Transcriptome profiling and co-expression network analysis of lncRNAs and mRNAs in colorectal cancer by RNA sequencing.

BACKGROUND: Long non-coding RNAs (lncRNAs) are widely involved in the pathogenesis of cancers. However, biological roles of lncRNAs in occurrence and progression of colorectal cancer (CRC) remain unclear. The current study aimed to evaluate the expression pattern of lncRNAs and messenger RNAs (mRNAs). METHODS: RNA sequencing (RNA-Seq) in CRC tissues and adjacent normal tissues from 6 CRC patients was performed and functional lncRNA-mRNA co-expression network was constructed afterwards. Gene enrichment analysis was demonstrated using DAVID 6.8 tool. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) was used to validate the expression pattern of differentially expressed lncRNAs. Pearson correlation analysis was applied to evaluate the relationships between selected lncRNAs and mRNAs. RESULTS: One thousand seven hundred and sixteenth differentially expressed mRNAs and 311 differentially expressed lncRNAs were screened out. Among these, 568 mRNAs were up-regulated while 1148 mRNAs down-regulated, similarly 125 lncRNAs were up-regulated and 186 lncRNAs down-regulated. In addition, 1448 lncRNA-mRNA co-expression pairs were screened out from 940,905 candidate lncRNA-mRNA pairs. Gene enrichment analysis revealed that these lncRNA-related mRNAs are associated with cell adhesion, collagen adhesion, cell differentiation, and mainly enriched in ECM-receptor interaction and PI3K-Akt signaling pathways. Finally, RT-qPCR results verified the expression pattern of lncRNAs, as well as the relationships between lncRNAs and mRNAs in 60 pairs of CRC tissues. CONCLUSIONS: In conclusion, these results of the RNA-seq and bioinformatic analysis strongly suggested that the dysregulation of lncRNA is involved in the complicated process of CRC development, and providing important insight regarding the lncRNAs involved in CRC.

Simultaneous determination of 3-n-butylphthalide and its metabolite 10-hydroxy-butylphthalide in rat plasma using liquid chromatography-tandem mass spectrometry and application to a pharmacokinetic study.

3-n-Butylphthalide (NBP) is a potent drug for the treatment of ischemic stroke. The aim of this study was to develop a simple and sensitive ultra-high-performance liquid chromatography-tandem mass spectrometric (UPLC-MS/MS) method for the simultaneous determination of NBP and its circulating metabolite 10-hydroxy-NBP in rat plasma using senkyunolide I as the internal standard (IS). The analytes and IS were extracted from the plasma by ethyl acetate-ethyl ether (1:5, v/v) and then separated on an ACQUITY BEH C18 column (2.1 × 50 mm, 1.7 µm). The mobile phase consisted of water containing 0.1% formic acid and acetonitrile containing 0.1% formic acid, which was delivered at a flow rate of 0.3 mL/min with gradient elution. MS detection was achieved under selective reaction monitoring mode with precursor-to-product transitions at m/z 191.1 > 145.1 for NBP, m/z 207.1 > 171.1 for 10-hydroxy-NBP and m/z 207.1 > 161.1 for IS, respectively. The assay showed excellent linearity over the concentration range of 0.5-1000 ng/mL for both analytes, with correlation coefficient greater than 0.998. The other validation parameters were all within the required limits. The validated UPLC-MS/MS method has been further applied to the pharmacokinetic study of NBP and 10-hydroxy-NBP in rats after they were orally administered with NBP (30 mg/kg).

A synonymous mutation in exon 39 of FBN1 causes exon skipping leading to Marfan syndrome.

Marfan syndrome is a heritable autosomal-dominant connective tissue disorder and it was typically caused by mutations in FBN1. However, the synonymous mutation was seldom recorded to be related to Marfan syndrome. Hereon, Multiplex ligation-dependent probe amplification failed to detect a copy number variant involving FBN1 but a synonymous mutation c.4773A > G (p.Gly1591Gly) was identified by NGS in exon 39. RNA was extracted from patient's aortic tissue and reverse polymerase chain reaction demonstrated the presence of a shortened mRNA transcript. Results of minigene models indicated that c.4773A > G was bona fide responsibility for the aberrant splicing pattern, and artificial mutations of c.4773A > C and c.4773A > T also gave rise to fragments with exon 39 entire skipped. Together, the novel synonymous mutations in c.4773 position (A > G, C, T), middle of exon 39 of FBN1 gene, was found to be associated with Marfan syndrome by altering the splicing pattern of pre-mRNA.

[Mutation analysis and prenatal diagnosis for a case of spinal muscular atrophy with respiratory distress type 1].

OBJECTIVE: To detect potential mutation of immunoglobulin µ -binding protein 2 (IGHMBP2) gene in a two-year-old patient with spinal muscular atrophy with respiratory distress type 1 (SMARD1). METHODS: Genomic DNA was extracted from peripheral blood sample from the patient and her parents, as well as cord blood sample from the fetus. Potential mutations of the coding region of the IGHMBP2 gene was detected with PCR and Sanger sequencing. RESULTS: A heterozygous missense mutation c.1060G>A and a frameshift mutation c.2356delG was detected in the patient. The mutations were respectively inherited from her father and mother. Neither mutation was found in DNA derived from the cord blood sample. CONCLUSION: The missense mutation c.1060G>A and frameshift mutation c.2356delG were probably causative for the disease. Analysis of the IGHMBP2 gene has provided an important clue for the etiology and prenatal diagnosis of SMARD1.

Identification of two novel large deletions in FBN1 gene by next-generation sequencing and multiplex ligation-dependent probe amplification.

BACKGROUND: Mutations in fibrillin-1 (FBN1) are known to be associated with Marfan syndrome (MFS), an autosomal dominant connective tissue disorder. Most FBN1 mutations are missense or nonsense mutations. Traditional molecular genetic testing for the FBN1 gene, like Sanger sequencing, may miss disease-causing mutations in the gene's regulatory regions or non-coding sequences, as well as partial or complete gene deletions and duplications. METHODS: Next-generation sequencing, multiplex ligation-dependent probe amplification and gap PCR were conducted on two MFS patients to screen for disease-causing mutations. RESULTS: We identified two large deletions in FBN1 from two MFS patients. One patient had a 0.23 Mb deletion (NC_000015.9:g.48550506_48779360del) including 5'UTR-exon6 of FBN1. The other patient harbored a 1416 bp deletion (NC_000015.9:g.48410869_48412284del) affecting the last exon, exon 66, of the FBN1 gene. CONCLUSION: Our results expanded the number of large FBN1 deletions and highlighted the importance of screening for large deletions in FBN1 in clinical genetic testing, especially for those with the classic MFS phenotype.

[Surface-enhanced Raman spectroscopic analysis of uric acid].

Based on Ag nanoparticles as the surface-enhanced Raman spectroscopy (SERS)-active nanostructure, the SERS of uric acid was presented in the paper. The absorption spectroscopies of uric acid and the mixture of silver colloids and uric acid were measured. The possible enhancing mechanism of the uric acid on silver colloid was speculated. The characteristic SERS bands of uric acid were tentatively assigned. The influence of absorption time and different ion on the SERS of uric acid were also discussed. The SERS spectral intensity changes linearly with the uric acid concentration, which indicated that the SERS might provide a new kind of direct and fast detecting method for the detection of uric acid. The detection limit of uric acid in silver sol is found to be 1 mg/L.

Corrigendum to "Comprehensive Humoral and Cellular Immune Responses to SARS-CoV-2 Variants in Diverse Chinese Population".

[This corrects the article DOI: 10.34133/2022/9873831.].

Comprehensive Humoral and Cellular Immune Responses to SARS-CoV-2 Variants in Diverse Chinese Population.

The SARS-CoV-2 variants have been emerging and have made great challenges to current vaccine and pandemic control strategies. It is urgent to understand the current immune status of various Chinese populations given that the preexisting immunity has been established by national vaccination or exposure to past variants. Using sera from 85 individuals (including 21 convalescents of natural infection, 15 cases which suffered a breakthrough infection after being fully vaccinated, and 49 healthy vaccinees), we showed significantly enhanced neutralizing activities against SRAS-CoV-2 variants in convalescent sera, especially those who had been fully vaccinated. The neutralizing antibodies against Omicron were detectable in 75% of convalescents and 44.9% of healthy vaccinees (p = 0.006), with a GMT of 289.5, 180.9-463.3, and 42.6, 31.3-59, respectively. However, the neutralizing activities were weaker in young convalescents (aged < 18 y), with a detectable rate of 50% and a GMT of 46.4 against Omicron. We also examined and found no pan-sarbecovirus neutralizing activities in vaccinated SARS-CoV-1 survivors. A booster dose could further increase the breadth and magnitude of neutralization against WT and variants of concern (VOCs) to different degrees. In addition, we showed that COVID-19-inactivated vaccines can elicit Omicron-specific T-cell responses. The positive rates of ELISpot reactions were 26.7% (4/15) and 43.8% (7/16) in the full vaccination group and the booster vaccination group, respectively, although without statistically significant difference. The neutralizing antibody titers declined while T-cell responses remain consistent over 6 months. These findings will inform the optimization of public health vaccination and intervention strategies to protect diverse populations against SARS-CoV-2 variants. Advances. Breakthrough infection significantly boosted neutralizing activities against SARS-CoV-2 variants as compared to booster immunization with inactivated vaccine. Vaccine-induced virus-specific T-cell immunity, on the other hand, may compensate for the shortfall. Furthermore, the public health system should target the most vulnerable group due to a poorer protective serological response in both infected and vaccinated adolescents.

Congenital Short-Bowel Syndrome Is Associated With a Novel Deletion Mutation in the CLMP Gene: Mutations in CLMP Caused CSBS.

Objective: To describe the clinical presentation and novel mutation in the coxsackie and adenovirus receptor-like membrane protein (CLMP) gene in a Chinese family with congenital short bowel syndrome (CSBS). Methods: We collected clinical data from a Chinese family with inherited CSBS, and performed whole exon sequencing of the children and their parents. The pathogenic sites of candidate genes were targeted, and the detected exon deletions were verified by quantitative PCR. Results: Two siblings in this family presented with bilious vomiting, and were diagnosed with CSBS on laparotomy. Two siblings and their parents underwent complete exome sequencing of the peripheral blood. Both children had CLMP gene exons 3-5 homozygous deletion mutation, while the parents had a heterozygous mutation. Conclusion: This study identified a novel mutation of the CLMP gene in a Chinese family with CSBS. Identification of this mutation can help with genetic counseling and prenatal diagnosis of CSBS.

Prognostic and diagnostic roles of prolyl 4-hydroxylase subunit α members in breast cancer.

Aim: We aimed to evaluate the diagnostic and prognostic values of P4HAs in breast cancer (BC) patients. Materials & methods: Kaplan-Meier plotter was used to evaluate the prognostic values of P4HAs and correlations between their expression and clinical characteristics were assessed based on The Cancer Genome Atlas and the Human Protein Atlas. Results: The current study showed that P4HAs were highly expressed in BC patients with clinical stage I compared with nontumor control and elevated P4HAs were correlated with poor survival outcomes. Subtypes analysis revealed that P4HA1 and P4HA2 were most expressed in HER2+ subtypes patients. Univariate analysis displayed that elevated P4HA1 and P4HA3 correlated with unfavorable recurrence-free survival in mutated TP53 patients. Conclusion: This study indicated the diagnostic and prognostic roles of P4HAs members and broadened the biomarker fields of early diagnosis and prognostic monitoring of BC patients.

[Two novel mutations of FBN1 gene in the patients with MFS among Han population].

To detect the mutations of fibrillin-1 (FBN1) gene in the patients with Marfan syndrome (MFS), polymerase chain reaction (PCR) and denaturing high-performance liquid chromatography (DHPLC) were conducted to screen for the mutations in FBN1 gene. Sequence analyses were carried out when the DNA amplification fragments of the DHPLC elution profiles showed difference from the corresponding normal elution profile. Two novel mutations were detected in two families with MFS, respectively. One was a multiplex mutation in exon 55 containing a deletion mutation c.6862_6871delGGCTGTGTAG (p.Gly2288MetfsX109), a synonymous mutation (c.6861A>G) and an intronic mutation c.[6871+1_6871+11delGTAAGAGGATC; 6871+34dupCATCAGAAGTGACAGTGGACA], and the other was a missense mutation in exon 20 c.2462G>A (p.Cys821Tyr). The results indicated that the deletion mutation c.[6862_6871delGGCTGT GTAG; 6871+1_6871+11delGTAAGAGGATC] (p.Gly2288MetfsX109) and the missense mutation c.2462G>A (p.Cys821Tyr) of FBN1 gene may cause the two family patients with MFS respectively.

[Inhibition of winter seedling raising in greenhouse of premature bolting in Angelica sinensis].

OBJECTIVE: To study the inhibition effect of winter seedling raising in sunlight-greenhouse on premature bolting of Angelica sinensis. METHOD: One factor of sowing date with 4 levels was tested at random design with 3 repeats. RESULT: Sowing date of winter seedling raising had an important effect on seedling growth, seedling mature, plant growth, premature bolting, yield, quality, and extreme significant effect on yield. The bolting date of winter raised seedlings started in middle of July, 50 d later than tranditional seedlings, and bolting peck date was in the last ten days of July, 40 d later than the traditional seedlings. The highest ratio of premature bolting for winter raised seedlings was 1%, and the lowest was 0. A. sinensis roots sowed in November 28 had the highest yield, root dry ratio, ethanol extract, essential oil and ferulic acid contents compared to that in other sowing dates. The best sowing time was from end of November to middle of December. CONCLUSION: Premature bolting of A. sinensis could be greatly inhibited by winter seedling raising, end of November to middle of December would be the best sowing time for winter seedling raising in greenhouse.

Identification of Potential Diagnostic and Prognostic Values of P4HA1 Expression in Lung Cancer, Breast Cancer, and Head and Neck Cancer.

The aims of this study were to investigate the expression of prolyl 4-hydroxylase subunit alpha-1 (P4HA1) and its relationship with clinicopathological features in lung cancer (LC), breast cancer (BC), and head and neck cancer (HNSC) and to discuss the possibility of P4HA1 being a potential diagnostic and prognostic biomarker. Data on the RNA expression profile, protein expression profile, and relevant clinical information were downloaded from The Cancer Genome Atlas (TCGA) and The Human Protein Atlas databases. The relationship between P4HA1 mRNA expression and clinicopathological features was evaluated. Survival analysis was performed to assess overall survival (OS) and relapse-free survival (RFS). The multivariate Cox regression model was employed to analyze the independent prognostic factors. Finally, protein-protein interaction networks were constructed and enrichment analysis was performed to identify the latent P4HA1-related terms and pathways. This study showed that P4HA1 was upregulated in three types of tumor tissues (p < 0.05) and high P4HA1 was significantly relevant to the clinical features of patients with LC, BC, or HNSC. Survival analysis indicated that patients with high P4HA1 had unfavorable clinical outcomes. Multivariate analysis showed that the high P4HA1 expression was an independent prognostic factor for poor OS and RFS in LC and HNSC patients. Bioinformatic analysis was performed to predict P4HA1-interacted proteins and further evaluate possible signal pathways. In the current study, the rising P4HA1 was identified in LC, BC, and HNSC and significantly correlated with the clinicopathological features of patients. High P4HA1, suggesting poor clinical outcomes, could be used as an early diagnostic and prognostic biomarker for patients with aforementioned tumors.

lncRNA-CYTOR Works as an Oncogene Through the CYTOR/miR-3679-5p/MACC1 Axis in Colorectal Cancer.

Pieces of evidence have shown that cytoskeleton regulator RNA (CYTOR), a long noncoding RNA (lncRNA), played a pivotal role in development and progression of a variety of cancers. In contrast, further research is needed to study the clinical significance and the detailed mechanism of action of lncRNA-CYTOR in colorectal cancer (CRC). This study aimed to investigate the clinical significance of CYTOR in CRC prognosis and identify the relevant potential signaling pathways and underlying mechanism of competing endogenous RNA. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) indicated that the expression of CYTOR was significantly elevated in CRC tumor tissues and cell lines. Aberrant expression of CYTOR was significantly related to TNM stage, T stage, N stage, and perineural and venous invasions. Survival analysis indicated that high-CYTOR expression was associated with poor overall survival in CRC patients (p = 0.0057), and multivariate analysis showed that high-CYTOR expression was an independent prognostic factor, which led to poor OS. In addition, bioinformatics analysis revealed that there were 18 microRNAs (miRNAs) interacted with CYTOR, and one of them, miR-3679-5p might collaborate with metastasis-associated in colon cancer-1 (MACC1), which was selected for further analysis. Pearson correlation analysis showed a significant positive correlation between the expression levels of CYTOR and MACC1. In conclusion, this study suggested that lncRNA-CYTOR played an important role in tumorigenesis and development through the CYTOR/miR-3679-5p/MACC1 axis.

Discovery and Validation of a Serologic Autoantibody Panel for Early Diagnosis of Esophageal Squamous Cell Carcinoma.

BACKGROUND: Esophageal squamous cell carcinoma (ESCC) accounts for the highest incidence rate worldwide and is responsible for the fourth leading cause of cancer-related death. Currently, serologic biomarkers for early ESCC diagnosis are needed for timely treatment. METHODS: The performance of a four-autoantibody panel (i.e., anti-TP53, HRAS, CTAG1A, and NSG1) was evaluated by ELISA for the early diagnosis of ESCC with 569 retrospective serum samples. A training set comprising 129 patients with early-stage ESCC, 130 patients with esophageal benign lesion (EBL), and 150 healthy controls (HC) was used to develop an early ESCC predictive model. Data obtained from an independent validation set were used to evaluate and validate the predictive model to distinguish the early ESCC from the controls (EBL+HC). Finally, a multiplexed assay based on the Luminex xMAP technology platform was developed to enable simultaneous detection of the four-autoantibody panel using the validation set. RESULTS: The four-autoantibody panel significantly discriminated early ESCC cases from the controls with 62.8% sensitivity at 88.9% specificity in the training set and with 58.0% sensitivity at 90.0% specificity in the independent validation set. The results of the multiplexed assay using xMAP technology for early ESCC showed a significant correlation with that of the ELISA assays with 66.0% sensitivity at 90.9% specificity. CONCLUSIONS: A four-autoantibody panel showed good performance for early ESCC diagnosis with ELISA and could be further developed into a multiplex assay using the Luminex xMAP technology. IMPACT: The four-autoantibody panel could be used for serologic screening for early ESCC.

[Mutations of ACVRL1 gene in a pedigree with hereditary hemorrhagic telangiectasia].

OBJECTIVE: To identify the activin A receptor type II-like 1 gene (ACVRL1) mutations in a Chinese family with hereditary hemorrhagic telangiectasia (HHT2). METHODS: The exons 3, 7 and 8 of ACVRL1 gene of the proband and her five family members were amplified by polymerase chain reaction (PCR), and the PCR products were sequenced. RESULTS: The proband had obvious telangiectasis of gastric mucosa, and small arteriovenous fistula in the right kidney. All the patients in the HHT2 family had iterative epistaxis or bleeding in other sites, and had telangiectasis of nasal mucosa, tunica mucosa oris and finger tips. ACVRL1 gene analysis confirmed that there is frameshift mutation caused by deletion of G145 in exon 3 in the 4 patients, but the mutation is absent in 2 members without HHT2. CONCLUSION: The HHT2 family is caused by a 145delG mutation of ACVRL1 gene, resulting in frameshift and a new stop codon at codon 53.

[Influence of humic acid fertilizer on biomass accumulation and quality of Angelica sinensis].

OBJECTIVE: To study the influence of humic acid fertilizer on plant growth, assimilation base, dried biomass accumulation, yield, quality and disease infection of Angelica sinensis. METHOD: Three kinds of humic acid fertilizer and an amino acid liquid fertilizer were tested in randomized groups at 1 level with 3 times repeat. RESULT: T1 promoted plant and root growth effectively, increased dried biomass accumulation and fresh root average weight remarkably, the yield was increased, the content of ethanol extract was increased by 11.31%. T3 promoted plant and root growth quickly, enlarged leaves area and increased dried plant weight, but effect lasted shortly, the content of ethanol extract was increased by 5.23%. T4 increased more leaves in late growth period, enlarged leaves area, the yield was increased, the content of ethanol extract was increased by 3.09%. T2 increased fresh root average weight remarkably, the yield was increased. CONCLUSION: Humic acid fertilizer and amino acid liquid fertilizer could effectively promote plant growth, enlarge leaves area, promote dried biomass accumulation and transformation to root and increase yield and content of ethanol extract effectively.

Expression of KLF6-SV2 in colorectal cancer and its impact on proliferation and apoptosis.

Kruppel like factor 6 (KLF6), a member of KLF family, which has classic zinc finger structure, is broadly considered to have anticancer activity. The role of SV2 variant, one of KLF6 alternative splicing isoforms has not yet been definite in the colorectal cancer. This study aimed to detect the expression of the KLF6-SV2 in colorectal cancer and investigate its impact on cell proliferation and apoptosis. qRT-PCR was used to quantitatively determine KLF6-SV2 mRNA expression in colorectal cancer samples, corresponding normal tissue, normal colonic mucosal cell line FHC and seven colorectal cancer cell lines. SW480 and SW620 cell models with over-expressing KLF6-SV2 were constructed. Cell proliferation, cell cycle and apoptosis were measured respectively using MTT assay, DNA ploidy detection and Annexin V flow cytometry. Meanwhile, expression of p53, p21 and Bax were detected by qRT-PCR and western blot. The mRNA expression level of KLF6-SV2 in colorectal cancer tissues (0.783±0.409) was decreased than in corresponding normal tissues (1.086±0.449) (P<0.01), and expression in SW480 and SW620 were lower than in FHC, HCT116, LoVo, HT29, Caco-2 and RKO. In cell lines over-expressing KLF6-SV2, cell proliferation was markedly suppressed, cell cycle was blocked and cell apoptosis was significantly induced. Simultaneously, expression of p21 and Bax were remarkably up-regulated, while p53 remained unchanged. Decreased expression of KLF6-SV2 may be associated with the occurrence and development of colorectal cancer. KLF6-SV2 plays a role as tumor suppressor by efficiently blocking cell proliferation, arresting cell cycle and inducing apoptosis in colorectal cancer, which may be related to increased expression of p21 and Bax.

[Two gene mutations in fibrillin 1 of Marfan syndrome].

OBJECTIVE: To detect novel mutations in the fibrillin 1 (FBN1) and transforming growth factor beta receptor type II (TGFBR2) genes by screening the genes from 14 patients with Marfan syndrome. METHODS: Denaturing high performance liquid chromatography (DHPLC) was introduced to screen for FBN1 and TGFBR2 mutations exon-by-exon. The DNA amplification fragments which DHPLC elution profiles showed different from the corresponding normal elution profile were sequenced to identify the positions and types of mutations. Restriction fragment length polymorphism (RFLP) was employed to further prove the mutations when needed. RESULTS: Two gene mutations of the FBN1 were found in the patients with Marfan syndrome. They were a novel substitutional mutation (Intron29 +4A > T) of FBN1 and a recurrent nonsense mutation (8080C >T) of FBN1. CONCLUSION: Intron29 +4A > T and 8080C > T of FBN1 are possibly the pathogenesis of the MFS patients.