AIMS: The incidence of nonalcoholic fatty liver disease (NAFLD) is increasing annually, leading to substantial medical and health burdens. Numerous studies have demonstrated the potential effectiveness of intestinal probiotics as a treatment strategy for NAFLD. Therefore, the objective of this study is to identify a probiotic for the treatment of NAFLD. METHODS AND RESULTS: In this study, blood and fecal samples were collected from 41 healthy volunteers and 44 patients diagnosed with NAFLD. Analysis of the 16S rDNA sequencing data and quantitative real-time PCR (RT-qPCR) revealed a significant reduction in the abundance of Coprococcus in NAFLD patients. Subsequent animal experiments demonstrated that Coprococcus was able to effectively reverse liver lipid accumulation, inflammation, and fibrosis induced by a high-fat diet (HFD) in mice. CONCLUSIONS: This study provides the first in vivo evidence that Coprococcus is a beneficial bacterium capable of preventing NAFLD and has the same probiotic effect in mice as Lactobacillus GG (LGG), a positive control. Therefore, Coprococcus has the potential to serve as a probiotic for the prevention and treatment of NAFLD in humans.
Diet, High-Fat , Non-alcoholic Fatty Liver Disease , Probiotics , Animals , Non-alcoholic Fatty Liver Disease/prevention & control , Non-alcoholic Fatty Liver Disease/microbiology , Non-alcoholic Fatty Liver Disease/etiology , Diet, High-Fat/adverse effects , Probiotics/pharmacology , Probiotics/therapeutic use , Mice , Humans , Male , Mice, Inbred C57BL , Feces/microbiology , Feces/chemistry , Adult , Female , Liver/metabolism , Gastrointestinal Microbiome , Middle Aged , Disease Models, Animal
BACKGROUND: Postpartum hypogalactia (PH) is prominent during lactation and may negatively impact the mother's or infant's health. Acupuncture is widely used to increase maternal breast milk production. However, the effects of acupuncture on PH remain unclear. Therefore, this review aimed to evaluate the efficacy and safety of acupuncture in individuals with PH. MATERIALS AND METHODS: Articles on potentially eligible randomized controlled trials (RCTs) on acupuncture for PH published from database inception to October 2023 were retrieved from the PubMed, Web of Science, Cochrane Library, EMBASE, EBSCO, Scopus, China National Knowledge Infrastructure, Chinese Biomedical Literature Database, WanFang, and VIP databases. Two reviewers independently screened the records, extracted essential information, and evaluated the methodological quality of the RCTs using the revised Cochrane risk-of-bias (RoB) tool. The primary outcome was a change in serum prolactin (PRL) levels before and after treatment. Secondary outcomes included milk secretion volume (MSV), total effective rate (TER), mammary fullness degree (MFD), and exclusive breastfeeding rate (EBR). Meta-analyses were performed using RevMan v5.4. Finally, the quality of evidence was evaluated using the Grading of Recommendations, Assessment, Development, and Evaluation tool. RESULTS: This study included 19 RCTs involving 2,400 participants. The included studies were classified as having an unclear to high RoB. Our findings indicated that, overall, acupuncture showed a significant effect in increasing serum PRL levels (standardized mean differences [SMDs] = 1.09, 95% confidence interval [CI]: 0.50, 1.68), MSV (SMD = 1.69, 95% CI: 0.53, 2.86), TER (relative risk [RR] = 1.25, 95% CI: 1.10, 1.42), and EBR (RR = 2.01, 95% CI: 1.07, 3.78) compared to that in the control group; however, no difference in MFD (SMD = 1.17, 95% CI: -0.09, 2.42) was observed. In the subgroup analysis, acupuncture combined with Chinese herbs or conventional treatment was significantly more effective in increasing serum PRL levels, MSV, and TER than did Chinese herbs or conventional treatment alone. Moreover, acupuncture alone resulted in significantly higher serum PRL levels compared to Chinese herbs; however, this benefit was not observed for TER and MFD. The quality of evidence was critically low. CONCLUSION: Acupuncture may effectively increase milk secretion in women with PH. However, owing to the low quality of evidence, further rigorously designed studies are warranted to confirm our findings.
Acupuncture Therapy , Postpartum Period , Randomized Controlled Trials as Topic , Humans , Acupuncture Therapy/methods , Acupuncture Therapy/adverse effects , Female , Lactation , Prolactin/blood , Breast Feeding , Treatment Outcome , Galactorrhea/therapy , Milk, Human
N6-methyladenosine (m6A) is the most prevalent modification in cellular RNA which orchestrates diverse physiological and pathological processes during stress response. However, the differential m6A modifications that cope with herbivore stress in resistant and susceptible crop varieties remain unclear. Here, we found that rice stem borer (RSB) larvae grew better on indica rice (e.g., MH63, IR64, Nanjing 11) than on japonica rice varieties (e.g., Nipponbare, Zhonghua 11, Xiushui 11). Then, transcriptome-wide m6A profiling of representative resistant (Nipponbare) and susceptible (MH63) rice varieties were performed using a nanopore direct RNA sequencing approach, to reveal variety-specific m6A modifications against RSB. Upon RSB infestation, m6A methylation occurred in actively expressed genes in Nipponbare and MH63, but the number of methylation sites decreased across rice chromosomes. Integrative analysis showed that m6A methylation levels were closely associated with transcriptional regulation. Genes involved in herbivorous resistance related to mitogen-activated protein kinase, jasmonic acid (JA), and terpenoid biosynthesis pathways, as well as JA-mediated trypsin protease inhibitors, were heavily methylated by m6A, and their expression was more pronounced in RSB-infested Nipponbare than in RSB-infested MH63, which may have contributed to RSB resistance in Nipponbare. Therefore, dynamics of m6A modifications act as the main regulatory strategy for expression of genes involved in plant-insect interactions, which is attributed to differential responses of resistant and susceptible rice varieties to RSB infestation. These findings could contribute to developing molecular breeding strategies for controlling herbivorous pests.
Both the 3-fluorooxindole and germinal bisphosphonate structural motifs are prevalent in bioactive molecules because of their associated biological activities. We describe an approach to accessing 3,3-disubstituted 3-fluorooxindoles bearing a geminal bisphosphate fragment through a highly enantioselective Michael addition reaction between 3-fluorooxindoles and vinylidene bisphosphonates. These reactions are catalyzed by a commercially available cinchona alkaloid catalyst, have a broad substrate scope concerning 3-fluorooxindoles, and provide the corresponding addition products in a yield of up to 95% with an enantiomeric excess of up to 95%. A reasonable reaction pathway to explain the observed stereochemistry is also proposed.
Purpose: This study aimed to investigate the cognitive evaluation level of ICU nurses in Guizhou Province, China, on the sensitivity indicators of nursing quality for ECMO patients. Patients and Methods: This was a cross-sectional observational study conducted in Guizhou Province, China, from May to July 2023, 259 ICU nurses were surveyed. Objective sampling method was used to select the participants from 10 hospitals in Guizhou Province that carried out ECMO. Data were collected through questionnaire survey. Two researchers checked and recorded Epidata 3.1. SPSS 25.0 was used for statistical analysis of the data, and frequency, mean and component ratio were used for descriptive statistical analysis. The importance rating was used to reflect the degree of nurses' agreement with the indicators. Results: The results of this study showed that 79.1% of the 253 ICU nurses in Guizhou Province, China, had not participated in training and courses related to indicators of quality of care evaluation for ECMO patients. The main way for ICU nurses to acquire knowledge related to indicators of quality of care sensitivity for ECMO patients was departmental training, which accounted for 87.4%. And the other ways, in descending order, were public, the matic lectures or academic conferences, journals and magazines; their evaluation scores of the importance of most of the quality of care sensitivity indicators for ECMO patients was moderate, with the scores ranging from 73 to 150. Among them, the range of importance evaluation scores for each indicator was 4.01 ~ 4.48. Conclusion: The overall cognitive evaluation of ICU nurses in Guizhou Province, China, on most sensitivity indicators of quality of care for ECMO patients was moderate, and there is a general lack of systematic courses and training on the knowledge related to ECMO care quality sensitive indicators.
Cell mechanics are pivotal in regulating cellular activities, diseases progression, and cancer development. However, the understanding of how cellular viscoelastic properties varying in physiological and pathological stimuli remains scarce. Here, we develop a hybrid self-similar hierarchical theory-microrheology approach to accurately and efficiently characterize cellular viscoelasticity. Focusing on two key cell types associated with livers fibrosis - the capillarized liver sinusoidal endothelial cells (cLSEC) and activated hepatic stellate cells (aLX-2) - we uncover a universal two-stage power-law rheology characterized by two distinct exponents αshort and αlong. The mechanical profiles derived from both exponents exhibit significant potential for discriminating among diverse cells. This finding suggests a potential common dynamic creep characteristic across biological systems, extending our earlier observations in soft tissues. Using a tailored hierarchical model for cellular mechanical structures, we discern significant variations in the viscoelastic properties and their distribution profiles across different cell types and states from the cytoplasm (elastic stiffness E1 and viscosity η), to a single cytoskeleton fiber (elastic stiffness E2), and then to the cell level (transverse expansion stiffness E3). Importantly, we construct a logistic regression based-machine learning (ML) model using the dynamic parameters outperforms conventional cell stiffness-based classifiers in assessing cell states, achieving an area under the curve (AUC) of 97% vs. 78%. Our findings not only advance a robust framework for monitoring intricate cell dynamics but also highlight the crucial role of cellular viscoelasticity in discerning cell states across a spectrum of liver diseases and prognosis, offering new avenues for developing diagnostic and therapeutic strategies based on cellular viscoelasticity.
Activated hepatic stellate cells (HSCs) have been widely recognized as a primary source of pathological myofibroblasts, leading to the accumulation of extracellular matrix and liver fibrosis. CD47, a transmembrane glycoprotein expressed on the surface of various cell types, has been implicated in non-alcoholic fatty liver disease. However, the precise role of CD47 in HSC activation and the underlying regulatory mechanisms governing CD47 expression remain poorly understood. In this study, we employed single-cell RNA sequencing analysis to investigate CD47 expression in HSCs from mice subjected to a high-fat diet. CD47 silencing in HSCs markedly inhibited the expression of fibrotic genes and promoted apoptosis. Mechanistically, we found that Yes-associated protein (YAP) collaborates with TEAD4 to augment the transcriptional activation of CD47 by binding to its promoter region. Notably, disruption of the interaction between YAP and TEAD4 caused a substantial decrease in CD47 expression in HSCs and reduced the development of high-fat diet-induced liver fibrosis. Our findings highlight CD47 as a critical transcriptional target of YAP in promoting HSC activation in response to a high-fat diet. Targeting the YAP/TEAD4/CD47 signaling axis may hold promise as a therapeutic strategy for liver fibrosis.
BACKGROUND AND AIMS: Metabolic dysfunction-associated steatotic liver disease (MASLD) represents the foremost cause of chronic liver disease, yet its underlying mechanisms remain elusive. Our group previously discovered a novel long non-coding RNA (lncRNA) in rats, termed lncHC and its human counterpart, LNCHC. This study aimed to explore the role of LNCHC in the progression of MASLD. METHODS: RNA-binding proteins bound to LNCHC were searched by mass spectrometry. The target genes of LNCHC and Y-Box binding protein 1 (YBX1) were identified by RNA-seq. MASLD animal models were utilised to examine the roles of LNCHC, YBX1 and patatin-like phospholipase domain containing 3 (PNPLA3) in MASLD progression. RESULTS: Here, we identified LNCHC as a native restrainer during MASLD development. Notably, LNCHC directly binds YBX1 and prevents protein ubiquitination. Up-regulation of YBX1 then stabilises PNPLA3 mRNA to alleviate lipid accumulation in hepatocytes. Furthermore, both cell and animal studies demonstrate that LNCHC, YBX1 and PNPLA3 function to improve hepatocyte lipid accumulation and exacerbate metabolic dysfunction-associated steatohepatitis development. CONCLUSIONS: In summary, our findings unveil a novel LNCHC functionality in regulating YBX1 and PNPLA3 mRNA stability during MASLD development, providing new avenues in MASLD treatment.
Purpose: In the present study, we aim to elucidate the underlying molecular mechanism of endoplasmic reticulum (ER) stress induced delayed corneal epithelial wound healing and nerve regeneration. Methods: Human limbal epithelial cells (HLECs) were treated with thapsigargin to induce excessive ER stress and then RNA sequencing was performed. Immunofluorescence, qPCR, Western blot, and ELISA were used to detect the expression changes of SLIT3 and its receptors ROBO1-4. The role of recombinant SLIT3 protein in corneal epithelial proliferation and migration were assessed by CCK8 and cell scratch assay, respectively. Thapsigargin, exogenous SLIT3 protein, SLIT3-specific siRNA, and ROBO4-specific siRNA was injected subconjunctivally to evaluate the effects of different intervention on corneal epithelial and nerve regeneration. In addition, Ki67 staining was performed to evaluate the proliferation ability of epithelial cells. Results: Thapsigargin suppressed normal corneal epithelial and nerve regeneration significantly. RNA sequencing genes related to development and regeneration revealed that thapsigargin induced ER stress significantly upregulated the expression of SLIT3 and ROBO4 in corneal epithelial cells. Exogenous SLIT3 inhibited normal corneal epithelial injury repair and nerve regeneration, and significantly suppressed the proliferation and migration ability of cultured mouse corneal epithelial cells. SLIT3 siRNA inhibited ROBO4 expression and promoted epithelial wound healing under thapsigargin treatment. ROBO4 siRNA significantly attenuated the delayed corneal epithelial injury repair and nerve regeneration induced by SLIT3 treatment or thapsigargin treatment. Conclusions: ER stress inhibits corneal epithelial injury repair and nerve regeneration may be related with the upregulation of SLIT3-ROBO4 pathway.
Cell Proliferation , Endoplasmic Reticulum Stress , Epithelium, Corneal , Nerve Regeneration , Receptors, Immunologic , Roundabout Proteins , Signal Transduction , Wound Healing , Animals , Humans , Mice , Blotting, Western , Cell Movement/physiology , Cells, Cultured , Endoplasmic Reticulum Stress/physiology , Enzyme-Linked Immunosorbent Assay , Epithelium, Corneal/metabolism , Limbus Corneae/cytology , Nerve Regeneration/physiology , Nerve Tissue Proteins/genetics , Nerve Tissue Proteins/metabolism , Receptors, Cell Surface/metabolism , Receptors, Cell Surface/genetics , Receptors, Immunologic/genetics , Receptors, Immunologic/metabolism , Signal Transduction/physiology , Wound Healing/physiology
Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome (MPPH), a type of overgrowth syndrome, is characterized by progressive megalencephaly, cortical brain malformations, and distal limb anomalies. Previous studies have revealed that the overactivity of the phosphatidylinositol 3-kinase-Protein kinase B pathway and the increased cyclin D2 (CCND2) expression were the main factors contributing to this disease. Here, we present the case of a patient who exhibited megalencephaly, polymicrogyria, abnormal neuronal migration, and developmental delay. Serum tandem mass spectrometry and chromosome examination did not detect any metabolic abnormalities or copy number variants. However, whole-exome sequencing and Sanger sequencing revealed a de novo nonsense mutation (NM_001759.3: c.829C>T; p.Gln277X) in the CCND2 gene of the patient. Bioinformatics analysis predicted that this mutation may disrupt the structure and surface charge of the CCND2 protein. This disruption could potentially prevent polyubiquitination of CCND2, leading to its resistance against degradation. Consequently, this could drive cell division and growth by altering the activity of key cell cycle regulatory nodes, ultimately contributing to the development of MPPH. This study not only presents a new case of MPPH and expands the mutation spectrum of CCND2 but also enhances our understanding of the mechanisms connecting CCND2 with overgrowth syndromes.
Carexqingyuanensis, a new species of Cyperaceae from Guangdong Province, China, is described and illustrated. The new species is morphologically similar to Carexpeliosanthifolia F. T. Wang & Tang ex P. C. Li, but it can be distinguished by the racemose inflorescence branches appearing single (rarely binate or ternate) (vs. binate or ternate), one (rarely two or three) (vs. 1-3) spiked, male part of linear-cylindrical spikes much longer than the female part (vs. just male part short-cylindrical and slightly longer than female part), style base thickened (vs. not thickened) and perigynium horizontally patent with a short (vs. long and excurved) beak. Phylogenetic analysis, based on the two nuclear DNA regions (ETS 1f and ITS) and three chloroplast DNA regions (matK, ndhF and rps16), suggests that the new species belongs to sect. Siderostictaes.s. of subg. Siderosticta and shows a closer phylogenetic relationship to Carexscaposa C. B. Clarke.
OBJECTIVE: To establish a cellular-level mechanical injury model for human skeletal muscle cells and investigate changes in the mechanical effect mechanism after such injuries. METHODS: The FX-5000™ Compression System was used to apply constant static mechanical pressure to human skeletal muscle cells. A factorial design analysis was conducted to discover the optimal injury model by evaluating the correlation between the amount of pressure, the duration of mechanical stimulation, and the number of days of observation. Skeletal muscle cell injury was evaluated by measuring cell metabolism, morphology, and calcium homeostasis. RESULTS: Mechanical injury was modeled as continuous pressure of 1 MPa for 2 hours with observation for 3 days. The results show that mechanical injury increased creatine kinase, intracellular Ca2+ concentration, and malondialdehyde content, decreased superoxide dismutase, and caused cell swelling and severe cytoplasmic vacuolization (all P < 0.05). CONCLUSION: This model of mechanically-injured human skeletal muscle cells provides an experimental model for the clinically common skeletal muscle injury caused by static loading pressure. It may be used to study the mechanism of action of treatment methods for mechanically injured skeletal muscle.
Snake venoms, comprising a complex array of protein-rich components, an important part of which are snake venom metalloproteinases (SVMPs). These SVMPs, which are predominantly isolated from viperid venoms, are integral to the pathology of snakebites. However, SVMPs derived from elapid venoms have not been extensively explored, and only a handful of SVMPs have been characterized to date. Atrase A, a nonhemorrhagic P-III class metalloproteinase from Naja atra venom, exhibits weak proteolytic activity against fibrinogen in vitro but has pronounced anticoagulant effects in vivo. This contrast spurred investigations into its anticoagulant mechanisms. Research findings indicate that atrase A notably extends the activated partial thromboplastin time, diminishes fibrinogen levels, and impedes platelet aggregation. The anticoagulant action of atrase A primarily involves inhibiting coagulation factor VIII and activating the endogenous fibrinolytic system, which in turn lowers fibrinogen levels. Additionally, its effect on platelet aggregation further contributes to its anticoagulant profile. This study unveils a novel anticoagulant mechanism of atrase A, significantly enriching the understanding of the roles of cobra venom metalloproteinases in snake venom. Furthermore, these findings underscore the potential of atrase A as a novel anticoagulant drug, offering insights into the functional evolutions of cobra venom metalloproteinases.
BACKGROUND: Difficulty in obtaining tetracycline, increased adverse reactions, and relatively complicated medication methods have limited the clinical application of the classic bismuth quadruple therapy. Therefore, the search for new alternative drugs has become one of the research hotspots. In recent years, minocycline, as a semisynthetic tetracycline, has demonstrated good potential for eradicating Helicobacter pylori (H. pylori) infection, but the systematic evaluation of its role remains lacking. AIM: To explore the efficacy, safety, and compliance of minocycline in eradicating H. pylori infection. METHODS: We comprehensively retrieved the electronic databases of PubMed, Embase, Web of Science, China National Knowledge Infrastructure, SinoMed, and Wanfang database as of October 30, 2023, and finally included 22 research reports on H. pylori eradication with minocycline-containing regimens as per the inclusion and exclusion criteria. The eradication rates of H. pylori were calculated using a fixed or a random effect model, and the heterogeneity and publication bias of the studies were measured. RESULTS: The single-arm meta-analysis revealed that the minocycline-containing regimens achieved good overall H. pylori eradication rates, reaching 82.3% [95% confidence interval (CI): 79.7%-85.1%] in the intention-to-treat analysis and 90.0% (95%CI: 87.7%-92.4%) in the per-protocol analysis. The overall safety and compliance of the minocycline-containing regimens were good, demonstrating an overall incidence of adverse reactions of 36.5% (95%CI: 31.5%-42.2%). Further by traditional meta-analysis, the results showed that the minocycline-containing regimens were not statistically different from other commonly used eradication regimens in eradication rate and incidence of adverse effects. Most of the adverse reactions were mild to moderate and well-tolerated, and dizziness was relatively prominent in the minocycline-containing regimens (16%). CONCLUSION: The minocycline-containing regimens demonstrated good efficacy, safety, and compliance in H. pylori eradication. Minocycline has good potential to replace tetracycline for eradicating H. pylori infection.
Anti-Bacterial Agents , Drug Therapy, Combination , Helicobacter Infections , Helicobacter pylori , Minocycline , Humans , Minocycline/adverse effects , Minocycline/administration & dosage , Minocycline/therapeutic use , Helicobacter Infections/drug therapy , Helicobacter Infections/microbiology , Helicobacter pylori/drug effects , Anti-Bacterial Agents/adverse effects , Anti-Bacterial Agents/therapeutic use , Anti-Bacterial Agents/administration & dosage , Drug Therapy, Combination/methods , Treatment Outcome , Proton Pump Inhibitors/adverse effects , Proton Pump Inhibitors/therapeutic use , Proton Pump Inhibitors/administration & dosage , Medication Adherence
The supramolecular solvent (SUPRAS) has garnered significant attention as an innovative, efficient, and environmentally friendly solvent for the effective extraction and separation of bioactive compounds from natural resources. However, research on the use of a SUPRAS for the extraction of phenolic compounds from plants, which are highly valued in food products due to their exceptional antioxidant properties, remains scarce. The present study developed a green, ultra-sound-assisted SUPRAS method for the simultaneous determination of three phenolic acids in Prunella vulgaris using high-performance liquid chromatography (HPLC). The experimental parameters were meticulously optimized. The efficiency and antioxidant properties of the phenolic compounds obtained using different extraction methods were also compared. Under optimal conditions, the extraction efficiency of the SUPRAS, prepared with octanoic acid reverse micelles dispersed in ethanol-water, significantly exceeded that of conventional organic solvents. Moreover, the SUPRAS method demonstrated greater antioxidant capacity. Confocal laser scanning microscopy (CLSM) images revealed the spherical droplet structure of the SUPRAS, characterized by a well-defined circular fluorescence position, which coincided with the position of the phenolic acids. The phenolic acids were encapsulated within the SUPRAS droplets, indicating their efficient extraction capacity. Furthermore, molecular dynamics simulations combined with CLSM supported the proposed method's mechanism and theoretically demonstrated the superior extraction performance of the SUPRAS. In contrast to conventional methods, the higher extraction efficiency of the SUPRAS can be attributed to the larger solvent contact surface area, the formation of more types of hydrogen bonds between the extractants and the supramolecular solvents, and stronger, more stable interaction forces. The results of the theoretical studies corroborate the experimental outcomes.
Antioxidants , Phenols , Plant Extracts , Solvents , Solvents/chemistry , Phenols/chemistry , Phenols/isolation & purification , Antioxidants/chemistry , Antioxidants/isolation & purification , Plant Extracts/chemistry , Chromatography, High Pressure Liquid/methods , Green Chemistry Technology , Molecular Dynamics Simulation , Hydroxybenzoates/chemistry , Hydroxybenzoates/isolation & purification
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
A series of bis-naphthyl ferrocene derivatives were synthesized and characterized. Based on the results obtained from UV-visible absorption titration and ethidium bromide (EB) displacement experiments, it was observed that the synthesized compounds exhibited a strong binding ability to dsDNA. In comparison to the viscosity curve of EB, the tested compounds demonstrated a bisintercalation binding mode when interacting with CT-DNA. Differential pulse voltammetry (DPV) was employed to assess the binding specificity of these indicators towards ssDNA and dsDNA. All tested indicators displayed more pronounced signal differences before and after hybridization between probe nucleic acids and target nucleic acids compared to Methylene Blue (MB). Among the evaluated compounds, compound 3j containing an ether chain showed superior performance as an indicator, making it suitable for constructing DNA-based biosensors. Under optimized conditions including probe ssDNA concentration and indicator concentration, this biosensor exhibited good sensitivity, reproducibility, stability, and selectivity. The limit of detection was calculated as 4.53 × 10-11 mol/L. Furthermore, when utilizing 3j as the indicator in serum samples, the biosensor achieved satisfactory recovery rates for detecting the BRCA1 gene.
Osteogenic-osteoclast coupling processes play a crucial role in bone regeneration. Recently, strategies that focus on multi-functionalized implant surfaces to enhance the healing of bone defects through the synergistic regulation of osteogenesis and osteoclastogenesis is still a challenging task in the field of bone tissue engineering. The aim of this study was to create a dual-drug release-based core-shell nanofibers with the intent of achieving a time-controlled release to facilitate bone regeneration. We fabricated core-shell P/PCL nanofibers using coaxial electrospinning, where alendronate (ALN) was incorporated into the core layer and hydroxyapatite (HA) into shell. The surface of the nanofiber construct was further modified with mussel-derived polydopamine (PDA) to induce hydrophilicity and enhance cell interactions. Surface characterizations confirmed the successful synthesis of PDA@PHA/PCL-ALN nanofibers endowed with excellent mechanical strength (20.02 ± 0.13 MPa) and hydrophilicity (22.56°), as well as the sustained sequential release of ALN and Ca ions. In vitro experiments demonstrated that PDA-functionalized core-shell PHA/PCL-ALN scaffolds possessed excellent cytocompatibility, enhanced cell adhesion and proliferation, alkaline phosphatase activity and osteogenesis-related genes. In addition to osteogenesis, the engineered scaffolds also significantly reduced osteoclastogenesis, such as tartrate-resistant acid phosphatase activity and osteoclastogenesis-related gene expression. After 12-week of implantation, it was observed that PDA@PHA/PCL-ALN nanofiber scaffolds, in a rat cranial defect model, significantly promoted bone repair and regeneration. Microcomputed tomography, histological examination, and immunohistochemical analysis collectively demonstrated that the PDA-functionalized core-shell PHA/PCL-ALN scaffolds exhibited exceptional osteogenesis-inducing and osteoclastogenesis-inhibiting effects. Finally, it may be concluded from our results that the bio-inspired surface-functionalized multifunctional, biomimetic and controlled release core-shell nanofiber provides a promising strategy to facilitate bone healing.
A new compound, named coniferin B (1), and fourteen known compounds were purified and identified from the leaves and branches of Wikstroemia chamaedaphne Meisn. Their chemical structures were elucidated through analyzing spectroscopic and HRESIMS data. Compounds 2, 3, 5, 7-9, 11, and 13 were isolated from this plant for the first time. All compounds were assayed for cytotoxicity and activation of latent HIV activity on NH2 cells. The results showed that all compounds did not produce cytotoxicity at 10.0 µM and compounds 1, 9-11 showed weak activating activity with activation folds of 4.88, 7.14, 5.3, and 6.97, respectively.
PURPOSE: To investigate the rate of axial length elongation and high myopia progression in operated eyes before and after posterior scleral reinforcement (PSR) surgery. METHODS: This was a retrospective study. Children with pathological myopia treated with PSR at Beijing Tongren Hospital between May 2013 and May 2020 were recruited into the PSR surgery group. Children matched for age and myopia were recruited into the control group. All children underwent comprehensive ophthalmologic examinations. The presurgical and postsurgical rates of axial length elongation and myopic (spherical equivalent) progression were calculated. RESULTS: A total of 35 PSR patients were included in the study. The mean age was 6.5±3.0 years (range 2 to 14 years). Mean follow-up was 544 days (range 216 to 1657 days). The rate of axial length elongation was significantly less after posterior scleral reinforcement surgery (0.505±0.048mm per year prior to surgery; 0.382±0.045mm per year after surgery, P<0.001). The rate of myopic progression decreased after posterior scleral reinforcement surgery (1.162±0.118 D per year prior to surgery; 0.153±0.437 D per year after surgery, P=0.0239). There was no statistically significant difference in axial length elongation or myopic progression between pre-inclusion and post-inclusion in the control group. Moreover, the children's best-corrected visual acuity was significantly improved after posterior scleral reinforcement surgery (P<0.001). CONCLUSION: Posterior scleral reinforcement surgery effectively decreased the rate of high myopic progression and axial length elongation in children.