. RESULTS: Case 1 presented with hyperglycemia requiring insulin at birth. She had several episodes of ketoacidosis triggered by stress and labile blood glucose control. Workup for genetic causes of neonatal diabetes was negative. She had transfusion dependent anemia and died at 24 months due to multisystem organ failure. Case 2 presented with adrenal insufficiency and anemia during inturcurrent illness, requiring steroid replacement since 37 months of age. He is currently 4 years old and has mild anemia. Mitochondrial DNA studies confirmed a 4.9 kb deletion in patient 1 and a 5.1 kb deletion in patient 2. CONCLUSION: The patients reported highlight the importance of considering mitochondrial DNA disorders in patients with early onset endocrine dysfunction, and expand the knowledge about this rare mitochondrial disease.

Krabbe disease: clinical, biochemical and molecular information on six new patients and successful retrospective diagnosis using stored newborn screening cards.

PURPOSE: To present clinical, biochemical and molecular information on six new clinically diagnosed Krabbe disease patients and assess the sensitivity of retrospective galactocerebrosidase measurement in their newborn screening samples. METHODS: Medical records were reviewed. Galactocerebrosidase activity was measured in leukocytes and, retrospectively, in the patients' newborn screening cards (stored for 1.4 to 13.5 years). GALC gene mutation analysis was performed. RESULTS: Five patients with Krabbe disease, one of whom also had hydrocephalus, became symptomatic during infancy. A sixth patient presented with seizures and developmental regression at age two and had a protracted disease course. Galactocerebrosidase activity in leukocytes ranged from 0.00 to 0.20 nmol/h/mg protein. Low galactocerebrosidase activity (range: 3.2% to 11.1% of the daily mean), consistent with Krabbe disease, was detected in each of the newborn screening samples. GALC molecular analysis identified six previously unreported mutations and two novel sequence variants. CONCLUSION: Our cases highlight the clinical variability of Krabbe disease. Galactocerebrosidase activity in newborn dried blood spots is a highly sensitive test, even when samples have been stored for many years. The high frequency of private mutations in the GALC gene may limit the use of genetic information for making treatment decisions in the newborn period.

Risk factors for oxaliplatin-induced peripheral neuropathy: a systematic review and meta-analysis.

OBJECTIVE: Oxaliplatin-induced neuropathy is a significant complication of cancer therapy. We aimed at investigating the risk factors of oxaliplatin-induced neuropathy (OIPN) and providing evidence to enhance its prevention. MATERIALS AND METHODS: PubMed, Medline, Web of Science, Embase, China Knowledge Resource Integrated Database, and the Wanfang Database were searched comprehensively for observational studies investigating the prevalence and risk factors of OIPN from inception to November 30, 2021. The Newcastle-Ottawa Scale was used by two independent reviewers to assess methodological quality. When applicable, we used meta-analysis to determine mean differences and odds ratios for continuous and nominal scaled data. RESULTS: We included 20 studies involving 10,900 participants for analysis. Factors associated with OIPN risk identified by meta-analysis were age, gender, diabetes, anemia, hypomagnesaemia, alcohol consumption, body mass index, body surface area, cumulative oxaliplatin dose and the number of chemotherapy cycles. Factors not associated with OIPN risk included smoking history and chemotherapy regimen. CONCLUSIONS: This meta-analysis identified multiple variables associated with OIPN. The recognition of modifiable risk factors is an urgent priority to improve prevention and treatment outcomes.