Follicular fluid progesterone downregulated HPGD and COX2 in granulosa cells via suppressing NF-ĸB in endometriosis†.

Increasing evidences showed that ovulatory dysfunction, possibly caused by luteinized unruptured follicular follicle syndrome (LUFS), is one of the reasons for endometriosis-related infertility. The present study was conducted to explore the potential effect of elevated progesterone in follicular fluid (FF) on ovulation in endometriosis. A prospective study including 50 ovarian endometriosis patients and 50 control patients with matched pairs design was conducted with alterations in FF and peritoneal fluid (PF) components identified by metabolomics analyses and differentially expressed genes in granulosa cells (GCs) identified by transcriptome analysis. Patients with endometriosis exhibited a significantly higher progesterone level in serum, FF, and PF. Granulosa cells from endometriosis patients revealed decreased expression of HPGD, COX-2, and suppressed NF-ĸB signaling. Similarly, progesterone treatment in vitro downregulated HPGD and COX2 expression and suppressed NF-ĸB signaling in granulosa tumor-like cell line KGN (Bena Culture Collection, China) and primarily cultured GCs, as manifested by decreased expressions of IL1R1, IRAK3, reduced pIĸBα/IĸBα ratio, and nucleus translocation of p65. On the contrary, TNF-α treatment increased expression of IL1R1, IRAK3, pIĸBα, p65, and HPGD in GCs. One potential p65 binding site was identified in the promoter region of HPGD by chromatin immunoprecipitation. In conclusion, we found that intrafollicular progesterone might downregulate HPGD and COX-2 in GCs via suppressing the NF-ĸB signaling pathway, shedding light on the mechanism underlying the endometriosis-related ovulatory dysfunction.

Embryo morphologic quality in relation to the metabolic and cognitive development of singletons conceived by in vitro fertilization and intracytoplasmic sperm injection: a matched cohort study.

BACKGROUND: Embryos with higher morphologic quality grading may have a greater potential to achieve clinical pregnancy that leads to a live birth regardless of the type of cleavage-stage embryos or blastocysts. Few studies have investigated the impacts of embryo grading on the long-term health of the offspring. OBJECTIVE: This pilot study aimed to examine the associations between embryo morphologic quality and the physical, metabolic, and cognitive development of singletons conceived by in vitro fertilization and intracytoplasmic sperm injection at preschool age. STUDY DESIGN: This matched cohort study included singletons born to infertile couples who underwent fresh cleavage-stage embryo transfer cycles with good- or poor-quality embryos from 2014 to 2016 at the reproductive center of the Women's Hospital, School of Medicine, Zhejiang University. A total of 144 children, aged 4 to 6 years, participated in the follow-up assessment from 2020 to 2021, and the response rate of poor-quality embryo offspring was 39%. Singletons in the good-quality embryo group were matched with singletons in the poor-quality embryo group at a 2:1 ratio according to the fertilization method and the children's age (±1 year). We measured the offspring's height, weight, body mass index, blood pressure, thyroid hormone levels, and metabolic indicators. Neurodevelopmental assessments were performed using the Chinese version of the Wechsler Preschool and Primary Scale of Intelligence, Fourth Edition, and the Adaptive Behavior Assessment System, Second Edition. We also collected data from the medical records. A linear regression model was used to analyze the association between embryo morphologic quality and offspring health outcomes. RESULTS: A total of 48 singletons conceived with poor-quality embryo transfer and 96 matched singletons conceived with good-quality embryo transfer were included in the final analysis. Age, sex, height, weight, body mass index, blood pressure, thyroid function, and metabolic indicators were comparable between the 2 groups. After adjustment for potential risk factors by linear regression model 1 and model 2, poor-quality embryo offspring exhibited a tendency toward higher free thyroxine levels than offspring of good-quality embryo transfers (beta, 0.22; 95% confidence interval, 0.09-0.90; beta, 0.22; 95% confidence interval, 0.09-0.91, respectively), but this difference was not clinically significant. Regarding neurodevelopmental assessments, there was no difference in the full-scale intelligence quotient based on the Wechsler Preschool and Primary Scale of Intelligence (109.96±12.42 vs 109.60±14.46; P=.88) or the general adaptive index based on the Adaptive Behavior Assessment System (108.26±11.70 vs 108.08±13.44; P=.94) between the 2 groups. The subindices of the 2 tests were also comparable. These findings remained after linear regression analysis. CONCLUSION: At 4 to 6 years of age, singletons born from poor-quality embryo transfers have comparable metabolic and cognitive development as those born from good-quality embryo transfers using fresh cleavage-stage embryos. The results of this pilot study indicate that poor-quality embryos that can survive implantation and end in live birth are likely to have a developmental potential comparable to that of good-quality embryos.

[Risk Factors for Sepsis Associated-Acute Kidney Injury in Intensive Care Unit Patients].

OBJECTIVE: To explore the risk factors of acute kidney injury (AKI) in patients with sepsis in intensive care unit (ICU). METHODS: The medical records of patients diagnosed with sepsis in ICU of West China Hospital of Sichuan University from March 2009 to June 2016 were retrospectively analyzed. Differences between AKI group and Non-AKI group in general data, background disease, ICU entry and exit dates, complications, laboratory data and other related data were analyzed through univariate and multivariate statistical methods. RESULTS: A total of 2331 patients with sepsis were included in the study, including 626 patients in the AKI group and 1695 patients in the Non-AKI group. The multivariate logistic regression analysis revealed that age >40 yr. (odds ratio (OR) =2.752), diabetes (OR=2.563), hypertension/coronary heart disease (OR=1.851), chronic kidney disease (OR=15.876), heart failure (OR=2.295), acute respiratory distress syndrome (OR=2.067), severe acute pancreatitis (OR=2.725), hypotension (OR=2.140), hypoproteinemia (OR=1.596), lactic acidosis (OR=2.164), organ failure>1 (OR=4.480), WBC>10×10 9L -1 (OR=4.166), serum creatinine (OR=4.401), PCT (OR=1.816), Cys-C (OR=7.046), mild anemia (OR=2.107), moderate anemia (OR=3.817), and severe anemia (OR=6.091) were all independent risk factors of SA-AKI. CONCLUSION: Several risk factors are related to the occurrence of SA-AKI in the ICU. Early identification and monitoring of risk factors for SA-AKI and early prevention of AKI can improve the prognosis of sepsis patients.

Characterization of Fc gamma receptor IIb expression within abdominal aortic aneurysm.

OBJECTIVE: To evaluate protein profiles and Fc gamma receptor IIb (FCGRIIB) expression in abdominal aortic aneurysm (AAA) compared to the expression in normal aortas. METHODS: We performed a protein array to study the protein expression profiles within AAA and normal aortic tissues. FCGRIIB was found to be significantly elevated in AAA samples. Quantitative PCR and Western blot analyses were performed to study the expression of FCGRIIB in AAA compared to that in normal aortic tissue. Immunohistochemistry was used to locate FCGRIIB and the B cell marker CD19 in AAA and normal aortas specimens. RESULTS: FCGRIIB was significantly elevated in AAA tissues in both mRNA (AAA vs. normal control: about 5.8 folds, p < 0.001) and protein levels (AAA vs. normal control: about 6.3 folds, p < 0.001). In AAA specimens, immunohistochemistry revealed that FCGRIIB localized to the area of inflammatory infiltrates, which consisted of CD 19+ B cells and other inflammatory cells. FCGRIIB and CD19 were undetectable in normal aortas. CONCLUSIONS: FCGRIIB was significantly elevated in AAA tissues compared to normal aortas. FCGRIIB may be involved in the pathogenesis of AAA by regulation of inflammatory reactions.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Identification of a novel pathogenic variant in the MYH3 gene in a five-generation family with CPSFS1A (Contractures, Pterygia, and Spondylocarpotarsal Fusion Syndrome 1A).

BACKGROUND: Distal arthrogryposis (DA) is a group of rare Mendelian conditions that demonstrate heterogeneity with respect to genetics and phenotypes. Ten types of DAs, which collectively involve six genes, have been reported. Among them, the MYH3 gene causes several types of arthrogryposis conditions and therefore has a pivotal role in the skeletal and muscle development of the fetus. For this study, we recruited a five-generation Chinese family with members presenting DA features and phenotypic variability. Further clinical study characterized it as CPSFS1A (Contractures, Pterygia, and Spondylocarpotarsal Fusion Syndrome 1A). METHODS: Genomic DNA was extracted from eight family members, including one fetus. Whole-exome sequencing (WES) was then conducted on the proband's sample, followed by Sanger sequencing as validation for each of the participants. In silico analysis was performed. Western blotting (WB) detection and pathological staining were conducted on skeletal muscle tissue of the induced fetus after prenatal diagnosis. RESULTS: A novel heterozygous pathogenic variant, namely NM_002470.3: c.3044_3047delinsTCAATTTGTT: p.E1015_D1016delinsVNLF in the MYH3 gene, was identified and shown to be cosegregated with the condition in the subject family. This variant resulted in the replacement of amino-acid residues E1015 and D1016 by a string of VNLFs. The pregnancy was selectively terminated because the fetus was genetically affected. However, the WB and pathological results did not indicate a significant change in the norm. CONCLUSIONS: Our study expanded the variant spectrum of CPSFS1A, in addition to which it provided solid evidence for the appropriateness of genetic counseling and pregnancy management for the family. The results may also provide further insight into the molecular mechanism of MYH3.

Intratumoral and peritumoral radiomics analysis for preoperative Lauren classification in gastric cancer.

BACKGROUND: Preoperative prediction of the Lauren classification in gastric cancer (GC) is very important to the choice of therapy, the evaluation of prognosis, and the improvement of quality of life. However, there is not yet radiomics analysis concerning the prediction of Lauren classification straightly. In this study, a radiomic nomogram was developed to preoperatively differentiate Lauren diffuse type from intestinal type in GC. METHODS: A total of 539 GC patients were enrolled in this study and later randomly allocated to two cohorts at a 7:3 ratio for training and validation. Two sets of radiomic features were derived from tumor regions and peritumor regions on venous phase computed tomography (CT) images, respectively. With the least absolute shrinkage and selection operator logistic regression, a combined radiomic signature was constructed. Also, a tumor-based model and a peripheral ring-based model were built for comparison. Afterwards, a radiomic nomogram integrating the combined radiomic signature and clinical characteristics was developed. All the models were evaluated regarding classification ability and clinical usefulness. RESULTS: The combined radiomic signature achieved an area under receiver operating characteristic curve (AUC) of 0.715 (95% confidence interval [CI], 0.663-0.767) in the training cohort and 0.714 (95% CI, 0.636-0.792) in the validation cohort. The radiomic nomogram incorporating the combined radiomic signature, age, CT T stage, and CT N stage outperformed the other models with a training AUC of 0.745 (95% CI, 0.696-0.795) and a validation AUC of 0.758 (95% CI, 0.685-0.831). The significantly improved sensitivity of radiomic nomogram (0.765 and 0.793) indicated better identification of diffuse type GC patients. Further, calibration curves and decision curves demonstrated its great model fitness and clinical usefulness. CONCLUSIONS: The radiomic nomogram involving the combined radiomic signature and clinical characteristics holds potential in differentiating Lauren diffuse type from intestinal type for reasonable clinical treatment strategy.

Analysis of the origins of black carbon and carbon monoxide transported to Beijing, Tianjin, and Hebei in China.

A novel back-trajectory approach was adopted to determine the origins of black carbon (BC) and carbon monoxide (CO) transported to Beijing, Tianjin and Hebei. Results showed that the transport efficiency was controlled mainly by mid-latitude westerlies in winter, the South Asian monsoon in summer and prevailing westerly and northwesterly winds in spring and autumn. Hebei was identified as the most important source region of both BC (respectively accounting for 55% and 49%) and CO (39% and 38%) transported to Beijing and Tianjin. Inner Mongolia contributed more to the effective emission intensity (EEI) in winter than in summer for both BC and CO transported to Beijing and Tianjin. Shandong was responsible for higher EEI in summer than in winter. The six provinces making the greatest contributions to BC transported to Hebei were Shandong (19%), Shanxi (19%), Inner Mongolia (17%), Beijing (11%), Henan (11%), and Tianjin (10%), whereas those making the greatest contributions to CO transported to Hebei were Shandong (20%), Inner Mongolia (10%), Tianjin (9%), Henan (9%), Shanxi (9%), and Beijing (8%). In summary, Hebei, Inner Mongolia, Shandong, Tianjin and Shanxi were determined as the dominant source regions of not only BC but also CO transported to Beijing. Hebei, Shandong, Beijing, Inner Mongolia, Henan, Liaoning and Shanxi were relatively important source regions for Tianjin. Shandong, Shanxi, Inner Mongolia, Beijing, Henan, Tianjin, Liaoning, Jiangsu and Anhui were the main source regions for Hebei. Residential and industrial sectors were the dominant sectors for BC and CO transported to the receptors, respectively. These results are consistent with the results of previous studies. Finally, comparing the observed ΔBC/ΔCO ratio with the enhancement ratio of the EEI of BC with that of CO (ΔEEIBC/ΔEEICO) at Miyun site, we further confirmed that the EEI can be used to represent the amounts of BC and CO reaching receptors.

[The mechanism of transforming growth factor beta1 in myofibroblast differentiation].

OBJECTIVE: To investigate the mechanism underlying myofibroblast differentiation induced by transforming growth factor (TGF) beta1 in obliterative bronchiolitis following lung transplantation. METHODS: Heterotopic tracheal transplantation was performed in Smad3 wild-type and knock-out mice to simulate the lung transplantation in human. Murine tracheal fibroblasts cultivated in primary culture were used for in vitro study. Immunohistochemistry, immunocytochemistry, Western Blotting, RT-PCR and DNA electrophoresis mobility gel shift assay were conducted to detect the expression of alpha-smooth muscle actin (alphaSMA), the marker of fibroblast-myofibroblast differentiation, and the activation of Smad3, p38 and ERK1/2. RESULTS: In affected airways of experimental obliterative bronchiolitis, abundant expression of alphaSMA were found. In vitro study for tracheal fibroblasts, the activation of Smad3 by TGF-beta1 presents as three major forms, phosphorylation, nuclear translocation and DNA binding. In Smad3 wild-type fibroblasts, TGF-beta1 induces the increase of the myofibroblasts transformation, characterized by the elevation of alphaSMA, both at transcription and protein level. While in Smad3 knock-out fibroblasts, the transformation of myofibroblasts induced by TGF-beta1 is significantly decreased (t = 2.080, P = 0.027; t = 1.982, P = 0.032), but not completely abolished. Further study in Smad3-deficient fibroblasts demonstrates that p38 and ERK1/2 could be activated by TGF-beta1 and result in fibroblast differentiation. CONCLUSIONS: TGF-beta1 could promote the transformation of fibroblasts into myofibroblasts in Smad3 dependent and independent signal pathways, especially the Smad3 dependent path, and result in the development of obliterative bronchiolitis.

Barcoded sequencing reveals diverse intrauterine microbiomes in patients suffering with endometrial polyps.

Results of this study showed that the bacterial composition in vagina (V) greatly differed from intrauterine microbiome (I). Microbiomes were present in all intrauterine samples of healthy women (Group H (I)) and patients with endometrial polyps (EP) (including Group EP (I) and Group EP/chronic endometritis (CE) (I)). Indeed, the intrauterine bacteria population in Group EP/CE (I) were more diverse than those in Groups EP (I) and H (I). The result also confirmed the bacterial composition differences between vagina and uterus as well as the intrauterine microbiome alteration in the patients, compared to the healthy. Although bacteria of Proteobacteria, Firmicutes and Actinobacteria, dominated the intrauterine microbiome in all samples, however, proportions of Firmicutes from Group EP/CE (I) and Group EP (I) were much higher than that from Group H (I), in contrast, the proportions of Proteobacteria were far lower than the healthy. At the genus level, compared to Group H (I), it is found that proportions of Lactobacillus, Gardnerella, Bifidobacterium, Streptococcus, and Alteromonas were significantly higher, and that of Pseudomonas were significantly lower in Group EP/CE (I) or Group EP (I). In addition, lower proportions of Enterobacter and Sphingomonas and a higher proportion of Prevotella were also observed in Group EP/CE (I). In conclusion, uterine microbiomes between patients with EP and the healthy are significantly different and all the potentially important variation of uterine microbes may cause EP, but not definitively related to CE. Further experiments should be performed to test these relationships to endometritis occurrence.

Comparison of clinical curative effect between open surgery and endovascular repair of abdominal aortic aneurysm in China.

OBJECTIVE: To compare clinical curative effects of open surgery (OS) or endovascular repair (EVAR) for patients with abdominal aortic aneurysm (AAA) in China. DATA SOURCES: We performed a comprehensive search of both English and Chinese literatures involving case studies on retrograde OS or EVAR of AAA in China from January 1976 to December 2010. STUDY SELECTION: According to the inclusion criteria, 76 articles were finally analyzed to compare patient characteristics, clinical success, complications, and prognosis. RESULTS: We analyzed a total of 2862 patients with 1757 undergoing OS (OS group) and 1105 undergoing EVAR (EVAR group). There was no significant difference in the success rate of the procedures. Operative time, length of ICU stay, fasting time, duration of total postoperative stay, blood loss, and blood transfusion requirements during the procedure were significantly lower in the EVAR group. A 30-day follow up revealed more cardiac, renal, pulmonary, and visceral complications in the OS group (P < 0.01). Low-limb ischemia, however, was more common in the EVAR group (P < 0.05). The 30-day mortality rate, including aorta-related and non-aorta related mortality, was significantly lower in the EVAR group (P < 0.01). In the follow-up period, there were more patients with occlusions of artificial vessel and late endoleak in the EVAR group (P < 0.01). The overall late mortality rate was higher in the OS group (P < 0.01), especially non-aorta-related late mortality and mortality during the fourth to the sixth year (P < 0.01). CONCLUSIONS: EVAR was safer and less invasive for AAA patients. Patients suffered fewer complications and recovered sooner. However, complications such as artificial vessel occlusion, low-limb ischemia, and endoleak were common in EVAR. Clinicians should carry out further research to solve these complications and improve the efficacy of EVAR.

Synthesis of methylated quercetin derivatives and their reversal activities on P-gp- and BCRP-mediated multidrug resistance tumour cells.

Three methylated quercetins and a series of O-3 substituted 5,7,3',4'-tetra-O-methylated quercetin derivatives have been synthesized and evaluated on the modulating activity of P-gp, BCRP and MRP1 in cancer cell lines. Compound 17 (with a 2-((4-methoxybenzoyl)oxy)ethyl at O-3) is the most potent P-gp modulator. Three derivatives, compound 9 (3,7,3',4'-tetra-O-methylated quercetin), compound 14 (with a 2-((3-oxo-3-(3,4,5trimethoxyphenyl)prop-1-en-1-yl)oxy)ethyl at O-3) and compound 17, consistently exhibited promising BCRP-modulating activity. Interestingly, compound 17 was found to be equipotent against both P-gp and BCRP. Importantly, these synthetic quercetin derivatives did not exhibit any inherent cytotoxicity to cancer cell lines or normal mouse fibroblast cell lines. These quercetin derivatives can be employed as safe and effective modulators of P-gp- or BCRP-mediated drug resistance in cancer.

[Regional PM pollution in Beijing and surrounding area during summertime].

The air quality in Beijing and surrounding area is influenced by local emission and regional transport. To study the characteristics of regional pollution, PM (particulate matter) samples were collected simultaneously at 4 sites including Tsinghua University (TH) and Miyun reservoir (MY) in Beijing, Renqiu (RQ, Hebei Province), and Shangdu (SD, Inner Mongolia) during August, 2007, and temporal/spatial distributions of PM2.5 mass concentrations along with 22 elements in TSP were characterized. PM2.5 mass concentrations were quite different at 4 sites, following the sequence as RQ > TH > MY > SD. The highest concentrations of pollution-derived elements S, Zn, Pb, Cu, As, Sb, Ni, Cd, In, Se were found in RQ, showing the most intensive anthropogenic influence around this region, and their lowest variation indicated that the pollution mostly came from local sources. Controlled by the meteorological factors, highest daily variations of these elements were found at SD with relative lower concentrations. The correlation coefficients of S, Pb, Cd, In, As, Zn concentrations between TH and MY were all higher than 0.70, which implies similar sources for these elements at the 2 sites in Beijing. At the beginning and the end of the Sawtooth pollution episode in Beijing, concentrations of most elements in Miyun were comparable with the lowest concentrations at Shangdu observed during the sampling period, which means Miyun could well represent the regional characteristics of clean air mass from the northwest. Uniform spatial distribution of high sulfate was found (about 10 microg/m3) at the peaks of Sawtooth episode, which implies the important contribution from secondary aerosol during the regional pollution. Variable sources of PM at each site and their regional influence were discussed based on the different characteristics of elemental enrichment factors.