Prediction and validation of novel SigB regulon members in Bacillus subtilis and regulon structure comparison to Bacillales members.

BACKGROUND: Sigma factor B (SigB) is the central regulator of the general stress response in Bacillus subtilis and regulates a group of genes in response to various stressors, known as the SigB regulon members. Genes that are directly regulated by SigB contain a promotor binding motif (PBM) with a previously identified consensus sequence. RESULTS: In this study, refined SigB PBMs were derived and different spacer compositions and lengths (N12-N17) were taken into account. These were used to identify putative SigB-regulated genes in the B. subtilis genome, revealing 255 genes: 99 had been described in the literature and 156 genes were newly identified, increasing the number of SigB putative regulon members (with and without a SigB PBM) to > 500 in B. subtilis. The 255 genes were assigned to five categories (I-V) based on their similarity to the original SigB consensus sequences. The functionalities of selected representatives per category were assessed using promoter-reporter fusions in wt and ΔsigB mutants upon exposure to heat, ethanol, and salt stress. The activity of the PrsbV (I) positive control was induced upon exposure to all three stressors. PytoQ (II) showed SigB-dependent activity only upon exposure to ethanol, whereas PpucI (II) with a N17 spacer and PylaL (III) with a N16 spacer showed mild induction regardless of heat/ethanol/salt stress. PywzA (III) and PyaaI (IV) displayed ethanol-specific SigB-dependent activities despite a lower-level conserved - 10 binding motif. PgtaB (V) was SigB-induced under ethanol and salt stress while lacking a conserved - 10 binding region. The activities of PygaO and PykaA (III) did not show evident changes under the conditions tested despite having a SigB PBM that highly resembled the consensus. The identified extended SigB regulon candidates in B. subtilis are mainly involved in coping with stress but are also engaged in other cellular processes. Orthologs of SigB regulon candidates with SigB PBMs were identified in other Bacillales genomes, but not all showed a SigB PBM. Additionally, genes involved in the integration of stress signals to activate SigB were predicted in these genomes, indicating that SigB signaling and regulon genes are species-specific. CONCLUSION: The entire SigB regulatory network is sophisticated and not yet fully understood even for the well-characterized organism B. subtilis 168. Knowledge and information gained in this study can be used in further SigB studies to uncover a complete picture of the role of SigB in B. subtilis and other species.

SigB modulates expression of novel SigB regulon members via Bc1009 in non-stressed and heat-stressed cells revealing its alternative roles in Bacillus cereus.

BACKGROUND: The Bacillus cereus Sigma B (SigB) dependent general stress response is activated via the two-component RsbKY system, which involves a phosphate transfer from RsbK to RsbY. It has been hypothesized that the Hpr-like phosphocarrier protein (Bc1009) encoded by bc1009 in the SigB gene cluster may play a role in this transfer, thereby acting as a regulator of SigB activation. Alternatively, Bc1009 may be involved in the activation of a subset of SigB regulon members. RESULTS: We first investigated the potential role of bc1009 to act as a SigB regulator but ruled out this possibility as the deletion of bc1009 did not affect the expression of sigB and other SigB gene cluster members. The SigB-dependent functions of Bc1009 were further examined in B. cereus ATCC14579 via comparative proteome profiling (backed up by transcriptomics) of wt, Δbc1009 and ΔsigB deletion mutants under heat stress at 42 °C. This revealed 284 proteins displaying SigB-dependent alterations in protein expression levels in heat-stressed cells, including a subgroup of 138 proteins for which alterations were also Bc1009-dependent. Next to proteins with roles in stress defense, newly identified SigB and Bc1009-dependent proteins have roles in cell motility, signal transduction, transcription, cell wall biogenesis, and amino acid transport and metabolism. Analysis of lethal stress survival at 50 °C after pre-adaptation at 42 °C showed intermediate survival efficacy of Δbc1009 cells, highest survival of wt, and lowest survival of ΔsigB cells, respectively. Additional comparative proteome analysis of non-stressed wt and mutant cells at 30 °C revealed 96 proteins with SigB and Bc1009-dependent differences in levels: 51 were also identified under heat stress, and 45 showed significant differential expression at 30 °C. This includes proteins with roles in carbohydrate/ion transport and metabolism. Overlapping functions at 30 °C and 42 °C included proteins involved in motility, and ΔsigB and Δbc1009 cells showed reduced motility compared to wt cells in swimming assays at both temperatures. CONCLUSION: Our results extend the B. cereus SigB regulon to > 300 members, with a novel role of SigB-dependent Bc1009 in the activation of a subregulon of  > 180 members, conceivably via interactions with other transcriptional regulatory networks.

Analysis of Germination Capacity and Germinant Receptor (Sub)clusters of Genome-Sequenced Bacillus cereus Environmental Isolates and Model Strains.

Spore germination of 17 Bacillus cereus food isolates and reference strains was evaluated using flow cytometry analysis in combination with fluorescent staining at a single-spore level. This approach allowed for rapid collection of germination data under more than 20 conditions, including heat activation of spores, germination in complex media (brain heart infusion [BHI] and tryptone soy broth [TSB]), and exposure to saturating concentrations of single amino acids and the combination of alanine and inosine. Whole-genome sequence comparison revealed a total of 11 clusters of operons encoding germinant receptors (GRs): GerK, GerI, and GerL were present in all strains, whereas GerR, GerS, GerG, GerQ, GerX, GerF, GerW, and GerZ (sub)clusters showed a more diverse presence/absence in different strains. The spores of tested strains displayed high diversity with regard to their sensitivity and responsiveness to selected germinants and heat activation. The two laboratory strains, B. cereus ATCC 14579 and ATCC 10987, and 11 food isolates showed a good germination response under a range of conditions, whereas four other strains (B. cereus B4085, B4086, B4116, and B4153) belonging to phylogenetic group IIIA showed a very weak germination response even in BHI and TSB media. Germination responses could not be linked to specific (combinations of) GRs, but it was noted that the four group IIIA strains contained pseudogenes or variants of subunit C in their gerL cluster. Additionally, two of those strains (B4086 and B4153) carried pseudogenes in the gerK and gerRI (sub)clusters that possibly affected the functionality of these GRs. IMPORTANCE: Germination of bacterial spores is a critical step before vegetative growth can resume. Food products may contain nutrient germinants that trigger germination and outgrowth of Bacillus species spores, possibly leading to food spoilage or foodborne illness. Prediction of spore germination behavior is, however, very challenging, especially for spores of natural isolates that tend to show more diverse germination responses than laboratory strains. The approach used has provided information on the genetic diversity in GRs and corresponding subclusters encoded by B. cereus strains, as well as their germination behavior and possible associations with GRs, and it provides a basis for further extension of knowledge on the role of GRs in B. cereus (group member) ecology and transmission to the host.

Spore Heat Activation Requirements and Germination Responses Correlate with Sequences of Germinant Receptors and with the Presence of a Specific spoVA2mob Operon in Foodborne Strains of Bacillus subtilis.

Spore heat resistance, germination, and outgrowth are problematic bacterial properties compromising food safety and quality. Large interstrain variation in these properties makes prediction and control of spore behavior challenging. High-level heat resistance and slow germination of spores of some natural Bacillus subtilis isolates, encountered in foods, have been attributed to the occurrence of the spoVA2mob operon carried on the Tn1546 transposon. In this study, we further investigate the correlation between the presence of this operon in high-level-heat-resistant spores and their germination efficiencies before and after exposure to various sublethal heat treatments (heat activation, or HA), which are known to significantly improve spore responses to nutrient germinants. We show that high-level-heat-resistant spores harboring spoVA2mob required higher HA temperatures for efficient germination than spores lacking spoVA2mob The optimal spore HA requirements additionally depended on the nutrients used to trigger germination, l-alanine (l-Ala), or a mixture of l-asparagine, d-glucose, d-fructose, and K+ (AGFK). The distinct HA requirements of these two spore germination pathways are likely related to differences in properties of specific germinant receptors. Moreover, spores that germinated inefficiently in AGFK contained specific changes in sequences of the GerB and GerK germinant receptors, which are involved in this germination response. In contrast, no relation was found between transcription levels of main germination genes and spore germination phenotypes. The findings presented in this study have great implications for practices in the food industry, where heat treatments are commonly used to inactivate pathogenic and spoilage microbes, including bacterial spore formers.IMPORTANCE This study describes a strong variation in spore germination capacities and requirements for a heat activation treatment, i.e., an exposure to sublethal heat that increases spore responsiveness to nutrient germination triggers, among 17 strains of B. subtilis, including 9 isolates from spoiled food products. Spores of industrial foodborne isolates exhibited, on average, less efficient and slower germination responses and required more severe heat activation than spores from other sources. High heat activation requirements and inefficient, slow germination correlated with elevated resistance of spores to heat and with specific genetic features, indicating a common genetic basis of these three phenotypic traits. Clearly, interstrain variation and numerous factors that shape spore germination behavior challenge standardization of methods to recover highly heat-resistant spores from the environment and have an impact on the efficacy of preservation techniques used by the food industry to control spores.

A transposon present in specific strains of Bacillus subtilis negatively affects nutrient- and dodecylamine-induced spore germination.

Spore germination shows a large inter-strain variability. Spores of certain Bacillus subtilis strains, including isolates from spoiled food products, exhibit different germination behavior from spores of the well-studied model organism Bacillus subtilis 168, often for unknown reasons. In this study, we analyzed spore germination efficiencies and kinetics of seventeen B. subtilis strains with previously sequenced genomes. A subsequent gene-trait matching analysis revealed a correlation between a slow germination phenotype and the presence of a mobile genetic element, i.e., a Tn1546-like transposon. A detailed investigation of the transposon elements showed an essential role of a specific operon (spoVA2mob ) in inhibiting spore germination with nutrients and with the cationic surfactant dodecylamine. Our results indicate that this operon negatively influences release of Ca-DPA by the SpoVA channel and may additionally alter earlier germination events, potentially by affecting proteins in the spore inner membrane. The spoVA2mob operon is an important factor that contributes to inter-strain differences in spore germination. Screening for its genomic presence can be applied for identification of spores that exhibit specific properties that impede spore eradication by industrial processes.

Minimal inhibitory concentrations of undissociated lactic, acetic, citric and propionic acid for Listeria monocytogenes under conditions relevant to cheese.

Minimal inhibitory concentrations (MICs) of undissociated lactic acid were determined for six different Listeria monocytogenes strains at 30 °C and in a pH range of 4.2-5.8. Small increments in pH and acid concentrations were used to accurately establish the growth/no growth limits of L. monocytogenes for these acids. The MICs of undissociated lactic acid in the pH range of 5.2-5.8 were generally higher than at pH 4.6 for the different L. monocytogenes strains. The average MIC of undissociated lactic acid was 5.0 (SD 1.5) mM in the pH range 5.2-5.6, which is relevant to Gouda cheese. Significant differences in MICs of undissociated lactic acid were found between strains of L. monocytogenes at a given pH, with a maximum observed level of 9.0 mM. Variations in MICs were mostly due to strain variation. In the pH range 5.2-5.6, the MICs of undissociated lactic acid were not significantly different at 12 °C and 30 °C. The average MICs of undissociated acetic acid, citric acid, and propionic acid were 19.0 (SD 6.5) mM, 3.8 (SD 0.9) mM, and 11.0 (SD 6.3) mM, respectively, for the six L. monocytogenes strains tested in the pH range 5.2-5.6. Variations in MICs of these organic acids for L. monocytogenes were also mostly due to strain variation. The generated data contribute to improved predictions of growth/no growth of L. monocytogenes in cheese and other foods containing these organic acids.

Bacillus thermoamylovorans Spores with Very-High-Level Heat Resistance Germinate Poorly in Rich Medium despite the Presence of ger Clusters but Efficiently upon Exposure to Calcium-Dipicolinic Acid.

High-level heat resistance of spores of Bacillus thermoamylovorans poses challenges to the food industry, as industrial sterilization processes may not inactivate such spores, resulting in food spoilage upon germination and outgrowth. In this study, the germination and heat resistance properties of spores of four food-spoiling isolates were determined. Flow cytometry counts of spores were much higher than their counts on rich medium (maximum, 5%). Microscopic analysis revealed inefficient nutrient-induced germination of spores of all four isolates despite the presence of most known germination-related genes, including two operons encoding nutrient germinant receptors (GRs), in their genomes. In contrast, exposure to nonnutrient germinant calcium-dipicolinic acid (Ca-DPA) resulted in efficient (50 to 98%) spore germination. All four strains harbored cwlJ and gerQ genes, which are known to be essential for Ca-DPA-induced germination in Bacillus subtilis. When determining spore survival upon heating, low viable counts can be due to spore inactivation and an inability to germinate. To dissect these two phenomena, the recoveries of spores upon heat treatment were determined on plates with and without preexposure to Ca-DPA. The high-level heat resistance of spores as observed in this study (D120°C, 1.9 ± 0.2 and 1.3 ± 0.1 min; z value, 12.2 ± 1.8°C) is in line with survival of sterilization processes in the food industry. The recovery of B. thermoamylovorans spores can be improved via nonnutrient germination, thereby avoiding gross underestimation of their levels in food ingredients.

Two distinct groups within the Bacillus subtilis group display significantly different spore heat resistance properties.

The survival of bacterial spores after heat treatment and the subsequent germination and outgrowth in a food product can lead to spoilage of the food product and economical losses. Prediction of time-temperature conditions that lead to sufficient inactivation requires access to detailed spore thermal inactivation kinetics of relevant model strains. In this study, the thermal inactivation kinetics of spores of fourteen strains belonging to the Bacillus subtilis group were determined in detail, using both batch heating in capillary tubes and continuous flow heating in a micro heater. The inactivation data were fitted using a log linear model. Based on the spore heat resistance data, two distinct groups (p < 0.001) within the B. subtilis group could be identified. One group of strains had spores with an average D120 °C of 0.33 s, while the spores of the other group displayed significantly higher heat resistances, with an average D120 °C of 45.7 s. When comparing spore inactivation data obtained using batch- and continuous flow heating, the z-values were significantly different, hence extrapolation from one system to the other was not justified. This study clearly shows that heat resistances of spores from different strains in the B. subtilis group can vary greatly. Strains can be separated into two groups, to which different spore heat inactivation kinetics apply.

Levels and types of microbial contaminants in different plant-based ingredients used in dairy alternatives.

In this study levels and types of microbial contaminants were investigated in 88 different plant-based ingredients including many that are used to manufacture dairy alternatives. Studied ingredients encompassed samples of pulses (pea, faba bean, chickpea, and mung bean), cereals/pseudocereals (oat, rice, amaranth and quinoa) and drupes (coconut, almond and cashew). The microbial analysis included: i) total viable count (TVC), ii) total aerobic mesophilic spore count (TMS), iii) heat resistant aerobic thermophilic spore count (HRTS), iv) anaerobic sulfite reducing Clostridium spore count (SRCS), and v) Bacillus cereus spore count (BCES). Microorganisms isolated from the counting plates with the highest sample dilutions were identified using 16S rRNA and MALDI-TOF MS analyses. Many of the investigated ingredients showed a high proportion of spores as part of their total aerobic mesophilic counts. In 63 % of the samples, the difference between TVC and TMS counts was 1 Log10 unit or less. This was particularly the case for the majority of pea isolates and concentrates, faba bean isolates, oat kernels and flakes, and for single samples of chickpea isolate, almond, amaranth, rice, quinoa, and coconut flours. Concentrations of TVC ranged between <1.0 and 5.3 Log10 CFU/g in different samples, and TMS varied between <1.0 and 4.1 Log10 CFU/g. Levels of HTRS, BCES and SRCS were generally low, typically around or below the LOD of 1.0 Log10 CFU/g. In total, 845 individual bacterial colonies were isolated belonging to 33 different genera. Bacillus licheniformis and B. cereus group strains were most frequently detected among Bacillus isolates, and these species originated primarily from pea and oat samples. Geobacillus stearothermophilus was the main species encountered as part of the HRTS. Among the Clostridium isolates, Clostridum sporogenes/tepidum were predominant species, which were mostly found in pea and almond samples. Strains with potential to cause foodborne infection or intoxication were typed using the PCR-based method for toxin genes detection. In the B. cereus group, 9 % of isolates contained the ces gene, 28 % contained hbl, 42 % cytK, and 69 % were positive for the nhe gene. Absence of the boNT-A and -B genes was confirmed for all isolated C. sporogenes/tepidum strains. Nearly all (98 %) B. licheniformis isolates were positive for the lchAA gene. Insight into the occurrence of microbial contaminants in plant-based ingredients, combined with knowledge of their key inactivation and growth characteristics, can be used for the microbial risk assessment and effective design of plant-based food processing conditions and formulations to ensure food safety and prevent spoilage.

A wide variety of Clostridium perfringens type A food-borne isolates that carry a chromosomal cpe gene belong to one multilocus sequence typing cluster.

Of 98 suspected food-borne Clostridium perfringens isolates obtained from a nationwide survey by the Food and Consumer Product Safety Authority in The Netherlands, 59 strains were identified as C. perfringens type A. Using PCR-based techniques, the cpe gene encoding enterotoxin was detected in eight isolates, showing a chromosomal location for seven isolates and a plasmid location for one isolate. Further characterization of these strains by using (GTG)(5) fingerprint repetitive sequence-based PCR analysis distinguished C. perfringens from other sulfite-reducing clostridia but did not allow for differentiation between various types of C. perfringens strains. To characterize the C. perfringens strains further, multilocus sequence typing (MLST) analysis was performed on eight housekeeping genes of both enterotoxic and non-cpe isolates, and the data were combined with a previous global survey covering strains associated with food poisoning, gas gangrene, and isolates from food or healthy individuals. This revealed that the chromosomal cpe strains (food strains and isolates from food poisoning cases) belong to a distinct cluster that is significantly distant from all the other cpe plasmid-carrying and cpe-negative strains. These results suggest that different groups of C. perfringens have undergone niche specialization and that a distinct group of food isolates has specific core genome sequences. Such findings have epidemiological and evolutionary significance. Better understanding of the origin and reservoir of enterotoxic C. perfringens may allow for improved control of this organism in foods.

Lichenysin Production by Bacillus licheniformis Food Isolates and Toxicity to Human Cells.

Bacillus licheniformis can cause foodborne intoxication due to the production of the surfactant lichenysin. The aim of this study was to measure the production of lichenysin by food isolates of B. licheniformis in LB medium and skimmed milk and its cytotoxicity for intestinal cells. Out of 11 B. licheniformis isolates tested, most showed robust growth in high salt (1M NaCl), 4% ethanol, at 37 or 55°C, and aerobic and anaerobic conditions. All strains produced lichenysin (in varying amounts), but not all strains were hemolytic. Production of this stable compound by selected strains (high producers B4094 and B4123, and type strain DSM13 T ) was subsequently determined using LB medium and milk, at 37 and 55°C. Lichenysin production in LB broth and milk was not detected at cell densities < 5 log10 CFU/ml. The highest concentrations were found in the stationary phase of growth. Total production of lichenysin was 4-20 times lower in milk than in LB broth (maximum 36 µg/ml), and ∼10 times lower in the biomass obtained from milk agar than LB agar. Under all conditions tested, strain B4094 consistently yielded the highest amounts. Besides strain variation and medium composition, temperature also had an effect on lichenysin production, with twofold lower amounts of lichenysin produced at 55°C than at 37°C. All three strains produced lichenysin A with varying acyl chain lengths (C11-C18). The relative abundance of the C14 variant was highest in milk and the C15 variant highest in LB. The concentration of lichenysin needed to reduce cell viability by 50% (IC50) was 16.6 µg/ml for Caco-2 human intestinal epithelial cells and 16.8 µg/ml for pig ileum organoids. Taken together, the presence of low levels (<5 log10 CFU/ml) of B. licheniformis in foods is unlikely to pose a foodborne hazard related to lichenysin production. However, depending on the strain present, the composition, and storage condition of the food, a risk of foodborne intoxication may arise if growth to high levels is supported and such product is ingested.

Clostridial spore germination versus bacilli: genome mining and current insights.

Bacilli and clostridia share the characteristic of forming metabolically inactive endospores. Spores are highly resistant to adverse environmental conditions including heat, and their ubiquitous presence in nature makes them inevitable contaminants of foods and food ingredients. Spores can germinate under favourable conditions, and the following outgrowth can lead to food spoilage and foodborne illness. Germination of spores has been best studied in Bacillus species, but the process of spore germination is less well understood in anaerobic clostridia. This paper describes a genome mining approach focusing on the genes related to spore germination of clostridia. To this end, 12 representative sequenced Bacillus genomes and 24 Clostridium genomes were analyzed for the distribution of known and putative germination-related genes and their homologues. Overall, the number of ger operons encoding germinant receptors is lower in clostridia than in bacilli, and some Clostridium species are predicted to produce cortex-lytic enzymes that are different from the ones encountered in bacilli. The in silico germination model constructed for clostridia was linked to recently obtained experimental data for selected germination determinants, mainly in Clostridium perfringens. Similarities and differences between germination mechanisms of bacilli and clostridia will be discussed.

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis.

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a DeltarecA mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Stress-survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2) and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

Enumeration and Identification of Bacterial Spores in Cocoa Powders.

ABSTRACT: The presence of bacterial spores in cocoa powders is inevitable due to the cocoa bean fermentation process, during which members of the genera Bacillus and Geobacillus are typically present. Spores are a concern in heat-treated foods when they survive heat treatments and the finished product supports germination, growth, and potentially toxin production. In this study, available methods for the enumeration of total mesophilic and thermophilic spores (TMS and TTS, respectively) were evaluated, leading to the recommendation of one global method specifically for cocoa powders. The proposed method was validated during a ring test on seven selected cocoa powders and applied during routine analyses on commercial powders. The method includes dilution of cocoa powder using buffered peptone water, heating at 80°C for 10 min for TMS and TTS counts, and heating at 100°C for 30 min for a heat-resistant (HR) spore count. Tryptic soy agar is used as a recovery medium with a maximal concentration of cocoa powder of 2.5 mg/mL (to prevent growth inhibition) and a nonnutrient agar overlay to prevent swarming of bacteria. Plates are incubated for at least 72 h at 30°C for recovery of mesophilic bacteria and 55°C for thermophilic bacteria. Suitable alternatives to specific method parameters are provided. Median values of total spore concentrations are low (<400 CFU/g for TMS and <75 CFU/g for TTS), and concentrations of HR spores are very low (<5 CFU/g). Importantly, the relation between concentrations of HR spores in cocoa powder and incidence of spoilage of heat-treated beverages containing cocoa is currently unclear. In the powders included in this study, Bacillus subtilis and Bacillus licheniformis were the predominant spore-forming species identified (49 and 39%, respectively). Both species are known for high variability in spore heat resistance. The development of reliable and sensitive molecular methods is therefore required to assess the risk of spoilage caused by spores present in cocoa powders.

Diversity assessment of heat resistance of Listeria monocytogenes strains in a continuous-flow heating system.

Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated in a high-temperature, short-time pasteurization process (72 degrees C for 15 s). To obtain heat-resistant strains, 48 strains were exposed to 55 degrees C for up to 3 h. The energy of activation constant and inactivation constant of strains that survived best (strains 1E and NV8) were subsequently determined in a continuous-flow-through system. Strain Scott A was taken along as a reference. The 3 strains were cultured in whole milk and in brain heart infusion broth at 30 and 7 degrees C. Strains 1E and NV8 were significantly more heat resistant than was strain Scott A after growth in brain heart infusion broth at 30 degrees C and after growth in milk at 7 degrees C. From the inactivation parameters, it was calculated that exposure to high-temperature, short-time pasteurization (72 degrees C for 15 s) will result in 12.1-, 14.2-, and 87.5-log reductions for the strains 1E, NV8, and Scott A, respectively. These results demonstrate that industrial pasteurization conditions suffice to inactivate the most heat-resistant L. monocytogenes strains tested in this study.

Heat resistance of spores of 18 strains of Geobacillus stearothermophilus and impact of culturing conditions.

In this study, different methods were evaluated for enumeration of spores of G. stearothermophilus, different sporulation methods were assessed for yields and wet heat resistances of obtained spores, and subsequently, the variation in heat resistances of spores was determined. Overall, tryptone soya agar (TSA) was the most suitable medium for enumeration of spores of this thermophilic bacterium. Sporulation on different media both at 55 and at 61 °C led to considerable variation in spore heat resistance. The heat resistance of spores was highest upon sporulation on medium supplemented with free ions of calcium, potassium, magnesium and manganese (CaKMgMn). For 18 different G. stearothermophilus strains that were isolated from various sources, spores were subsequently produced on nutrient agar supplemented with CaKMgMn at 55 °C. Strain ATCC 12980T, also known as 9A20, which is commonly used in steam sterilization tests was included. The survival of spores of all strains was assessed at 125 °C and 130 °C using two independent spore batches per strain. The mean D125°C for spores of the 18 strains was 1.1 min (95% PI 0.48-2.3 min) and the mean D130°C was 0.37 min (95% PI 0.17-0.82 min). For spore inactivation of these 18 strains, a z-value of 11.1 °C was estimated, resulting in an estimated D-value of 2.4 min (95% PI 1.1-5.2) at the reference temperature 121.1 °C. Based on the data sets obtained in this study, it was found that the variability in spore heat resistance could largely be attributed to strain variability and conditions used during sporulation (especially the sporulation medium); reproduction and experimental variabilities were much smaller. The established variabilities were compared with the overall variability in spore heat resistance of G. stearothermophilus based on a meta-analysis of reported D-values. The data presented indicate that strain variability and history of sporulation each account for approximately half of the overall variability observed with respect to the heat resistance of spores of G. stearothermophilus. The findings presented in this study allow for optimal recovery of G. stearothermophilus spores from foods and a better understanding of factors that determine the heat resistance properties of spores of G. stearothermophilus. Moreover, this study once more underlines the limited effects of heat treatments used in the food industry on inactivation of spores of this bacterium.

Natural Diversity in Heat Resistance of Bacteria and Bacterial Spores: Impact on Food Safety and Quality.

Heat treatments are widely used in food processing often with the aim of reducing or eliminating spoilage microorganisms and pathogens in food products. The efficacy of applying heat to control microorganisms is challenged by the natural diversity of microorganisms with respect to their heat robustness. This review gives an overview of the variations in heat resistances of various species and strains, describes modeling approaches to quantify heat robustness, and addresses the relevance and impact of the natural diversity of microorganisms when assessing heat inactivation. This comparison of heat resistances of microorganisms facilitates the evaluation of which (groups of) organisms might be troublesome in a production process in which heat treatment is critical to reducing the microbial contaminants, and also allows fine-tuning of the process parameters. Various sources of microbiological variability are discussed and compared for a range of species, including spore-forming and non-spore-forming pathogens and spoilage organisms. This benchmarking of variability factors gives crucial information about the most important factors that should be included in risk assessments to realistically predict heat inactivation of bacteria and spores as part of the measures for controlling shelf life and safety of food products.

Next generation microbiological risk assessment-Potential of omics data for hazard characterisation.

According to the World Health Organization estimates in 2015, 600 million people fall ill every year from contaminated food and 420,000 die. Microbial risk assessment (MRA) was developed as a tool to reduce and prevent risks presented by pathogens and/or their toxins. MRA is organized in four steps to analyse information and assist in both designing appropriate control options and implementation of regulatory decisions and programs. Among the four steps, hazard characterisation is performed to establish the probability and severity of a disease outcome, which is determined as function of the dose of toxin and/or pathogen ingested. This dose-response relationship is subject to both variability and uncertainty. The purpose of this review/opinion article is to discuss how Next Generation Omics can impact hazard characterisation and, more precisely, how it can improve our understanding of variability and limit the uncertainty in the dose-response relation. The expansion of omics tools (e.g. genomics, transcriptomics, proteomics and metabolomics) allows for a better understanding of pathogenicity mechanisms and virulence levels of bacterial strains. Detection and identification of virulence genes, comparative genomics, analyses of mRNA and protein levels and the development of biomarkers can help in building a mechanistic dose-response model to predict disease severity. In this respect, systems biology can help to identify critical system characteristics that confer virulence and explain variability between strains. Despite challenges in the integration of omics into risk assessment, some omics methods have already been used by regulatory agencies for hazard identification. Standardized methods, reproducibility and datasets obtained from realistic conditions remain a challenge, and are needed to improve accuracy of hazard characterisation. When these improvements are realized, they will allow the health authorities and government policy makers to prioritize hazards more accurately and thus refine surveillance programs with the collaboration of all stakeholders of the food chain.

Two complementary approaches to quantify variability in heat resistance of spores of Bacillus subtilis.

Realistic prediction of microbial inactivation in food requires quantitative information on variability introduced by the microorganisms. Bacillus subtilis forms heat resistant spores and in this study the impact of strain variability on spore heat resistance was quantified using 20 strains. In addition, experimental variability was quantified by using technical replicates per heat treatment experiment, and reproduction variability was quantified by using two biologically independent spore crops for each strain that were heat treated on different days. The fourth-decimal reduction times and z-values were estimated by a one-step and two-step model fitting procedure. Grouping of the 20 B. subtilis strains into two statistically distinguishable groups could be confirmed based on their spore heat resistance. The reproduction variability was higher than experimental variability, but both variabilities were much lower than strain variability. The model fitting approach did not significantly affect the quantification of variability. Remarkably, when strain variability in spore heat resistance was quantified using only the strains producing low-level heat resistant spores, then this strain variability was comparable with the previously reported strain variability in heat resistance of vegetative cells of Listeria monocytogenes, although in a totally other temperature range. Strains that produced spores with high-level heat resistance showed similar temperature range for growth as strains that produced low-level heat resistance. Strain variability affected heat resistance of spores most, and therefore integration of this variability factor in modelling of spore heat resistance will make predictions more realistic.

A mobile genetic element profoundly increases heat resistance of bacterial spores.

Bacterial endospores are among the most resilient forms of life on earth and are intrinsically resistant to extreme environments and antimicrobial treatments. Their resilience is explained by unique cellular structures formed by a complex developmental process often initiated in response to nutrient deprivation. Although the macromolecular structures of spores from different bacterial species are similar, their resistance to environmental insults differs widely. It is not known which of the factors attributed to spore resistance confer very high-level heat resistance. Here, we provide conclusive evidence that in Bacillus subtilis, this is due to the presence of a mobile genetic element (Tn1546-like) carrying five predicted operons, one of which contains genes that encode homologs of SpoVAC, SpoVAD and SpoVAEb and four other genes encoding proteins with unknown functions. This operon, named spoVA2mob, confers high-level heat resistance to spores. Deletion of spoVA2mob in a B. subtilis strain carrying Tn1546 renders heat-sensitive spores while transfer of spoVA2mob into B. subtilis 168 yields highly heat-resistant spores. On the basis of the genetic conservation of different spoVA operons among spore-forming species of Bacillaceae, we propose an evolutionary scenario for the emergence of extremely heat-resistant spores in B. subtilis, B. licheniformis and B. amyloliquefaciens. This discovery opens up avenues for improved detection and control of spore-forming bacteria able to produce highly heat-resistant spores.