Stable bulged G-quadruplexes in the human genome: identification, experimental validation and functionalization.

DNA sequence composition determines the topology and stability of G-quadruplexes (G4s). Bulged G-quadruplex structures (G4-Bs) are a subset of G4s characterized by 3D conformations with bulges. Current search algorithms fail to capture stable G4-B, making their genome-wide study infeasible. Here, we introduced a large family of computationally defined and experimentally verified potential G4-B forming sequences (pG4-BS). We found 478 263 pG4-BS regions that do not overlap 'canonical' G4-forming sequences in the human genome and are preferentially localized in transcription regulatory regions including R-loops and open chromatin. Over 90% of protein-coding genes contain pG4-BS in their promoter or gene body. We observed generally higher pG4-BS content in R-loops and their flanks, longer genes that are associated with brain tissue, immune and developmental processes. Also, the presence of pG4-BS on both template and non-template strands in promoters is associated with oncogenesis, cardiovascular disease and stemness. Our G4-BS models predicted G4-forming ability in vitro with 91.5% accuracy. Analysis of G4-seq and CUT&Tag data strongly supports the existence of G4-BS conformations genome-wide. We reconstructed a novel G4-B 3D structure located in the E2F8 promoter. This study defines a large family of G4-like sequences, offering new insights into the essential biological functions and potential future therapeutic uses of G4-B.

Bulges in left-handed G-quadruplexes.

G-quadruplex (G4) DNA structures with a left-handed backbone progression have unique and conserved structural features. Studies on sequence dependency of the structures revealed the prerequisites and some minimal motifs required for left-handed G4 formation. To extend the boundaries, we explore the adaptability of left-handed G4s towards the existence of bulges. Here we present two X-ray crystal structures and an NMR solution structure of left-handed G4s accommodating one, two and three bulges. Bulges in left-handed G4s show distinct characteristics as compared to those in right-handed G4s. The elucidation of intricate structural details will help in understanding the possible roles and limitations of these unique structures.

Crystal structures of an HIV-1 integrase aptamer: Formation of a water-mediated A•G•G•G•G pentad in an interlocked G-quadruplex.

93del is a 16-nucleotide G-quadruplex-forming aptamer which can inhibit the activity of the HIV-1 integrase enzyme at nanomolar concentration. Previous structural analyses of 93del using NMR spectroscopy have shown that the aptamer forms an interlocked G-quadruplex structure in K+ solution. Due to its exceptional stability and unique topology, 93del has been used in many different studies involving DNA G-quadruplexes, such as DNA aptamer and multimer design, as well as DNA fluorescence research. To gain further insights on the structure of this unique aptamer, we have determined several high-resolution crystal structures of 93del and its variants. While confirming the overall dimeric interlocked G-quadruplex folding topology previously determined by NMR, our results reveal important detailed structural information, particularly the formation of a water-mediated A•G•G•G•G pentad. These insights allow us to better understand the formation of various structural elements in G-quadruplexes and should be useful for designing and manipulating G-quadruplex scaffolds with desired properties.

Coexistence of two quadruplex-duplex hybrids in the PIM1 gene.

The triple-negative breast cancer (TNBC), a subtype of breast cancer which lacks of targeted therapies, exhibits a poor prognosis. It was shown recently that the PIM1 oncogene is highly related to the proliferation of TNBC cells. A quadruplex-duplex hybrid (QDH) forming sequence was recently found to exist near the transcription start site of PIM1. This structure could be an attractive target for regulation of the PIM1 gene expression and thus the treatment of TNBC. Here, we present the solution structures of two QDHs that could coexist in the human PIM1 gene. Form 1 is a three-G-tetrad-layered (3+1) G-quadruplex containing a propeller loop, a lateral loop and a stem-loop made up of three G•C Watson-Crick base pairs. On the other hand, Form 2 is an anti-parallel G-quadruplex comprising two G-tetrads and a G•C•G•C tetrad; the structure has three lateral loops with the middle stem-loop made up of two Watson-Crick G•C base pairs. These structures provide valuable information for the design of G-quadruplex-specific ligands for PIM1 transcription regulation.

Intra-locked G-quadruplex structures formed by irregular DNA G-rich motifs.

G-rich DNA sequences with tracts of three or more continuous guanines (G≥3) are known to have high propensity to adopt stable G-quadruplex (G4) structures. Bioinformatic analyses suggest high prevalence of G-rich sequences with short G-tracts (G≤2) in the human genome. However, due to limited structural studies, the folding principles of such sequences remain largely unexplored and hence poorly understood. Here, we present the solution NMR structure of a sequence named AT26 consisting of irregularly spaced G2 tracts and two isolated single guanines. The structure is a four-layered G4 featuring two bi-layered blocks, locked between themselves in an unprecedented fashion making it a stable scaffold. In addition to edgewise and propeller-type loops, AT26 also harbors two V-shaped loops: a 2-nt V-shaped loop spanning two G-tetrad layers and a 0-nt V-shaped loop spanning three G-tetrad layers, which are named as VS- and VR-loop respectively, based on their distinct structural features. The intra-lock motif can be a basis for extending the G-tetrad core and a very stable intra-locked G4 can be formed by a sequence with G-tracts of various lengths including several G2 tracts. Findings from this study will aid in understanding the folding of G4 topologies from sequences containing irregularly spaced multiple short G-tracts.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

Duplexes Formed by G4C2 Repeats Contain Alternate Slow- and Fast-Flipping G·G Base Pairs.

Aberrant expansion of the hexanucleotide GGGGCC (or G4C2) repeat in the human C9ORF72 gene is the most common genetic factor found behind amyotrophic lateral sclerosis and frontotemporal dementia. The hypothesized pathways, through which the repeat expansions contribute to the pathology, involve one or more secondary structural forms of the DNA and/or RNA sequences, such as G-quadruplexes, duplexes, and hairpins. Here, we study the structures of DNA and RNA duplexes formed by G4C2 repeats, which contain G(syn)·G(anti) base pairs flanked by either G·C or C·G base pairs. We show that duplexes formed by G4C2 repeats contain alternately two types of G·G pair contexts exhibiting different syn-anti base flipping dynamics (∼100 ms vs ∼2 ms for DNA and ∼50 ms vs ∼20 ms for RNA at 10 °C, respectively) depending on the flanking bases, with the slow-flipping G·G pairs being flanked by a guanine at the 5'-end and the fast-flipping G·G pairs being flanked by a cytosine at the 5'-end. Our findings on the structures and dynamics of G·G base pairs in DNA and RNA duplexes formed by G4C2 repeats provide a foundation for further studies of the functions and targeting of such biologically relevant motifs.

Structure of a (3+1) hybrid G-quadruplex in the PARP1 promoter.

Poly (ADP-ribose) polymerase 1 (PARP1) has emerged as an attractive target for cancer therapy due to its key role in DNA repair processes. Inhibition of PARP1 in BRCA-mutated cancers has been observed to be clinically beneficial. Recent genome-mapping experiments have identified a non-canonical G-quadruplex-forming sequence containing bulges within the PARP1 promoter. Structural features, like bulges, provide opportunities for selective chemical targeting of the non-canonical G-quadruplex structure within the PARP1 promoter, which could serve as an alternative therapeutic approach for the regulation of PARP1 expression. Here we report the G-quadruplex structure formed by a 23-nucleotide G-rich sequence in the PARP1 promoter. Our study revealed a three-layered intramolecular (3+1) hybrid G-quadruplex scaffold, in which three strands are oriented in one direction and the fourth in the opposite direction. This structure exhibits unique structural features such as an adenine bulge and a G·G·T base triple capping structure formed between the central edgewise loop, propeller loop and 5' flanking terminal. Given the highly important role of PARP1 in DNA repair and cancer intervention, this structure presents an attractive opportunity to explore the therapeutic potential of PARP1 inhibition via G-quadruplex DNA targeting.

NMR solution and X-ray crystal structures of a DNA molecule containing both right- and left-handed parallel-stranded G-quadruplexes.

Analogous to the B- and Z-DNA structures in double-helix DNA, there exist both right- and left-handed quadruple-helix (G-quadruplex) DNA. Numerous conformations of right-handed and a few left-handed G-quadruplexes were previously observed, yet they were always identified separately. Here, we present the NMR solution and X-ray crystal structures of a right- and left-handed hybrid G-quadruplex. The structure reveals a stacking interaction between two G-quadruplex blocks with different helical orientations and displays features of both right- and left-handed G-quadruplexes. An analysis of loop mutations suggests that single-nucleotide loops are preferred or even required for the left-handed G-quadruplex formation. The discovery of a right- and left-handed hybrid G-quadruplex further expands the polymorphism of G-quadruplexes and is potentially useful in designing a left-to-right junction in G-quadruplex engineering.

Extracellular protein isolation from the matrix of anammox biofilm using ionic liquid extraction.

Anaerobic ammonium oxidation (anammox)-performing bacteria self-assemble into compact biofilms by expressing extracellular polymeric substances (EPS). Anammox EPS are poorly characterized, largely due to their low solubility in typical aqueous solvents. Pronase digestion achieved 19.5 ± 0.9 and 41.4 ± 1.4% (w/w) more solubilization of laboratory enriched Candidatus Brocadia sinica anammox granules than DNase and amylase, respectively. Nuclear magnetic resonance profiling of the granules confirmed proteins as dominant biopolymer within the EPS. Ionic liquid (IL) 1-ethyl-3-methylimidazolium acetate and N,N-dimethylacetamide (EMIM-Ac/DMAc) mixture was applied to extract the major structural proteins. Further treatment by anion exchange chromatography isolated homologous serine (S)- and threonine (T)-rich proteins BROSI_A1236 and UZ01_01563, which were major components of the extracted proteins, and sequentially highly similar to putative anammox extracellular proteins KUSTD1514 and WP_070066018.1 of Ca. Kuenenia stuttgartiensis and Ca. Brocadia sapporoensis, respectively. Six monosaccharides (i.e., arabinose, xylose, rhamnose, fucose, galactose, and mannose) were enriched for BROSI_A1236 against all other major proteins. The sugars, however, contributed < 0.5% (w/w) of total granular biomass and were likely co-enriched as glycoprotein appendages. This study demonstrates that BROSI_A1236 is a major extracellular component of Ca. B. sinica anammox biofilms that is likely a common anammox extracellular polymer, and can be isolated from the matrix following ionic liquid extraction.

Solution Structures of a G-Quadruplex Bound to Linear- and Cyclic-Dinucleotides.

Cyclic dinucleotides have emerged as important secondary messengers and cell signaling molecules that regulate several cell responses. A guanine-deficit G-quadruplex structure formation by a sequence containing (4n - 1) guanines, n denoting the number of G-tetrad layers, was previously reported. Here, a (4n - 1) G-quadruplex structure is shown to be capable of binding guanine-containing dinucleotides in micromolar affinity. The guanine base of the dinucleotides interacts with a vacant G-triad, forming four additional Hoogsteen hydrogen bonds to complete a G-tetrad. Solution structures of two complexes, both comprised of a (4n - 1) G-quadruplex structure, one bound to a linear dinucleotide (d(AG)) and the other to a cyclic dinucleotide (cGAMP), are solved using NMR spectroscopy. The latter suggests sufficiently strong interaction between the guanine base of the dinucleotide and the vacant G-triad, which acts as an anchor point of binding. The binding interfaces from the two solution structures provide useful information for specific ligand design. The results also infer that other guanine-containing metabolites of a similar size have the capability of binding G-quadruplexes, potentially affecting the expression of the metabolites and functionality of the bound G-quadruplexes.

Bright G-Quadruplex Nanostructures Functionalized with Porphyrin Lanterns.

The intricate arrangement of numerous and closely placed chromophores on nanoscale scaffolds can lead to key photonic applications ranging from optical waveguides and antennas to signal-enhanced fluorescent sensors. In this regard, the self-assembly of dye-appended DNA sequences into programmed photonic architectures is promising. However, the dense packing of dyes can result in not only compromised DNA assembly (leading to ill-defined structures and precipitates) but also to essentially nonfluorescent systems (due to π-π aggregation). Here, we introduce a two-step "tether and mask" strategy wherein large porphyrin dyes are first attached to short G-quadruplex-forming sequences and then reacted with per-O-methylated ß-cyclodextrin (PMßCD) caps, to form supramolecular synthons featuring the porphyrin fluor fixed into a masked porphyrin lantern (PL) state, due to intramolecular host-guest interactions in water. The PL-DNA sequences can then be self-assembled into cyclic architectures or unprecedented G-wires tethered with hundreds of porphyrin dyes. Importantly, despite the closely arrayed PL units (∼2 nm), the dyes behave as bright chromophores (up to 180-fold brighter than the analogues lacking the PMßCD masks). Since other self-assembling scaffolds, dyes, and host molecules can be used in this modular approach, this work lays out a general strategy for the bottom-up aqueous self-assembly of bright nanomaterials containing densely packed dyes.

An Unprecedented Knot-like G-Quadruplex Peripheral Motif.

A knot-like G-quadruplex peripheral structure is formed by a 7-nt DNA sequence DL7 (TGTTGGT), in which six out of its seven nucleobases participate in compact base-pairing interactions. Here, the solution NMR structure of a 24-nt DNA oligonucleotide containing the DL7 sequence shows the interaction between a two-layer anti-parallel G-quadruplex core and the peripheral knot-like structure, including the construction of two sharp turns in the DNA backbone. The formation of this novel structural element highlights the intricate properties of single-stranded DNA folding in presence of G-quadruplex-forming motifs. We demonstrated the compatibility of the DL7 knot-like structure with various G-quadruplexes, which could have implications in drug design and DNA engineering.

A Catalytic and Selective Scissoring Molecular Tool for Quadruplex Nucleic Acids.

A copper complex embedded in the structure of a water-soluble naphthalene diimide has been designed to bind and cleave G-quadruplex DNA. We describe the properties of this ligand, including its catalytic activity in the generation of ROS. FRET melting, CD, NMR, gel sequencing, and mass spectrometry experiments highlight a unique and unexpected selectivity in cleaving G-quadruplex sequences. This selectivity relies both on the binding affinity and structural features of the targeted G-quadruplexes.

Analysis of Interactions between Telomeric i-Motif DNA and a Cyclic Tetraoxazole Compound.

The interaction of a macrocyclic tetraoxazole compound, L2H2-4OTD (1), with two aminoalkyl side chains and telomeric i-motif, was investigated by means of electrophoretic mobility shift assay, circular dichroism spectroscopy, mass spectrometry and NMR spectroscopy analyses. The results indicate that 1 interacts with the i-motif structure at two preferred binding sites.

Rotation of Guanine Amino Groups in G-Quadruplexes: A Probe for Local Structure and Ligand Binding.

Nucleic acids are dynamic molecules whose functions may depend on their conformational fluctuations and local motions. In particular, amino groups are dynamic components of nucleic acids that participate in the formation of various secondary structures such as G-quadruplexes. Here, we present a cost-efficient NMR method to quantify the rotational dynamics of guanine amino groups in G-quadruplex nucleic acids. An isolated spectrum of amino protons from a specific tetrad-bound guanine can be extracted from the nuclear Overhauser effect spectroscopy spectrum based on the close proximity between the intra-residue imino and amino protons. We apply the method in different structural contexts of G-quadruplexes and their complexes. Our results highlight the role of stacking and hydrogen-bond interactions in restraining amino-group rotation. The measurement of the rotation rate of individual amino groups could give insight into the dynamic processes occurring at specific locations within G-quadruplex nucleic acids, providing valuable probes for local structure, dynamics, and ligand binding.

Functional and Promiscuity Studies of Three-Residue Cyclophane Forming Enzymes Show Nonnative C-C Cross-Linked Products and Leader-Dependent Cyclization.

Enzymes catalyzing peptide macrocyclization are important biochemical tools in drug discovery. The three-residue cyclophane-forming enzymes (3-CyFEs) are an emerging family of post-translational modifying enzymes that catalyze the formation of three-residue peptide cyclophanes. In this report, we introduce three additional 3-CyFEs, including ChlB, WnsB, and FnnB, that catalyze cyclophane formation on Tyr, Trp, and Phe, respectively. To understand the promiscuity of these enzymes and those previously reported (MscB, HaaB, and YxdB), we tested single amino acid substitutions at the three-residue motif of modification (Ω1X2X3, Ω1 = aromatic). Collectively, we observe that substrate promiscuity is observed at the Ω1 and X2 positions, but a greater specificity is observed for the X3 residue. Two nonnative cyclophane products were characterized showing a Phe-C3 to Arg-Cß and His-C2 to Pro-Cß cross-links, respectively. We also tested the leader dependence of selected 3-CyFEs and show that a predicted helix region is important for cyclophane formation. These results demonstrate the biocatalytic potential of these maturases and allow rational design of substrates to obtain a diverse array of genetically encoded 3-residue cyclophanes.

Stitched peptides as potential cell permeable inhibitors of oncogenic DAXX protein.

DAXX (Death Domain Associated Protein 6) is frequently upregulated in various common cancers, and its suppression has been linked to reduced tumor progression. Consequently, DAXX has gained significant interest as a therapeutic target in such cancers. DAXX is known to function in several critical biological pathways including chromatin remodelling, transcription regulation, and DNA repair. Leveraging structural information, we have designed and developed a novel set of stapled/stitched peptides that specifically target a surface on the N-terminal helical bundle domain of DAXX. This surface serves as the anchor point for binding to multiple interaction partners, such as Rassf1C, p53, Mdm2, and ATRX, as well as for the auto-regulation of the DAXX N-terminal SUMO interaction motif (SIM). Our experiments demonstrate that these peptides effectively bind to and inhibit DAXX with a higher affinity than the known interaction partners. Furthermore, these peptides release the auto-inhibited SIM, enabling it to interact with SUMO-1. Importantly, we have developed stitched peptides that can enter cells, maintaining their intracellular concentrations at nanomolar levels even after 24 hours, without causing any membrane perturbation. Collectively, our findings suggest that these stitched peptides not only serve as valuable tools for probing the molecular interactions of DAXX but also hold potential as precursors to the development of therapeutic interventions.

RNA is a key component of extracellular DNA networks in Pseudomonas aeruginosa biofilms.

The extracellular matrix of bacterial biofilms consists of diverse components including polysaccharides, proteins and DNA. Extracellular RNA (eRNA) can also be present, contributing to the structural integrity of biofilms. However, technical difficulties related to the low stability of RNA make it difficult to understand the precise roles of eRNA in biofilms. Here, we show that eRNA associates with extracellular DNA (eDNA) to form matrix fibres in Pseudomonas aeruginosa biofilms, and the eRNA is enriched in certain bacterial RNA transcripts. Degradation of eRNA associated with eDNA led to a loss of eDNA fibres and biofilm viscoelasticity. Compared with planktonic and biofilm cells, the biofilm matrix was enriched in specific mRNA transcripts, including lasB (encoding elastase). The mRNA transcripts colocalised with eDNA fibres in the biofilm matrix, as shown by single molecule inexpensive FISH microscopy (smiFISH). The lasB mRNA was also observed in eDNA fibres in a clinical sputum sample positive for P. aeruginosa. Thus, our results indicate that the interaction of specific mRNAs with eDNA facilitates the formation of viscoelastic networks in the matrix of Pseudomonas aeruginosa biofilms.

Four-Layered Intramolecular Parallel G-Quadruplex with Non-Nucleotide Loops: An Ultra-Stable Self-Folded DNA Nano-Scaffold.

A four-stranded scaffold of nucleic acids termed G-quadruplex (G4) has found growing applications in nano- and biotechnology. Propeller loops are a hallmark of the most stable intramolecular parallel-stranded G4s. To date, propeller loops have been observed to span only a maximum of three G-tetrad layers. Going beyond that would allow creation of more stable scaffolds useful for building robust nanodevices. Here we investigate the formation of propeller loops spanning more than three layers. We show that native nucleotide sequences are incompatible toward this goal, and we report on synthetic non-nucleotide linkers that form a propeller loop across four layers. With the established linkers, we constructed a four-layered intramolecular parallel-stranded G4, which exhibited ultrahigh thermal stability. Control on loop design would augment the toolbox toward engineering of G4-based nanoscaffolds for diverse applications.