An improved tetracycline-inducible expression system for fission yeast.

The ability to manipulate gene expression is valuable for elucidating gene function. In the fission yeast Schizosaccharomyces pombe, the most widely used regulatable expression system is the nmt1 promoter and its two attenuated variants. However, these promoters have limitations, including a long lag, incompatibility with rich media, and unsuitability for non-dividing cells. Here, we present a tetracycline-inducible system free of these shortcomings. Our system features the enotetS promoter, which achieves a similar induced level and a higher induction ratio compared to the nmt1 promoter, without exhibiting a lag. Additionally, our system includes four weakened enotetS variants, offering an expression range similar to the nmt1 series promoters but with more intermediate levels. To enhance usability, each promoter is combined with a Tet-repressor-expressing cassette in an integration plasmid. Importantly, our system can be used in non-dividing cells, enabling the development of a synchronous meiosis induction method with high spore viability. Moreover, our system allows for the shutdown of gene expression and the generation of conditional loss-of-function mutants. This system provides a versatile and powerful tool for manipulating gene expression in fission yeast.

An operator-based expression toolkit for Bacillus subtilis enables fine-tuning of gene expression and biosynthetic pathway regulation.

SignificanceA gene regulatory system is an important tool for the engineering of biosynthetic pathways of organisms. Here, we report the development of an inducible-ON/OFF regulatory system using a malO operator as a key element. We identified and modulated sequence, position, numbers, and spacing distance of malO operators, generating a series of activating or repressive promoters with tunable strength. The stringency and robustness are both guaranteed in this system, a maximal induction factor of 790-fold was achieved, and nine proteins from different organisms were expressed with high yields. This system can be utilized as a gene switch, promoter enhancer, or metabolic valve in synthetic biology applications. This operator-based engineering strategy can be employed for developing similar regulatory systems in different microorganisms.

An expanded genetic toolkit for inducible expression and targeted gene silencing in Rickettsia parkeri.

Pathogenic species within the Rickettsia genus are transmitted to humans through arthropod vectors and cause a spectrum of diseases ranging from mild to life-threatening. Despite rickettsiae posing an emerging global health risk, the genetic requirements of their infectious life cycles remain poorly understood. A major hurdle toward building this understanding has been the lack of efficient tools for genetic manipulation, owing to the technical difficulties associated with their obligate intracellular nature. To this end, we implemented the Tet-On system to enable conditional gene expression in Rickettsia parkeri. Using Tet-On, we show inducible expression of antibiotic resistance and a fluorescent reporter. We further used this inducible promoter to screen the ability of R. parkeri to express four variants of the catalytically dead Cas9 (dCas9). We demonstrate that all four dCas9 variants can be expressed in R. parkeri and used for CRISPR interference (CRISPRi)-mediated targeted gene knockdown. We show targeted knockdown of an antibiotic resistance gene as well as the endogenous virulence factor sca2. Altogether, we have developed systems for inducible gene expression and CRISPRi-mediated gene knockdown for the first time in rickettsiae, laying the groundwork for more scalable, targeted mechanistic investigations into their infectious life cycles.IMPORTANCEThe spotted fever group of Rickettsia contains vector-borne pathogenic bacteria that are neglected and emerging threats to public health. Due to the obligate intracellular nature of rickettsiae, the development of tools for genetic manipulation has been stunted, and the molecular and genetic underpinnings of their infectious lifecycle remain poorly understood. Here, we expand the genetic toolkit by introducing systems for conditional gene expression and CRISPR interference (CRISPRi)-mediated gene knockdown. These systems allow for relatively easy manipulation of rickettsial gene expression. We demonstrate the effectiveness of these tools by disrupting the intracellular life cycle using CRISPRi to deplete the sca2 virulence factor. These tools will be crucial for building a more comprehensive and detailed understanding of rickettsial biology and pathogenesis.

A heat-inducible expression system for external control of gene expression in plastids.

Inducible expression systems can overcome the trade-off between high-level transgene expression and its pleiotropic effects on plant growth. In addition, they can facilitate the expression of biochemical pathways that produce toxic metabolites. Although a few inducible expression systems for the control of transgene expression in plastids have been developed, they all depend on chemical inducers and/or nuclear transgenes. Here we report a temperature-inducible expression system for plastids that is based on the bacteriophage λ leftward and rightward promoters (pL/pR) and the temperature-sensitive repressor cI857. We show that the expression of green fluorescent protein (GFP) in plastids can be efficiently repressed by cI857 under normal growth conditions, and becomes induced over time upon exposure to elevated temperatures in a light-dependent process. We further demonstrate that by introducing into plastids an expression system based on the bacteriophage T7 RNA polymerase, the temperature-dependent accumulation of GFP increased further and was ~24 times higher than expression driven by the pL/pR promoter alone, reaching ~0.48% of the total soluble protein. In conclusion, our heat-inducible expression system provides a new tool for the external control of plastid (trans) gene expression that is cost-effective and does not depend on chemical inducers.

Using Euf1 transcription factor as a titrator of erythritol-inducible promoters in Yarrowia lipolytica; insight into the structure, splicing, and regulation mechanism.

Controllable regulatory elements, like inducible, titratable promoters, are highly desired in synthetic biology toolboxes. A set of previously developed erythritol-inducible promoters along with an engineered Yarrowia lipolytica host strain were shown to be a very potent expression platform. In this study, we push the previously encountered limits of the synthetic promoters' titratability (by the number of upstream motifs) by using a compatible transcription factor, Euf1, as the promoter titrator. Overexpression of spliced EUF1 turned out to be very efficient in promoting expression from the compatible promoter, however, the erythritol-inducible character of the promoter was then lost. Analysis of the EUF1's splicing pattern suggests that the intron removal is promoted in the presence of erythritol, but is not dependent on it. The 3D structures of spliced versus unspliced Euf1 were modeled, and ligand-binding strength was calculated and compared. Furthermore, the EUF1-dependent expression profile under different chemical stimulants was investigated. Depletion of carbon source was identified as the significant factor upregulating the expression from the Euf1-dependent promoter (2-10-fold). Considering these findings and transcriptomics data, a new mechanism of the Euf1-regulated promoter action is proposed, involving a 'catabolite repression' transcription factor-Adr1, both acting on the same ERY-inducible promoter.

Unlocking Nature's Toolbox: glutamate-inducible recombinant protein production from the Komagatella phaffii PEPCK promoter.

BACKGROUND: Komagataella phaffii (a.k.a. Pichia pastoris) harbors a glutamate utilization pathway in which synthesis of glutamate dehydrogenase 2 and phosphoenolpyruvate carboxykinase (PEPCK) is induced by glutamate. Glutamate-inducible synthesis of these enzymes is regulated by Rtg1p, a cytosolic, basic helix-loop-helix protein. Here, we report food-grade monosodium glutamate (MSG)-inducible recombinant protein production from K. phaffii PEPCK promoter (PPEPCK) using green fluorescent protein (GFP) and receptor binding domain of SARS-CoV-2 virus (RBD) as model proteins. RESULTS: PPEPCK-RBD/GFP expression cassette was integrated at two different sites in the genome to improve recombinant protein yield from PPEPCK. The traditional, methanol-inducible alcohol oxidase 1 promoter (PAOX1) was used as the benchmark. Initial studies carried out with MSG as the inducer resulted in low recombinant protein yield. A new strategy employing MSG/ethanol mixed feeding improved biomass generation as well as recombinant protein yield. Cell density of 100-120 A600 units/ml was achieved after 72 h of induction in shake flask cultivations, resulting in recombinant protein yield from PPEPCK that is comparable or even higher than that from PAOX1. CONCLUSIONS: We have designed an induction medium for recombinant protein production from K. phaffii PPEPCK in shake flask cultivations. It consists of 1.0% yeast extract, 2.0% peptone, 0.17% yeast nitrogen base with ammonium sulfate, 100 mM potassium phosphate (pH 6.0), 0.4 mg/L biotin, 2.0% MSG, and 2% ethanol. Substitution of ammonium sulphate with 0.5% urea is optional. Carbon source was replenished every 24 h during 72 h induction period. Under these conditions, GFP and RBD yields from PPEPCK equaled and even surpassed those from PAOX1. Compared to the traditional methanol-inducible expression system, the inducers of glutamate-inducible expression system are non-toxic and their metabolism does not generate toxic metabolites such as formaldehyde and hydrogen peroxide. This study sets the stage for MSG-inducible, industrial scale recombinant protein production from K. phaffii PPEPCK in bioreactors.

Evaluating the Biological Role of Lassa Viral Z Protein-Mediated RIG-I Inhibition Using a Replication-Competent Trisegmented Pichinde Virus System in an Inducible RIG-IN Expression Cell Line.

Lassa virus (LASV) is a mammarenavirus that can cause lethal Lassa fever disease with no FDA-approved vaccine and limited treatment options. Fatal LASV infections are associated with innate immune suppression. We have previously shown that the small matrix Z protein of LASV, but not of a nonpathogenic arenavirus Pichinde virus (PICV), can inhibit the cellular RIG-I-like receptors (RLRs), but its biological significance has not been evaluated in an infectious virus due to the multiple essential functions of the Z protein required for the viral life cycle. In this study, we developed a stable HeLa cell line (HeLa-iRIGN) that could be rapidly and robustly induced by doxycycline (Dox) treatment to express RIG-I N-terminal effector, with concomitant production of type I interferons (IFN-Is). We also generated recombinant tri-segmented PICVs, rP18tri-LZ, and rP18tri-PZ, which encode LASV Z and PICV Z, respectively, as an extra mScarlet fusion protein that is nonessential for the viral life cycle. Upon infection, rP18tri-LZ consistently expressed viral genes at a higher level than rP18tri-PZ. rP18tri-LZ also showed a higher level of a viral infection than rP18tri-PZ did in HeLa-iRIGN cells, especially upon Dox induction. The heterologous Z gene did not alter viral growth in Vero and A549 cells by growth curve analysis, while LASV Z strongly increased and prolonged viral gene expression, especially in IFN-competent A549 cells. Our study provides important insights into the biological role of LASV Z-mediated RIG-I inhibition and implicates LASV Z as a potential virulence factor. IMPORTANCE Lassa virus (LASV) can cause lethal hemorrhagic fever disease in humans but other arenaviruses, such as Pichinde virus (PICV), do not cause obvious disease. We have previously shown that the Z protein of LASV but not of PICV can inhibit RIG-I, a cytosolic innate immune receptor. In this study, we developed a stable HeLa cell line that can be induced to express the RIG-I N-terminal effector domain, which allows for timely control of RIG-I activation. We also generated recombinant PICVs encoding LASV Z or PICV Z as an extra gene that is nonessential for the viral life cycle. Compared to PICV Z, LASV Z could increase viral gene expression and viral infection in an infectious arenavirus system, especially when RIG-I signaling is activated. Our study presented a convenient cell system to characterize RIG-I signaling and its antagonists and revealed LASV Z as a possible virulence factor and a potential antiviral target.

Repressing expression of difficult-to-express recombinant proteins during the selection process increases productivity of CHO stable pools.

More than half of licensed therapeutic recombinant proteins (r-proteins) are manufactured using constitutively-expressing, stably-transfected Chinese hamster ovary (CHO) clones. While constitutive CHO expression systems have proven their efficacy for the manufacturing of monoclonal antibodies, many next-generation therapeutics such as cytokines and bispecific antibodies as well as biological targets such as ectodomains of transmembrane receptors remain intrinsically challenging to produce. Herein, we exploited a cumate-inducible CHO platform allowing reduced expression of various classes of r-proteins during selection of stable pools. Following stable pool generation, fed-batch productions showed that pools generated without cumate (OFF-pools) were significantly more productive than pools selected in the presence of cumate (ON-pools) for 8 out of the 10 r-proteins tested, including cytokines, G-protein coupled receptors (GPCRs), the HVEM membrane receptor ectodomain, the multifunctional protein High Mobility Group protein B1 (HMGB1), as well as monoclonal and bispecific T-cell engager antibodies. We showed that OFF-pools contain a significantly larger proportion of cells producing high levels of r-proteins and that these cells tend to proliferate faster when expression is turned off, suggesting that r-protein overexpression imposes a metabolic burden on the cells. Cell viability was lower and pool recovery was delayed during selection of ON-pools (mimicking constitutive expression), suggesting that high producers were likely lost or overgrown by faster-growing, low-producing cells. We also observed a correlation between the expression levels of the GPCRs with Binding immunoglobulin Protein, an endoplasmic reticulum (ER) stress marker. Taken together, these data suggest that using an inducible system to minimize r-protein expression during stable CHO pool selection reduces cellular stresses, including ER stress and metabolic burden, leading to pools with greater frequency of high-expressing cells, resulting in improved volumetric productivity.

A copper switch for inducing CRISPR/Cas9-based transcriptional activation tightly regulates gene expression in Nicotiana benthamiana.

BACKGROUND: CRISPR-based programmable transcriptional activators (PTAs) are used in plants for rewiring gene networks. Better tuning of their activity in a time and dose-dependent manner should allow precise control of gene expression. Here, we report the optimization of a Copper Inducible system called CI-switch for conditional gene activation in Nicotiana benthamiana. In the presence of copper, the copper-responsive factor CUP2 undergoes a conformational change and binds a DNA motif named copper-binding site (CBS). RESULTS: In this study, we tested several activation domains fused to CUP2 and found that the non-viral Gal4 domain results in strong activation of a reporter gene equipped with a minimal promoter, offering advantages over previous designs. To connect copper regulation with downstream programmable elements, several copper-dependent configurations of the strong dCasEV2.1 PTA were assayed, aiming at maximizing activation range, while minimizing undesired background expression. The best configuration involved a dual copper regulation of the two protein components of the PTA, namely dCas9:EDLL and MS2:VPR, and a constitutive RNA pol III-driven expression of the third component, a guide RNA with anchoring sites for the MS2 RNA-binding domain. With these optimizations, the CI/dCasEV2.1 system resulted in copper-dependent activation rates of 2,600-fold and 245-fold for the endogenous N. benthamiana DFR and PAL2 genes, respectively, with negligible expression in the absence of the trigger. CONCLUSIONS: The tight regulation of copper over CI/dCasEV2.1 makes this system ideal for the conditional production of plant-derived metabolites and recombinant proteins in the field.

Plasmids for Controlled and Tunable High-Level Expression in E. coli.

Controlled gene expression is crucial for engineering bacteria for basic and applied research. Inducible systems enable tight regulation of expression, wherein a small-molecule inducer causes the transcription factor to activate or repress transcriptional initiation. The T7 expression system is one of the most widely used inducible systems, particularly for high overexpression of proteins. However, it is well known that the highly active T7 RNA polymerase (RNAP) has several drawbacks, including toxicity to the host and substantial leaky expression in the absence of an inducer. Much work has been done to address these issues; current solutions require special strains or additional plasmids, making the system more complicated and less accessible. Here, we challenge the assumption that the T7 expression system is the best choice for obtaining high protein titers. We hypothesized that expression from strong inducible promoters expressed from high-copy plasmids could compete with expression levels obtained from T7 RNAP but that such promoters would possess improved control of transcription. Employing inducible systems from a toolbox we developed previously, we demonstrate that our plasmids consistently give higher outputs and greater fold changes over basal expression than the T7 system across rich and minimal media. In addition, we show that they outperformed the T7 system when we used an engineered metabolic pathway to produce lycopene. IMPORTANCE Genetic systems for protein overexpression are required tools in microbiological and biochemical research. Ideally, these systems include standardized genetic parts with predictable behavior, enabling the construction of stable expression systems in the host organism. Modularity of a genetic system is advantageous, so that the expression system can be easily moved into a host that best suits the needs of a given experiment. The T7 expression system lacks both predictability and stability and requires special host strains to function. Despite these limitations, it remains one of the most popular systems for protein overproduction. This study directly compared the T7 system to four inducible systems from our broad-host-range plasmid toolbox and demonstrated these alternative expression systems have distinct advantages over the T7. The systems are entirely plasmid-based and not constrained to a specific bacterial host, expanding the options for high-level protein expression across strains.

High-level production of wild-type and oxidation-resistant recombinant alpha-1-antitrypsin in glycoengineered CHO cells.

Alpha-1-antitrypsin (A1AT) is a serine protease inhibitor which blocks the activity of serum proteases including neutrophil elastase to protect the lungs. Its deficiency is known to increase the risk of pulmonary emphysema as well as chronic obstructive pulmonary disease. Currently, the only treatment for patients with A1AT deficiency is weekly injection of plasma-purified A1AT. There is still today no commercial source of therapeutic recombinant A1AT, likely due to significant differences in expression host-specific glycosylation profile and/or high costs associated with the huge therapeutic dose needed. Accordingly, we aimed to produce high levels of recombinant wild-type A1AT, as well as a mutated protein (mutein) version for increased oxidation resistance, with N-glycans analogous to human plasma-derived A1AT. To achieve this, we disrupted two endogenous glycosyltransferase genes controlling core α-1,6-fucosylation (Fut8) and α-2,3-sialylation (ST3Gal4) in CHO cells using CRISPR/Cas9 technology, followed by overexpression of human α-2,6-sialyltransferase (ST6Gal1) using a cumate-inducible expression system. Volumetric A1AT productivity obtained from stable CHO pools was 2.5- to 6.5-fold higher with the cumate-inducible CR5 promoter compared to five strong constitutive promoters. Using the CR5 promoter, glycoengineered stable CHO pools were able to produce over 2.1 and 2.8 g/L of wild-type and mutein forms of A1AT, respectively, with N-glycans analogous to the plasma-derived clinical product Prolastin-C. Supplementation of N-acetylmannosamine to the cell culture media during production increased the overall sialylation of A1AT as well as the proportion of bi-antennary and disialylated A2G2S2 N-glycans. These purified recombinant A1AT proteins showed in vitro inhibitory activity equivalent to Prolastin-C and substitution of methionine residues 351 and 358 with valines rendered A1AT significantly more resistant to oxidation. The recombinant A1AT mutein bearing an improved oxidation resistance described in this study could represent a viable biobetter drug, offering a safe and more stable alternative for augmentation therapy.

Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression.

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was "ACTTAGTTTAAGCAATAGACAAAGT", and this can be degenerated to "ACTTWGTTTAWSSNATAVACAAAGT" in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

[Gene cloning, induction, and prokaryotic expression of a Sm14-3-3 protein from Salvia miltiorrhiza].

14-3-3 proteins are important proteins in plants, as they regulate plant growth and development and the response to biotic or abiotic stresses. In this study, a 14-3-3 gene(GenBank accession: OM683281) was screened from the cDNA library of the medicinal species Salvia miltiorrhiza by yeast two-hybrid and cloned. The open reading frame(ORF) was 780 bp, encoding 259 amino a cids. Bioinformatics analysis predicted that the protein was a non-transmembrane protein with the molecular formula of C_(1287)H_(2046)N_(346)O_(422)S_9, relative molecular weight of 29.4 kDa, and no signal peptide. Homologous sequence alignment and phylogenetic tree analysis proved that the protein belonged to 14-3-3 family and had close genetic relationship with the 14-3-3 proteins from Arabidopsis thaliana, Oryza sativa, and Nicotiana tabacum. The 14-3-3 gene was ligated to the prokaryotic expression vector pGEX-4 T-1 and then transformed into Escherichia coli BL21 for the expression of recombinant protein. Real-time fluorescent quantitative PCR showed that the expression of this gene was different among roots, stems, leaves, and flowers of S. miltiorrhiza. To be specific, the highest expression was found in leaves, followed by stems, and the lowest expression was detected in flowers. S. miltiorrhiza plants were treated with 15% PEG(simulation of drought), and hormones salicylic acid, methyl jasmonate, and ethephon, respectively, and the expression of 14-3-3 gene peaked at the early stage of induction. Therefore, the gene can quickly respond to abiotic stresses such as drought and plant hormone treatments such as salicylic acid, jasmonic acid, and ethylene. This study lays the foundation for revealing the molecular mechanism of 14-3-3 protein regulating tanshinone biosynthesis and responding to biotic and abiotic stresses.

ALD1 accumulation in Arabidopsis epidermal plastids confers local and non-autonomous disease resistance.

The Arabidopsis plastid-localized ALD1 protein acts in the lysine catabolic pathway that produces infection-induced pipecolic acid (Pip), Pip derivatives, and basal non-Pip metabolite(s). ALD1 is indispensable for disease resistance associated with Pseudomonas syringae infections of naïve plants as well as those previously immunized by a local infection, a phenomenon called systemic acquired resistance (SAR). Pseudomonas syringae is known to associate with mesophyll as well as epidermal cells. To probe the importance of epidermal cells in conferring bacterial disease resistance, we studied plants in which ALD1 was only detectable in the epidermal cells of specific leaves. Local disease resistance and many features of SAR were restored when ALD1 preferentially accumulated in the epidermal plastids at immunization sites. Interestingly, SAR restoration occurred without appreciable accumulation of Pip or known Pip derivatives in secondary distal leaves. Our findings establish that ALD1 has a non-autonomous effect on pathogen growth and defense activation. We propose that ALD1 is sufficient in the epidermis of the immunized leaves to activate SAR, but basal ALD1 and possibly a non-Pip metabolite(s) are also needed at all infection sites to fully suppress bacterial growth. Thus, epidermal plastids that contain ALD1 play a key role in local and whole-plant immune signaling.

An efficient inducible RPE-Selective cre transgenic mouse line.

Cre-mediated modulation of gene function in the murine retinal pigment epithelium (RPE) has been widely used, but current postnatal RPE-selective Cre driver lines suffer from limited recombination efficiency and/or ectopic or mosaic expression. We sought to generate a transgenic mouse line with consistently efficient RPE-selective Cre activity that could be temporally regulated. We used ϕC31 integrase to insert a DNA construct encoding a human BEST1 promoter fragment driving a Cre recombinase estrogen receptor fusion (BEST1-CreERT2) at the Rosa26 locus of C57BL/6J mice. Rosa26BEST1-CreERT2 mice were bred with a tdTomato reporter line and to mice with a Cre-conditional allele of Tfam. 4-hydroxytamoxifen or vehicle was delivered by four consecutive daily intraperitoneal injections. TdTomato was robustly expressed in the RPE of mice of both sexes for inductions beginning at P14 (males 90.7 ± 4.5%, females 84.7 ± 3.2%) and at 7 weeks (males 84.3 ± 7.0%, females 82 ± 3.6%). <0.6% of Muller glia also expressed tdTomato, but no tdTomato fluorescence was observed in other ocular cells or in multiple non-ocular tissues, with the exception of sparse foci in the testis. No evidence of retinal toxicity was observed in mice homozygous for the transgene induced beginning at P14 and assessed at 7-10 months. RPE-selective ablation of Tfam beginning at P14 led to reduced retinal thickness at 8 months of age and diminished retinal electrical responses at 12 months, as expected. These findings demonstrate that we have generated a mouse line with consistently efficient, tamoxifen-mediated postnatal induction of Cre recombination in the RPE and a small fraction of Muller glia. This line should be useful for temporally regulated modulation of gene function in the murine RPE.

Rapid screening of high expressing Escherichia coli colonies using a novel dicistronic-autoinducible system.

BACKGROUND: Identification of high-expressing colonies is one of the main concerns in the upstream process of recombinant protein development. The common method to screen high-producing colonies is SDS-PAGE, a laborious and time-consuming process, which is based on a random and qualitative way. The current study describes the design and development of a rapid screening system composed of a dicistronic expression system containing a reporter (enhanced green fluorescent protein, eGFP), protein model (staphylokinase, SAK), and a self-inducible system containing heat shock protein 27 (Hsp27). RESULTS: Dicistronic-autoinducible system expressed eGFP and SAK successfully in 5-ml and 1-L culture volumes. High expressing colonies were identified during 6 h via fluorescent signals. In addition, the biological activity of the protein model was confirmed semi-quantitatively and quantitatively through radial caseinolytic and chromogenic methods, respectively. There was a direct correlation between eGFP fluorescent intensity and SAK activity. The correlation and linearity of expression between the two genes were respectively confirmed with Pearson correlation and linear regression. Additionally, the precision, limit of detection (LOD), and limit of quantification (LOQ) were determined. The expression of eGFP and SAK was stable during four freeze-thaw cycles. In addition, the developed protocol showed that the transformants can be inoculated directly to the culture, saving time and reducing the error-prone step of colony picking. CONCLUSION: The developed system is applicable for rapid screening of high-expressing colonies in most research laboratories. This system can be investigated for other recombinant proteins expressed in E. coli with a potential capability for automation and use at larger scales.

Spatiotemporally controlled induction of gene expression in vivo allows tracking the fate of tumor cells that traffic through the lymphatics.

Metastasis is a multistep process, during which circulating tumor cells traffic through diverse anatomical locations. Stable inducible marking of tumor cells in a manner that is tightly spatially and temporally controlled would allow tracking the contribution of cells passing through specific locations to metastatic dissemination. For example, tumor cells enter the lymphatic system and can form metastases in regional lymph nodes, but the relative contribution of tumor cells that traffic through the lymphatic system to the formation of distant metastases remains controversial. Here, we developed a novel genetic switch based on mild transient warming (TW) that allows cells to be marked in a defined spatiotemporal manner in vivo. Prior to warming, cells express only EGFP. Upon TW, the EGFP gene is excised and expression of mCherry is permanently turned on. We employed this system in an experimental pancreatic cancer model and used localized TW to induce the genetic switch in tumor cells trafficking through tumor-draining lymph nodes. Thereby we found that tumor cells disseminating via the lymphatics make a major contribution to the seeding of lung metastases. The inducible genetic marking system we have developed is a powerful tool for the tracking of metastasizing cells in vivo.

Expression of a fungal exo-ß-1,3-galactanase in Arabidopsis reveals a role of type II arabinogalactans in the regulation of cell shape.

Arabinogalactan-proteins (AGPs) are a family of plant extracellular proteoglycans implicated in many physiological events. AGP is decorated with type II arabinogalactans (AGs) consisting of a ß-1,3-galactan backbone and ß-1,6-galactan side chains, to which other sugars are attached. Based on the fact that a type II AG-specific inhibitor, ß-Yariv reagent, perturbs growth and development, it has been proposed that type II AGs participate in the regulation of cell shape and tissue organization. However, the mechanisms by which type II AGs participate have not yet been established. Here, we describe a novel system that causes specific degradation of type II AGs in Arabidopsis, by which a gene encoding a fungal exo-ß-1,3-galactanase that specifically hydrolyzes ß-1,3-galactan backbones of type II AGs is expressed under the control of a dexamethasone-inducible promoter. Dexamethasone treatment increased the galactanase activity, leading to a decrease in Yariv reagent-reactive AGPs in transgenic Arabidopsis. We detected the typical oligosaccharides released from type II AGs by Il3GAL in the soluble fraction, demonstrating that Il3GAL acted on type II AG in the transgenic plants. Additionally, this resulted in severe tissue disorganization in the hypocotyl and cotyledons, suggesting that the degradation of type II AGs affected the regulation of cell shape.

Estradiol-inducible AvrRps4 expression reveals distinct properties of TIR-NLR-mediated effector-triggered immunity.

Plant nucleotide-binding domain, leucine-rich repeat receptor (NLR) proteins play important roles in recognition of pathogen-derived effectors. However, the mechanism by which plant NLRs activate immunity is still largely unknown. The paired Arabidopsis NLRs RRS1-R and RPS4, that confer recognition of bacterial effectors AvrRps4 and PopP2, are well studied, but how the RRS1/RPS4 complex activates early immediate downstream responses upon effector detection is still poorly understood. To study RRS1/RPS4 responses without the influence of cell surface receptor immune pathways, we generated an Arabidopsis line with inducible expression of the effector AvrRps4. Induction does not lead to hypersensitive cell death response (HR) but can induce electrolyte leakage, which often correlates with plant cell death. Activation of RRS1 and RPS4 without pathogens cannot activate mitogen-associated protein kinase cascades, but still activates up-regulation of defence genes, and therefore resistance against bacteria.

Improved pEKEx2-derived expression vectors for tightly controlled production of recombinant proteins in Corynebacterium glutamicum.

The Escherichia coli/Corynebacterium glutamicum shuttle vector pEKEx2 is an IPTG-inducible expression vector that has been used successfully for the synthesis of numerous proteins in C. glutamicum. We discovered that the leaky gene expression observed for pEKEx2-derived plasmids relates to reduced functionality of the plasmid-encoded repressor LacI carrying a modified C-terminus, while duplicate DNA sequences in the pEKEx2 backbone contribute to plasmid instability. We constructed the pEKEx2-derivatives pPBEx2 and pPREx2, which harbor a restored lacI gene and which lack the unnecessary duplicate DNA sequences. pPREx2 in addition enables fusion of target genes to a C-terminal Strep-tag II coding region for easy protein detection and purification. In the absence of inducer, the novel vectors exhibit tight gene repression in C. glutamicum, as shown for the secretory production of Fusarium solani pisi cutinase and the cytosolic production of green fluorescent protein and C. glutamicum myo-inositol dehydrogenase. Undesired heterogeneity amongst clones expressing cutinase from pEKEx2 was attributed to the loss of a vector fragment containing the cutinase gene, which likely occurred via homologous recombination of the identical flanking DNA sequences. Such loss was not observed for pPBEx2. Using pPREx2, IolG-Strep was successfully produced and purified to homogeneity by Strep-Tactin affinity chromatography, obtaining 1.5 mg IolG with a specific activity of 27 µmol·min-1·(mg protein)-1 from 100 mL culture. The tight gene repression in the absence of inducer and the improved plasmid stability make expression vectors pPBEx2/pPREx2 attractive alternatives to the available molecular tools for genetic manipulation and high-level production of recombinant proteins in C. glutamicum.