Case series: Fundus autofluorescence abnormalities in a family of ocular albinism carriers.

SIGNIFICANCE: Carriers of ocular albinism demonstrate signs of retinal mosaicism with unique features on fundus autofluorescence testing, which differentiate this condition from other x-linked retinal disorders in carrier patients. Distinctive findings include a mud-splattered fundus with peripheral hyperpigmented streaks, which correlate with areas of hyperautofluorescence and hypoautofluorescence. PURPOSE: This is the first reported case series of a family that demonstrates diagnostic retinal and fundus autofluorescence abnormalities related to retinal mosaicism in three sisters who were unaware they were carriers of ocular albinism type 1. Multimodal imaging, electrodiagnostic testing, and genetic testing can be used to confirm the diagnosis and differentiate this clinical presentation from other sight-threatening hereditary retinal diseases. CASE REPORTS: Three sisters, aged 21, 17, and 13 years, were referred to determine the cause of abnormal retinal pigmentation. All presented with normal vision, and anterior segment examination was unremarkable without iris transillumination. They denied family history of ocular disease. Fundus examination of all three sisters revealed a mud-splattered pattern of pigmentation in the posterior pole and radial pigmentary streaks. Fundus autofluorescence showed a pattern of hyperautofluorescence and hypoautofluorescence corresponding to this pigmentary pattern. Spectral domain optical coherence tomography, electro-oculogram, and electroretinogram were normal in all three sisters. Genetic testing of their father, who was unaware of any disorder, tested positive for ocular albinism. CONCLUSIONS: Ocular albinism carriers have abnormal retinal pigmentation in a characteristic pattern. Fundus autofluorescence shows a correlative pattern that can confirm carrier status of ocular albinism in individuals unaware of their status and rule out other retinal degenerations.

Aland Island Eye Disease with Retinoschisis in the Clinical Spectrum of CACNA1F-Associated Retinopathy-A Case Report.

Aland island eye disease (AIED), an incomplete form of X-linked congenital stationary night blindness (CSNB2A), and X-linked cone-rod dystrophy type 3 (CORDX3) display many overlapping clinical findings. They result from mutations in the CACNA1F gene encoding the α1F subunit of the Cav1.4 channel, which plays a key role in neurotransmission from rod and cone photoreceptors to bipolar cells. Case report: A 57-year-old Caucasian man who had suffered since his early childhood from nystagmus, nyctalopia, low visual acuity and high myopia in both eyes (OU) presented to expand the diagnostic process, because similar symptoms had occurred in his 2-month-old grandson. Additionally, the patient was diagnosed with protanomalous color vision deficiency, diffuse thinning, and moderate hypopigmentation of the retina. Optical coherence tomography of the macula revealed retinoschisis in the right eye and foveal hypoplasia in the left eye. Dark-adapted (DA) 3.0 flash full-field electroretinography (ffERG) amplitudes of a-waves were attenuated, and the amplitudes of b-waves were abolished, which resulted in a negative pattern of the ERG. Moreover, the light-adapted 3.0 and 3.0 flicker ffERG as well as the DA 0.01 ffERG were consistent with severely reduced responses OU. Genetic testing revealed a hemizygous form of a stop-gained mutation (c.4051C>T) in exon 35 of the CACNA1F gene. This pathogenic variant has so far been described in combination with a phenotype corresponding to CSNB2A and CORDX3. This report contributes to expanding the knowledge of the clinical spectrum of CACNA1F-related disease. Wide variability and the overlapping clinical manifestations observed within AIED and its allelic disorders may not be explained solely by the consequences of different mutations on proteins. The lack of distinct genotype-phenotype correlations indicates the presence of additional, not yet identified, disease-modifying factors.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Clinical and mutational characteristics of oculocutaneous albinism type 7.

The purpose of this paper is to expand on the phenotype of oculocutaneous albinism type 7 (OCA7). We described three patients with OCA7: two from a consanguineous family of Kurdish origin and one patient of Dutch origin. We compared them with all patients described to date in the literature. All newly described patients had severely reduced visual acuity (VA), nystagmus, hypopigmentation of the fundus, severe foveal hypoplasia, and chiasmal misrouting. None had iris translucency. All patients had normal pigmentation of skin and hair. We found one novel mutation in the Dutch patient: c.565G > A; p.(Gly189Ser). We compared our patients to the 15 described in the literature to date. All 18 patients had substantially pigmented skin and hair, very poor VA (0.4-1.3 logMAR), nystagmus, (mild) ocular hypopigmentation, foveal hypoplasia, and misrouting. Although pigmentation levels were mildly affected in OCA7, patients had a severe ocular phenotype with VA at the poorer end of the albinism spectrum, severe foveal hypoplasia, and chiasmal misrouting. OCA7 patients had a phenotype restricted to the eyes, and similar to that of X-linked ocular albinism. We therefore propose to rename the disorder in ocular albinism type 2. Unfolding the role of LRMDA in OCA7, may bring us a step closer in identifying the responsible factors for the co-occurrence of foveal hypoplasia and misrouting.

Nistagmo secundario a albinismo con compromiso ocular en paciente femenina: un desafío diagnóstico / Nystagmus secondary to albinism with ocular involvement in a female: a diagnostic challenge

INTRODUCCIÓN: El nistagmo infantil es infrecuente y representa un desafío diagnóstico para el pediatra. El albinismo es una de sus principales causas, siendo difícil de sospechar en ausencia de compromiso cutáneo evidente, especialmente en pacientes femeninas, debido a que tipo de herencia del albinismo ocular. OBJETIVO: Describir un caso de nistagmo secundario a albinismo con compromiso ocular aislado en paciente femenina, para discutir el enfoque diagnóstico pediátrico. CASO CLÍNICO: Paciente fe menino de 3 semanas de vida, sin antecedentes mórbidos, derivada a neuropediatra y oftalmólogo por movimientos oculares paroxísticos desde las 2 semanas, con estudio con electroencefalograma e imágenes cerebrales normales. A los 3 meses se confirmó translucencia iridiana, nistagmo y astigmatismo hipermetrópico. La valuación dermatológica descartó compromiso cutáneo. Evolucionó con inclinación cefálica hacia abajo y retraso del desarrollo de la coordinación, fue manejada con lentes de corrección y kinesioterapia. A los 3 años, destacaba mejoría de la agudeza visual, disminución del nistagmo y neurodesarrollo normal. La evaluación oftalmológica de ambos padres fue normal y no había antecedentes de nistagmo o albinismo en la familia. Por decisión de los padres no se realizó estudio genético. CONCLUSIÓN: El diagnóstico de nistagmo secundario a compromiso ocular del albinismo, aún en ausencia de afección cutánea, es clínico; el estudio genético permite confirmar la etiología, sin ser un examen imprescindible, a menos que se considere la planificación familiar. La pesquisa oportuna e intervención multidisciplinaria determinan un mejor pronóstico.

INTRODUCTION: Infantile nystagmus is an infrequent condition that represents a diagnostic challenge for the pediatri cian. Albinism is one of its main causes, being difficult to suspect in the absence of evident cutaneous involvement, especially in female patients, due to the inheritance type of ocular albinism. OBJECTIVE: To describe a case of nystagmus secondary to albinism with isolated ocular involvement in a female patient, in order to provide tools for pediatric approach and diagnosis. CLINICAL CASE: Three- weeks-old female patient, without morbid history, referred to a pediatric neurosurgeon and ophthal mologist due to paroxysmal eye movements since 2 weeks of age. The electroencephalogram and brain images were normal. In follow-up monitoring at 3 months, iris translucency, nystagmus, and hypermetropic astigmatism were confirmed. Dermatologic evaluation ruled out cutaneous invol vement. The patient developed cephalic downward inclination and coordination development de lay was confirmed, the patient was handled with corrective lenses and kinesiotherapy. In follow-up monitoring at 3 years, there was an improvement in visual acuity, decreased nystagmus and normal neurodevelopment. The ophthalmological evaluation of both parents was normal and there was no history of nystagmus or albinism in the family. Upon her parents' decision, no genetic study was ca rried out. CONCLUSION: The diagnosis of nystagmus secondary to ocular albinism, even in the absence of cutaneous involvement, is clinical. The genetic study allows confirming the etiology, without being an essential examination, unless family planning is considered. Timely research and multidisciplinary intervention determine a better prognosis.

Perfil do paciente albino com visão subnormal e melhoria da acuidade visual com a adaptação de recursos ópticos e/ou eletrônicos / Profile of albinism with low vision and improvement of visual acuity with the adaptation of optical and / or electronic resources

RESUMO Objetivo: Determinar o perfil do paciente albino no departamento de visão subnormal do Instituto Benjamin Constant. Ressaltar o tempo de acompanhamento, a frequência do seguimento, e a melhora visual com a adaptação de recursos ópticos e/ou eletrônicos. Métodos: Estudo retrospectivo com dados de 77 pacientes albinos com idade entre 1 a 53 anos de idade atendidos no Instituto Benjamin Constant, entre 2003 e 2014. Resultados: O recurso óptico mais adaptado foi o telescópio de Galilleu 2.8x. Todos os pacientes referiram ganho de visão com os equipamentos. A maioria dos pacientes apresentaram acuidade visual com recursos ópticos entre 20/25 e 20/160. Conclusão: Os recursos ópticos auxiliaram na melhora da função visual e na qualidade de vida dos pacientes com albinismo ocular.

ABSTRACT Objective: Determine the profile of albinism in Low Vision Department of Benjamin Constant Institute. Highlight the follow-up, the frequency of follow-up, and the visual improvement with the adaptation of optical and / or electronic resources . Methods: A retrospective study with data from 77 patients with ocular albinism aged 1- 53 years old attended at Benjamin Constant Institute between 2003 and 2014. Results: The most suitable optical feature is the telescope Galilleu 2.8x . All patients reported gain vision with the resources . Most patients experienced visual acuity with optical devices between 20/25 - 20/160 . Conclusion: Optical resources assisted in the improvement of visual function and quality of life of patients with ocular albinism.

Albinismo ocular con mutación en GPR143: hallazgos en autofluorescencia de campo amplio y tomografía de coherencia óptica / Ocular albinism with mutation in GPR143: Findings in wide-field autofluorescence and optical coherence tomography

Varón de 12 años que consulta por nistagmo y visión baja desde el nacimiento. Su madre también consulta por visión baja de ojo derecho desde pequeña que empeoró últimamente. El examen físico no reveló alteraciones en la pigmentación de piel y cabello. En el examen del segmento anterior del niño se observaron áreas de hipopigmentación circunferencial leve de iris en ambos ojos. El examen de fondo de ojo reveló un fondo coroideo por ausencia de melanina en el epitelio pigmentario retiniano. En la autofluorescencia se observa una ausencia de la hipoautofluorescencia macular fisiológica y en la tomografía de coherencia óptica se objetivó hipoplasia foveal en ambos ojos. En el examen de fondo de ojo de la madre se observaron cambios pigmentarios maculares tenues en el ojo derecho y unas manchas radiadas hiperpigmentadas en la periferia retiniana de ambos ojos que en la autofluorescencia de campo amplio se vieron hipoautofluorescentes. En la tomografía de coherencia óptica del ojo derecho se objetivó una cavitación de las capas externas retinianas en la fóvea. Se hace el estudio genético por secuenciación nucleotídica en madre e hijo y se encuentra una mutación en el gen GPR143: el niño fue hemicigote y la madre heterocigote. Se diagnostica albinismo ocular ligado a X y se realiza el aconsejamiento genético respectivo. El albinismo ocular ligado a X es la variante genética más frecuente de esta enfermedad. Si bien las alteraciones pigmentarias periféricas en las madres heterocigotas fueron descritas en la literatura previamente, no existen reportes de cavitaciones en las capas retinianas externas por tomografía de coherencia óptica

A 12 year-old boy who consulted due to nystagmus and low vision from birth. His mother also consulted for low vision of the right eye since she was a child, which worsened recently. The physical examination revealed no alterations in skin and hair pigmentation. In the examination of the anterior segment of the child, areas of slight circumferential hypopigmentation were observed in the iris in both eyes. The fundus examination revealed a choroidal fundus due to the absence of melanin in the retinal pigment epithelium. In the autofluorescence, an absence of physiological macular hypo-autofluorescence was observed and, in optical coherence tomography, foveal hypoplasia was observed in both eyes. In the ocular fundus examination of the mother, slight macular pigmentary changes were observed in the right eye, with hyperpigmented radiated spots in the retinal periphery of both eyes, which were hypo-autofluorescent in the wide-field autofluorescence. In the optical coherence tomography of the right eye, a cavitation of the outer retinal layers was observed in the fovea. The genetic study by nucleotide sequencing was performed on the mother and the child. In the mutation found in the GPR143 gene, the son was hemizygous and the mother was heterozygous. X-linked ocular albinism was diagnosed and the genetic counselling was carried out. Ocular albinism linked to X is the most frequent genetic variant of this disease. Peripheral pigment alterations in heterozygous mothers have been previously described in the literature, but there are no reports of cavitations in the external retinal layers using optical coherence tomography

Mellizas con albinismo oculocutáneo / Twins with oculocutaneous albinism

El albinismo oculocutáneo (AOC) comprende un grupo de trastornos de herencia autosómica recesiva, producidos por una alteración en la vía sintética de la melanina en la piel, el peloy los ojos. Clínicamente se caracteriza por lahipopigmentación cutánea, ocular y pilar, asociada a alteraciones oculares, como fotofobia severa, disminución de la agudeza visualynistagmo. El AOC tipo 1es producido por mutaciones en latirosinasa, enzima codificada por el genTYR (11q14-q21), habiéndose identificado más de 270 mutacioneshasta la fecha. Presentamos el caso de mellizasnacidas pretérmino, de 14 meses de vida, producto de un embarazo controlado, con AOC. Destacamos la escasa frecuencia de presentación de esta patología en pacientes mellizos.

Oculocutaneous albinism (OCA) is an autosomal recessive disorder caused by a defective synthesis of melanin in the skin, hair and eyes. It is clinically characterized by a generalized reduction of pigment in the skin, eyes and hair, associated with ocular alterations, as severe photosensitivity, reduced vision and nystagmus.The OCA type 1 is caused by mutations in the tyrosinase, enzyme that is codified by TYR (11q14-q21), with more than 270 mutations identified up to date. We report the case of preterm 14 month-olddizygotic females twinsfrom a controlled pregnancy, with OCA. We emphasize the low frequency of presentation of this disease in dizygotic twins.

Chediak-Higashi syndrome: Lessons from a single-centre case series

Background: Chediak-Higashi syndrome (CHS) is a rare and potentially fatal autosomal recessive disease characterized by frequent bacterial infections, bleeding tendency, oculocutaneous albinism, photosensitivity and progressive neurologic dysfunction. Owing to the rarity of this condition, the objective of this study was to describe patients with CHS. Methods: Retrospective evaluation of patients followed in a paediatric tertiary centre of Allergy and Immunology of São Paulo, Brazil, between 1986 and 2018 with a confirmed diagnosis of CHS. Data were obtained from medical records. Demographic aspects, family history, clinical findings, laboratory data, diagnosis, treatment and outcome were described. Results: A total of 14 patients (five male) were included. Clinical manifestations were first recognized at a median age of two months (at birth-20 months). Median age at diagnosis was 1.7 years (0-5 years). All patients had recurrent infections. Albinism was present in 13 patients and silvery or light hair was present in 14. Seven patients developed hemophagocytic lymphohistiocytosis (HLH); the median age at the diagnosis of HLH was 5.7 years (2.6-6.7 years) and the median interval between the diagnosis of CHS and HLH was 3.3 years (0-5 years). Four of the most recently diagnosed patients underwent bone marrow transplantation (BMT). Nine patients are deceased, and one was lost to follow-up. The median age of death was 6.7 years (3.8-22 years). Five patients died of HLH, one of lymphoma, and three of infection. All the patients who had HLH before the year of 2000 died of HLH. The two most recently diagnosed patients with HLH were able to cure the HLH, although they died of other causes. Four patients are alive, three of them after successful BMT. Conclusion: Thirty years of follow up showed an improvement in the prognosis in patients with CHS. The better understanding of the underlying biological mechanisms of HLH allowed the standardization of management protocols, resulting in survival improvement. BMT is the only treatment that can change CHS prognosis, which emphasizes the need for early identification of the disease

No disponible

Carcinoma espinocelular infiltrante de base de cráneo en paciente de 16 años con albinismo óculo-cutáneo / Squamous cell carcinoma infiltrating skull base in 16 years old patient with oculo-cutaneous albinism

Presentamos el caso de una adolescente africana de 16 años de edad afectada por albinismo óculo-cutáneo, que desarrolló un carcinoma epidermoide en pabellón auricular derecho que requirió escisión radical y reconstrucción con colgajo TRAM libre. El albinismo es un trastorno metabólico genético que consiste en la incapacidad hereditaria para sintetizar melanina. Tiene dos variantes clínicas: el albinismo ocular y el albinismo óculo-cutáneo. En determinados países africanos, los pacientes afectos por esta enfermedad son socialmente rechazados y por ello no se les presta un control sanitario adecuado. Por esta razón el tumor llevaba varios años de evolución y cuando la paciente fue vista en nuestro centro, existía una infiltración profunda con afectación severa de la base del cráneo. La compleja anatomía de las estructuras vitales en esta región hace que la resección quirúrgica de los tumores sea complicada. Comentamos las peculiaridades en la reconstrucción de casos complejos en la base lateral del cráneo con proyección a la zona temporal (AU)

We present a 16 year-old girl from Africa, affected by an oculo-cutaneous albinism, who developed a squamous cell carcinoma of the right ear that was treated by radical surgery and reconstructed with a free TRAM flap. Albinism is a genetic metabolic disease that is characterized by an impossibility to produce melanin. It presents two variations: ocular and oculo-cutaneous. In some african countries, patients affected by the disease are socially rejected and they do not receive right medical treatments. For this reason the tumor was infiltrating very deeply, affecting the cranial base when our patient was visited in our hospital. The complex anatomy of the vital structures in this area makes surgical resection of tumors involving the skull base extremely difficult. We review some concepts about the treatment of lateral and temporal skull base tumors (AU)

Albinismo ocular ligado ao Cromossomo X: Relato de uma família brasileira / X linked ocular albinism: Report of a brazilian family

O albinismo ocular de herança ligada ao cromossomo X é uma doença genética rara. Clinicamente os homens apresentam-se com nistagmo, fotofobia, baixa acuidade visual e hipopigmentação generalizada do epitélio pigmentar retiniano com hipoplasia macular. Portadoras femininas (heterozigotas) são assintomática e podem apresentar defeitos de transiluminação irianos e fundos em mosaico (Mud Splattered). Relatou-se a primeira família brasileira descrita em literatura indexada. São cinco pacientes de uma mesma família (três homens e duas mulheres) com caracteristicas clínicas de albinismo ocular do tipo 1 incluindo defeitos de transiluminação iriano e fundos retiniano em mosaico. Enfatiza-se o fato de que uma das mulheres relatadas apresenta aspecto fundoscópico albino, que é raramente descrito, semelhante aos descritos para os pacientes do sexo masculino

Albinism and Hermansky-Pudlak syndrome in Puerto Rico

Five types of oculocutaneous albinism and two types of ocular albinism were found among 349 Puerto Rican albinos. The most prevalent type of albinism was the Hermansky-Pudlak syndrome (HPS). HPS was observed in five of every six albinos in Puerto Rico. The prevalence of HPS was highest in the northwestern quarter of the island, affecting approximately one in 1,800 persons, and approximately one in 22 are carriers of the gene. HPS is an autosomal recessively inherited triad of a tyrosinase-positive type of albinism, a hemorrhagic diathesis due to storage pool deficient platelets and accumulation of ceroid in tissues. The pigmentary phenotype of HPS albinos resembled that of any other type of oculocutaneous or ocular albinism. The most reliable method of diagnosing HPS is by a deficiency of platelet dense bodies observed by electron microscopy. The accumulation of ceroid in the tissues is associated with fibrotic restrictive lung disease and granulomatous enteropathic disease. The enteropathic disorder resembles Crohn's disease and with few exceptions, had its onset after 13 years of age. The major causes of death were fibrotic restrictive pulmonary disease, hemorrhagic episodes and sequelae of granulomatous enteropathic disease. Menometrorrhagia was common in women with HPS. No immune deficiency was found in HPS patients. The majority of patients with HPS had visal acuities of 20/200 or worse and consequently were legally blind. Albinos of all types, including HPS, lacked binocular...

La electrofisiología como diagnóstico diferencial entre albinismo ocular ligado al sexo y nystagmus central / Electrophysiology in the differential diagnosis between 'x-linked' ocular albinism and central nystagmus

Objetivo: Puede resultar sorprendente el hecho de que un porcentaje no inferior al 20 por ciento de los nistagmos idiopáticos 'centrales' son casos de albinismo ocular con herencia recesiva ligada al sexo (AOX) no diagnosticados. Hemos estudiado tres generaciones de una familia afecta de AOX para determinar el valor diagnóstico del estudio clínico, electrofisiológico e histológico. Nuestro objetivo se centró en valorar el protocolo de PEV más adecuado para el estudio de estos casos. Métodos: La metodología incluye el estudio clínico y oftalmológico de 36 personas pertenecientes a 3 generaciones de una familia, incluyendo fotografía de iris por transiluminación, fotografía de fondo de ojo, biopsia de piel y un sistema idóneo para el registro de los PEV. Resultados: Los resultados del estudio muestran que la fotografía del iris y las máculas son relevantes, así como la biopsia. En nuestra experiencia, la prueba concluyente son los PEV (realizados con flash cromático y acromático con electrodos situados a 3 y 6 cm de la línea media) en los que se aprecia la asimetría interhemisférica. Conclusiones: La exploración clínica puede ser insuficiente para el diagnóstico, la biopsia orienta el diagnóstico pero no es patognomónica y la electrofisiología ocular (PEV-flash) es la clave del método, aunque la sistemática de su registro técnico sigue siendo controvertida (AU)