The miR172/TOE3 module regulates resistance to tobacco mosaic virus in tobacco.

The outcome of certain plant-virus interaction is symptom recovery, which is accompanied with the emergence of asymptomatic tissues in which the virus accumulation decreased dramatically. This phenomenon shows the potential to reveal critical molecular factors for controlling viral disease. MicroRNAs act as master regulators in plant growth, development, and immunity. However, the mechanism by which miRNA participates in regulating symptom recovery remains largely unknown. Here, we reported that miR172 was scavenged in the recovered tissue of tobacco mosaic virus (TMV)-infected Nicotiana tabacum plants. Overexpression of miR172 promoted TMV infection, whereas silencing of miR172 inhibited TMV infection. Then, TARGET OF EAT3 (TOE3), an APETALA2 transcription factor, was identified as a downstream target of miR172. Overexpression of NtTOE3 significantly improved plant resistance to TMV infection, while knockout of NtTOE3 facilitated virus infection. Furthermore, transcriptome analysis indicated that TOE3 promoted the expression of defense-related genes, such as KL1 and MLP43. Overexpression of these genes conferred resistance of plant against TMV infection. Importantly, results of dual-luciferase assay, chromatin immunoprecipitation-quantitative PCR, and electrophoretic mobility shift assay proved that TOE3 activated the transcription of KL1 and MLP43 by binding their promoters. Moreover, overexpression of rTOE3 (the miR172-resistant form of TOE3) significantly reduced TMV accumulation compared to the overexpression of TOE3 (the normal form of TOE3) in miR172 overexpressing Nicotiana benthamiana plants. Taken together, our study reveals the pivotal role of miR172/TOE3 module in regulating plant immunity and in the establishment of recovery in virus-infected tobacco plants, elucidating a regulatory mechanism integrating plant growth, development, and immune response.

Enhanced Resistance to Viruses in Nicotiana edwardsonii 'Columbia' Is Dependent on Salicylic Acid, Correlates with High Glutathione Levels, and Extends to Plant-Pathogenic Bacteria and Abiotic Stress.

Our earlier research showed that an interspecific tobacco hybrid (Nicotiana edwardsonii 'Columbia' [NEC]) displays elevated levels of salicylic acid (SA) and enhanced resistance to localized necrotic symptoms (hypersensitive response [HR]) caused by tobacco mosaic virus (TMV) and tobacco necrosis virus (TNV), as compared with another interspecific hybrid (Nicotiana edwardsonii [NE]) derived from the same parents. In the present study, we investigated whether symptomatic resistance in NEC is indeed associated with the inhibition of TMV and TNV and whether SA plays a role in this process. We demonstrated that enhanced viral resistance in NEC is manifested as both milder local necrotic (HR) symptoms and reduced levels of TMV and TNV. The presence of an adequate amount of SA contributes to the enhanced defense response of NEC to TMV and TNV, as the absence of SA resulted in seriously impaired viral resistance. Elevated levels of subcellular tripeptide glutathione (GSH) in NEC plants in response to viral infection suggest that in addition to SA, GSH may also contribute to the elevated viral resistance of NEC. Furthermore, we found that NEC displays an enhanced resistance not only to viral pathogens but also to bacterial infections and abiotic oxidative stress induced by paraquat treatments. [Formula: see text] Copyright © 2024 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Fine mapping and identification of two NtTOM2A homeologs responsible for tobacco mosaic virus replication in tobacco (Nicotiana tabacum L.).

BACKGROUND: Tobacco mosaic virus (TMV) is a widely distributed viral disease that threatens many vegetables and horticultural species. Using the resistance gene N which induces a hypersensitivity reaction, is a common strategy for controlling this disease in tobacco (Nicotiana tabacum L.). However, N gene-mediated resistance has its limitations, consequently, identifying resistance genes from resistant germplasms and developing resistant cultivars is an ideal strategy for controlling the damage caused by TMV. RESULTS: Here, we identified highly TMV-resistant tobacco germplasm, JT88, with markedly reduced viral accumulation following TMV infection. We mapped and cloned two tobamovirus multiplication protein 2A (TOM2A) homeologs responsible for TMV replication using an F2 population derived from a cross between the TMV-susceptible cultivar K326 and the TMV-resistant cultivar JT88. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (CRISPR/Cas9)-mediated loss-of-function mutations of two NtTOM2A homeologs almost completely suppressed TMV replication; however, the single gene mutants showed symptoms similar to those of the wild type. Moreover, NtTOM2A natural mutations were rarely detected in 577 tobacco germplasms, and CRISPR/Cas9-mediated variation of NtTOM2A led to shortened plant height, these results indicating that the natural variations in NtTOM2A were rarely applied in tobacco breeding and the NtTOM2A maybe has an impact on growth and development. CONCLUSIONS: The two NtTOM2A homeologs are functionally redundant and negatively regulate TMV resistance. These results deepen our understanding of the molecular mechanisms underlying TMV resistance in tobacco and provide important information for the potential application of NtTOM2A in TMV resistance breeding.

Trans-complementation of the viral movement protein mediates efficient expression of large target genes via a tobacco mosaic virus vector.

The development of plant virus-based expression systems has expanded rapidly owing to their potential applications in gene functional and disease resistance research, and industrial production of pharmaceutical proteins. However, the low yield of certain proteins, especially high-molecular-mass proteins, restricts the production scale. In this study, we observed that the tobacco mosaic virus (TMV)-mediated expression of a foreign protein was correlated with the amount of the movement protein (MP) and developed a TMV-derived pAT-transMP vector system incorporating trans-complementation expression of MP. The system is capable of efficient expression of exogenous proteins, in particular those with a high molecular mass, and enables simultaneous expression of two target molecules. Furthermore, viral expression of competent CRISPR-Cas9 protein and construction of CRISPR-Cas9-mediated gene-editing system in a single pAT-transMP construct was achieved. The results demonstrated a novel role for TMV-MP in enhancing the accumulation of a foreign protein produced from the viral vector or a binary expression system. Further investigation of the mechanism underlying this role will be beneficial for optimization of plant viral vectors with broad applications.

In Vivo Delivery of Spherical and Cylindrical In Vitro Reconstituted Virus-like Particles Containing the Same Self-Amplifying mRNA.

The dramatic effectiveness of recent mRNA (mRNA)-based COVID vaccines delivered in lipid nanoparticles has highlighted the promise of mRNA therapeutics in general. In this report, we extend our earlier work on self-amplifying mRNAs delivered in spherical in vitro reconstituted virus-like particles (VLPs), and on drug delivery using cylindrical virus particles. In particular, we carry out separate in vitro assemblies of a self-amplifying mRNA gene in two different virus-like particles: one spherical, formed with the capsid protein of cowpea chlorotic mottle virus (CCMV), and the other cylindrical, formed from the capsid protein of tobacco mosaic virus (TMV). The mRNA gene is rendered self-amplifying by genetically fusing it to the RNA-dependent RNA polymerase (RdRp) of Nodamura virus, and the relative efficacies of cell uptake and downstream protein expression resulting from their CCMV- and TMV-packaged forms are compared directly. This comparison is carried out by their transfections into cells in culture: expressions of two self-amplifying genes, enhanced yellow fluorescent protein (EYFP) and Renilla luciferase (Luc), packaged alternately in CCMV and TMV VLPs, are quantified by fluorescence and chemiluminescence levels, respectively, and relative numbers of the delivered mRNAs are measured by quantitative real-time PCR. The cellular uptake of both forms of these VLPs is further confirmed by confocal microscopy of transfected cells. Finally, VLP-mediated delivery of the self-amplifying-mRNA in mice following footpad injection is shown by in vivo fluorescence imaging to result in robust expression of EYFP in the draining lymph nodes, suggesting the potential of these plant virus-like particles as a promising mRNA gene and vaccine delivery modality. These results establish that both CCMV and TMV VLPs can deliver their in vitro packaged mRNA genes to immune cells and that their self-amplifying forms significantly enhance in situ expression. Choice of one VLP (CCMV or TMV) over the other will depend on which geometry of nucleocapsid is self-assembled more efficiently for a given length and sequence of RNA, and suggests that these plant VLP gene delivery systems will prove useful in a wide variety of medical applications, both preventive and therapeutic.

TMV-CP based rational design and discovery of α-Amide phosphate derivatives as anti plant viral agents.

The tobacco mosaic virus coat protein (TMV-CP) is indispensable for the virus's replication, movement and transmission, as well as for the host plant's immune system to recognize it. It constitutes the outermost layer of the virus particle, and serves as an essential component of the virus structure. TMV-CP is essential for initiating and extending viral assembly, playing a crucial role in the self-assembly process of Tobacco Mosaic Virus (TMV). This research employed TMV-CP as a primary target for virtual screening, from which a library of 43,417 compounds was sourced and SH-05 was chosen as the lead compound. Consequently, a series of α-amide phosphate derivatives were designed and synthesized, exhibiting remarkable anti-TMV efficacy. The synthesized compounds were found to be beneficial in treating TMV, with compound 3g displaying a slightly better curative effect than Ningnanmycin (NNM) (EC50 = 304.54 µg/mL) at an EC50 of 291.9 µg/mL. Additionally, 3g exhibited comparable inactivation activity (EC50 = 63.2 µg/mL) to NNM (EC50 = 67.5 µg/mL) and similar protective activity (EC50 = 228.9 µg/mL) to NNM (EC50 = 219.7 µg/mL). Microscale thermal analysis revealed that the binding of 3g (Kd = 4.5 ± 1.9 µM) to TMV-CP showed the same level with NNM (Kd = 5.5 ± 2.6 µM). Results from transmission electron microscopy indicated that 3g could disrupt the structure of TMV virus particles. The toxicity prediction indicated that 3g was low toxicity. Molecular docking showed that 3g interacted with TMV-CP through hydrogen bond, attractive charge interaction and π-Cation interaction. This research provided a novel α-amide phosphate structure target TMV-CP, which may help the discovery of new anti-TMV agents in the future.

Design, synthesis and antiviral activity of indole derivatives containing quinoline moiety.

A series of indole derivatives containing quinoline structures were designed and synthesized. The synthesized compounds were characterized by NMR and HRMS. And W14 was performed by single crystal X-ray diffraction experiments. The antiviral activity studies showed that some of the target compounds possessed significant activity against tobacco mosaic virus (TMV). In particular, W20 had significant activity. The results of in vivo anti-TMV activity assay showed that W20 possessed the best curative and protective activities with EC50 values of 84.4 and 65.7 µg/mL, which were better than ningnanmycin (NNM) 205.1 and 162.0 µg/mL, respectively. The results of Microscale thermophoresis (MST) showed that W20 had a strong binding affinity for the tobacco mosaic virus coat protein (TMV-CP) with a dissociation constant (Kd) of 0.00519 µmol/L, which was superior to that of NNM (1. 65320 µmol/L). The molecular docking studies were in accordance with the experimental results. In addition, the determination of malondialdehyde (MDA) content in tobacco leaves showed that W20 improved the disease resistance of tobacco. Overall, this study shows that indole derivatives containing quinoline can be used as new antiviral agents for plant viruses for further research.

Antiviral activity evaluation and action mechanism of chalcone derivatives containing phenoxypyridine.

In this paper, a series of phenoxypyridine-containing chalcone derivatives (L1-L28) were designed and synthesized, characterized on NMR and HRMS. Ningnanmycin (NNM) was used as a control agent. The results of the antiviral activity testing showed that the curative activity EC50 values of L1 and L4 against TMV were 140.5 and 90.7 µg/mL, respectively, which were superior to that of NNM (148.3 µg/mL). The EC50 values of 154.1, 102.6 and 140.0 µg/mL for the anti-TMV protective activities of L1, L4 and L15 were superior to that of NNM (188.2 µg/mL). The mechanism of action between L4 and NNM and tobacco mosaic virus capsid protein (TMV-CP) was preliminarily investigated. The results of microscale thermophoresis (MST) experiments showed that L4 had a strong binding affinity for TMV-CP with a dissociation constant Kd value of 0.00149 µM, which was better than that of NNM (2.73016 µM). The results of molecular docking experiments showed that L4 formed shorter hydrogen bonds with amino acid residues of TMV-CP than NNM and formed more amino acid residues than NNM, which indicated that L4 was more tightly bound to TMV-CP. This study suggested that phenoxypyridine-containing chalcone derivatives can be used as new anti-TMV drugs through further research and development.

A highly sensitive fluorescence sensor for tobacco mosaic virus RNA based on DSN cycle and ARGET ATRP double signal amplification.

Early and sensitive detection of tobacco mosaic virus (TMV) is of great significance for improving crop yield and protecting germplasm resources. Herein, we constructed a novel fluorescence sensor to detect TMV RNA (tRNA) through double strand specific nuclease (DSN) cycle and activator regenerative electron transfer atom transfer radical polymerization (ARGET ATRP) dual signal amplification strategy. The hairpin DNA complementarily paired with tRNA was used as a recognition unit to specifically capture tRNA. By the double-stranded DNA hydrolyzed with DSN, tRNA is released to open more hairpin DNA, and more complementary DNA (cDNA) is bound to the surface of the magnetic beads (MBs) to achieve the first amplification. After binding with the initiator, the cDNA employed ARGET ATRP to attach more fluorescent signal molecules to the surface of MBs, thus achieving the second signal amplification. Under the optimal experimental conditions, the logarithm of fluorescence intensity versus tRNA concentration showed a good linear relationship in the range of 0.01-100 pM, with a detection limit of 1.03 fM. The limit of detection (LOD) was calculated according to LOD = 3 N/S. Besides, the sensor showed good reproducibility and stability, which present provided new method for early and highly sensitive detection for plant viruses.

One-Dimensional Rod-like Tobacco Mosaic Virus Promotes Macrophage Polarization for a Tumor-Suppressive Microenvironment.

The phenotype of tumor-associated macrophages plays an important role in their function of regulating the tumor immune microenvironment. The M1-phenotype macrophages display tumor-killing and immune activating functions. Here we show that the tobacco mosaic virus (TMV), a rod-like plant virus, can polarize macrophages to an M1 phenotype and shape a tumor-suppressive microenvironment. RAW 264.7 cells and bone marrow derived-macrophages (BMDMs) can recognize TMV via Toll-like receptor-4, and then the MAPK and NF-κB signaling pathways are activated, leading to the production of pro-inflammatory factors. Furthermore, the in vivo assessments on a subcutaneous co-injection tumor model show that the TMV-polarized BMDMs shape a tumor-suppressive microenvironment, resulting in remarkable delay of 4T1 tumor growth. Another in vivo assessment on an established tumor model indicates the high tumor-metastasis-inhibiting capacity of TMV-polarized BMDMs. This work suggests a role for this plant virus in macrophage-mediated therapeutic approaches and provides a strategy for tumor immunotherapy.

Strigolactones Negatively Regulate Tobacco Mosaic Virus Resistance in Nicotiana benthamiana.

Strigolactones (SLs) are plant hormones that regulate diverse developmental processes and environmental responses in plants. It has been discovered that SLs play an important role in regulating plant immune resistance to pathogens but there are currently no reports on their role in the interaction between Nicotiana benthamiana and the tobacco mosaic virus (TMV). In this study, the exogenous application of SLs weakened the resistance of N. benthamiana to TMV, promoting TMV infection, whereas the exogenous application of Tis108, a SL inhibitor, resulted in the opposite effect. Virus-induced gene silencing (VIGS) inhibition of two key SL synthesis enzyme genes, NtCCD7 and NtCCD8, enhanced the resistance of N. benthamiana to TMV. Additionally, we conducted a screening of N. benthamiana related to TMV infection. TMV-infected plants treated with SLs were compared to the control by using RNA-seq. The KEGG enrichment analysis and weighted gene co-expression network analysis (WGCNA) of differentially expressed genes (DEGs) suggested that plant hormone signaling transduction may play a significant role in the SL-TMV-N. benthamiana interactions. This study reveals new functions of SLs in regulating plant immunity and provides a reference for controlling TMV diseases in production.

Tobacco mosaic virus hijacks its coat protein-interacting protein IP-L to inhibit NbCML30, a calmodulin-like protein, to enhance its infection.

Calcium is an important plant immune signal that is essential for activating host resistance, but how RNA viruses manipulate calcium signals to promote their infections remains largely unknown. Here, we demonstrated that tobacco mosaic virus (TMV) coat protein (CP)-interacting protein L (IP-L) associates with calmodulin-like protein 30 (NbCML30) in the cytoplasm and nucleus, and can suppress its expression at the nucleic acid and protein levels. NbCML30, which lacks the EF-hand conserved domain and cannot bind to Ca2+ , was located in the cytoplasm and nucleus and was downregulated by TMV infection. NbCML30 silencing promoted TMV infection, while its overexpression inhibited TMV infection by activating Ca2+ -dependent oxidative stress in plants. NbCML30-mediated resistance to TMV mainly depends on IP-L regulation as the facilitation of TMV infection by silencing NbCML30 was canceled by co-silencing NbCML30 and IP-L. Overall, these findings indicate that in the absence of any reported silencing suppressor activity, TMV CP manipulates IP-L to inhibit NbCML30, influencing its Ca2+ -dependent role in the oxidative stress response. These results lay a theoretical foundation that will enable us to engineer tobacco (Nicotiana spp.) with improved TMV resistance in the future.

A chromosome scale tomato genome built from complementary PacBio and Nanopore sequences alone reveals extensive linkage drag during breeding.

The assembly and scaffolding of plant crop genomes facilitate the characterization of genetically diverse cultivated and wild germplasm. The cultivated tomato (Solanum lycopersicum) has been improved through the introgression of genetic material from related wild species, including resistance to pandemic strains of tobacco mosaic virus (TMV) from Solanum peruvianum. Here we applied PacBio HiFi and ONT Nanopore sequencing to develop independent, highly contiguous and complementary assemblies of an inbred TMV-resistant tomato variety. We show specific examples of how HiFi and ONT datasets can complement one another to improve assembly contiguity. We merged the HiFi and ONT assemblies to generate a long-read-only assembly where all 12 chromosomes were represented as 12 contiguous sequences (N50 = 68.5 Mbp). This chromosome scale assembly did not require scaffolding using an orthogonal data type. The merged assembly was validated by chromosome conformation capture data and is highly consistent with previous tomato genome assemblies that made use of genetic maps and Hi-C for scaffolding. Our long-read-only assembly reveals that a complex series of structural variants linked to the TMV resistance gene likely contributed to linkage drag of a 64.1-Mbp region of the S. peruvianum genome during tomato breeding. Through marker studies and ONT-based comprehensive haplotyping we show that this minimal introgression region is present in six cultivated tomato hybrid varieties developed in three commercial breeding programs. Our results suggest that complementary long read technologies can facilitate the rapid generation of near-complete genome sequences.

Facilitating viral vector movement enhances heterologous protein production in an established plant system.

Molecular farming technology using transiently transformed Nicotiana plants offers an economical approach to the pharmaceutical industry to produce an array of protein targets including vaccine antigens and therapeutics. It can serve as a desirable alternative approach for those proteins that are challenging or too costly to produce in large quantities using other heterologous protein expression systems. However, since cost metrics are such a critical factor in selecting a production host, any system-wide modifications that can increase recombinant protein yields are key to further improving the platform and making it applicable for a wider range of target molecules. Here, we report on the development of a new approach to improve target accumulation in an established plant-based expression system that utilizes viral-based vectors to mediate transient expression in Nicotiana benthamiana. We show that by engineering the host plant to support viral vectors to spread more effectively between host cells through plasmodesmata, protein target accumulation can be increased by up to approximately 60%.

Non-specific LIPID TRANSFER PROTEIN 1 enhances immunity against tobacco mosaic virus in Nicotiana benthamiana.

Plant non-specific lipid transfer proteins (nsLTPs) are small, cysteine-rich proteins that play significant roles in biotic and abiotic stress responses; however, the molecular mechanism of their functions against viral infections remains unclear. In this study, we employed virus-induced gene-silencing and transgenic overexpression to functionally analyse a type-I nsLTP in Nicotiana benthamiana, NbLTP1, in the immunity response against tobacco mosaic virus (TMV). NbLTP1 was inducible by TMV infection, and its silencing increased TMV-induced oxidative damage and the production of reactive oxygen species (ROS), compromised local and systemic resistance to TMV, and inactivated the biosynthesis of salicylic acid (SA) and its downstream signaling pathway. The effects of NbLTP1-silencing were partially restored by application of exogenous SA. Overexpressing NbLTP1 activated genes related to ROS scavenging to increase cell membrane stability and maintain redox homeostasis, confirming that an early ROS burst followed by ROS suppression at the later phases of pathogenesis is essential for resistance to TMV infection. The cell-wall localization of NbLTP1 was beneficial to viral resistance. Overall, our results showed that NbLTP1 positively regulates plant immunity against viral infection through up-regulating SA biosynthesis and its downstream signaling component, NONEXPRESSOR OF PATHOGENESIS-RELATED 1 (NPR1), which in turn activates pathogenesis-related genes, and by suppressing ROS accumulation at the later phases of viral pathogenesis.

High resolution imaging of viruses: Scanning probe microscopy and related techniques.

Scanning probe microscopy is a group of measurements that provides 3D visualization of viruses in different environmental conditions including liquids and air. Besides 3D topography it is possible to measure the properties like mechanical rigidity and stability, adhesion, tendency to crystallization, surface charge, etc. Choosing the right substrate and scanning parameters makes it much easier to obtain reliable data. Rational interpretation of experimental results should take into account possible artifacts, proper filtering and data presentation using specially designed software packages. Animal and human virus characterization is in the focus of many intensive studies because of their potential harm to higher organisms. The article focuses on high-resolution visualization of plant viruses. Tobacco mosaic virus, potato viruses X and B and others are not dangerous for the human being and are widely used in different applications such as vaccine preparation, construction of building units in nanotechnology and material science applications, nanoparticle production and delivery, and even metrology. The methods of virus's deposition, visualization, and consequent image processing and interpretation are described in details. Specific examples of viruses imaging are illustrated using the FemtoScan Online software, which has typical and all the necessary built-in functions for constructing three-dimensional images, their processing and analysis. Despite visible progress in visualizing the viruses using probe microscopy, many unresolved problems still remain. At present time the probe microscopy data on viruses is not systemized. There is no descriptive atlas of the images and morphology as revealed by this type of high resolution microscopy. It is worth emphasizing that new virus investigation methods will appear due to the progress of science.

MAP30 and luffin-α: Novel ribosome-inactivating proteins induce plant systemic resistance against plant viruses.

Ribosome-inactivating proteins (RIPs) are toxic N-glycosylase that act on eukaryotic and prokaryotic rRNAs, resulting in arrest protein synthesis. RIPs are widely found in higher plant species and display strong antiviral activity. Previous studies have shown that PAP and α-MMC have antiviral activity against TMV. However, the localization of RIPs in plant cells and the mechanism by which RIPs activate plant defense against several plant viruses remain unclear. In this study, we obtained four RIPs (the C-terminal deletion mutant of pokeweed antiviral proteins (PAP-c), alpha-momorcharin (α-MMC), momordica anti-HIV protein of 30 kDa (MAP30) and luffin-α). The subcellular localization results indicated that these four RIPs were located on the plant cell membrane. Heterologous expression of RIPs (PAP-c, α-MMC, MAP30, luffin-α) enhanced tobacco mosaic virus (TMV) resistance in N. benthamiana. Compared with the control treatment, these RIPs significantly reduced the TMV content (149-357 fold) and altered the movement of TMV in the leaves of N. benthamiana. At the same time, heterologous expression of RIPs (MAP30 and luffin-α) could relieve TMV-induced oxidative damage, significantly inducing the expression of plant defense genes including PR1 and PR2. Furthermore, application of these RIPs could inhibit the infection of turnip mosaic virus (TuMV) and potato virus x (PVX). Therefore, this study demonstrated that MAP30 and luffin-α could be considered as new, effective RIPs for controlling plant viruses by activating plant systemic defense.

First Report of Tobacco Mosaic Virus Infecting Bidens pilosa in China.

Bidens pilosa is an annual weed in family Asteraceae widely distributed in tropical and subtropical regions worldwide. It is also a natural host for at least five viruses including tomato spotted wilt orthotospovirus, tomato zonate spot orthotospovirus, pepper chlorotic spot orthotospovirus, Bidens mottle virus and Bidens mosaic virus, and therefore serve as a virus reservoir for various field crops (Yin et al. 2013; Xu et al. 2022; Wang et al. 2009). In August 2021, plants of B. pilosa displaying symptoms of chlorosis, mosaic and necrosis were observed surrounding a tobacco field in Kunming, Yunnan Province, China. Leaf samples were collected from four diseased B. pilosa plants and total nucleic acids were extracted using a CTAB based method (Li, R., et al. 2008). RT-PCR was carried out using virus-specific primers designed for the aforementioned five viruses as well as tobacco mosaic virus (TMV). The results indicated that none of the four samples tested positive for the 5 viruses, excepted for one sample, which produced an amplicon of the expected size (700 bp) with the TMV-specific primer pair of TMVF (CGGTCAGTGCCGAACAAGAA) and TMVR (TACGTGCCTGCGGATGTATATG). Cloning and sequencing the amplicon revealed a 717 nt fragment (accession no. OR136480) in the core cp region of TMV, showed the highest nt sequence identity of 99.6% with other TMV isolates (HE818450) in GenBank. TMV infection was also verified by dot-enzyme linked immunosorbent assay (DOT-ELISA) using antisera of TMV (Beijing Green Castle Agricultural Technology Co., Ltd.). To further confirm the TMV infection in B. pilosa plants, a TMV infectious clone (kindly provided by Dr. Fei Yan at Ningbo University, China) was inoculated into twelve healthy 3-week-old B. pilosa seedlings using Agrobacterium-mediated delivery. None of the inoculated B. pilosa plants exhibited distinct symptoms even at 30 days post-inoculation (dpi). Nevertheless, RT-PCR and Sanger sequencing results revealed that 2 of the inoculated B. pilosa plants were infected by TMV. The above results collectively indicate that TMV can infect B. pilosa under both natural and artificial conditions. However, it is possible that the symptoms observed on the diseased B. pilosa plants in the field may not be solely attributed to TMV but rather to the co-infection of TMV with other unidentified virus(es), which were not characterized in this study. TMV is considered one of the economically significant pathogens affecting crops such as tobacco (Nicotiana tabacum), pepper (Capsicum spp.), and tomato (Solanum lycopersicum). It is highly contagious and can be transmitted through various means, including seeds, soil and agricultural practice. B. pilosa is considered one of the most significant alien invasive weeds in China, mainly owing to its robust reproductive capacity. Furthermore, B. pilosa has the potential to act as a reservoir for various viruses that may affect field crops. The presence of TMV on B. pilosa plants may enhance the transmission efficiency of the virus in the field. Although TMV does not induce noticeable symptoms in B. pilosa, its presence on these plants could potentially increase the transmission efficiency of the virus in the field, posing a significant risk to field crops. Therefore, effective weed management and the diligent monitoring of TMV in B. pilosa should be recognized as essential sanitary practices for controlling viral diseases in field crops. To the best of our knowledge, this is the first report of TMV infecting B. pilosa in China.

Nicotiana benthamiana Class 1 Reversibly Glycosylated Polypeptides Suppress Tobacco Mosaic Virus Infection.

Reversibly glycosylated polypeptides (RGPs) have been identified in many plant species and play an important role in cell wall formation, intercellular transport regulation, and plant-virus interactions. Most plants have several RGP genes with different expression patterns depending on the organ and developmental stage. Here, we report on four members of the RGP family in N. benthamiana. Based on a homology search, NbRGP1-3 and NbRGP5 were assigned to the class 1 and class 2 RGPs, respectively. We demonstrated that NbRGP1-3 and 5 mRNA accumulation increases significantly in response to tobacco mosaic virus (TMV) infection. Moreover, all identified class 1 NbRGPs (as distinct from NbRGP5) suppress TMV intercellular transport and replication in N. benthamiana. Elevated expression of NbRGP1-2 led to the stimulation of callose deposition at plasmodesmata, indicating that RGP-mediated TMV local spread could be affected via a callose-dependent mechanism. It was also demonstrated that NbRGP1 interacts with TMV movement protein (MP) in vitro and in vivo. Therefore, class 1 NbRGP1-2 play an antiviral role by impeding intercellular transport of the virus by affecting plasmodesmata callose and directly interacting with TMV MP, resulting in the reduced viral spread and replication.

Novel 1,3,4-Thiadiazole Derivatives: Synthesis, Antiviral Bioassay and Regulation the Photosynthetic Pathway of Tobacco against TMV Infection.

Tobacco mosaic virus (TMV) is a systemic virus that poses a serious threat to crops worldwide. In the present study, a series of novel 1-phenyl-4-(1,3,4-thiadiazole-5-thioether)-1H-pyrazole-5-amine derivatives was designed and synthesized. In vivo antiviral bioassay results indicated that some of these compounds exhibited excellent protective activity against TMV. Among the compounds, E2 (EC50 = 203.5 µg/mL) was superior to the commercial agent ningnanmycin (EC50 = 261.4 µg/mL). Observation of tobacco leaves infected with TMV-GFP revealed that E2 could effectively inhibit the spread of TMV in the host. Further plant tissue morphological observation indicated that E2 could induce the tight arrangement and alignment of the spongy mesophyll and palisade cells while causing stomatal closure to form a defensive barrier to prevent viral infection in the leaves. In addition, the chlorophyll content of tobacco leaves was significantly increased after treatment with E2, and the net photosynthesis (Pn) value was also increased, which demonstrated that the active compound could improve the photosynthetic efficiency of TMV-infected tobacco leaves by maintaining stable chlorophyll content in the leaves, thereby protecting host plants from viral infection. The results of MDA and H2O2 content determination revealed that E2 could effectively reduce the content of peroxides in the infected plants, reducing the damage to the plants caused by oxidation. This work provides an important support for the research and development of antiviral agents in crop protection.