Evaluation of the Combined Effect of Heterodera glycines and Macrophomina phaseolina on Soybean Yield in Naturally Infested Fields with Spatial Regression Analysis and in Greenhouse Studies.

Heterodera glycines, the soybean cyst nematode, and Macrophomina phaseolina, causal agent of charcoal rot, are economically important soybean pathogens. The impact and effect of these pathogens on soybean yield in coinfested fields in the Midwest production region is not known. Both pathogens are soilborne, with spatially aggregated distribution and effects. Spatial regression analysis, therefore, is an appropriate method to account for the spatial dependency in either the dependent variable or regression error term from data produced in fields naturally infested with H. glycines and M. phaseolina. The objectives of this study were twofold: to evaluate the combined effect of H. glycines and M. phaseolina on soybean yield in naturally infested commercial fields with ordinary least squares and spatial regression models; and to evaluate, under environmentally controlled conditions, the combined effect of H. glycines and M. phaseolina through nematode reproduction and plant tissue fungal colonization. Six trials were conducted in fields naturally infested with H. glycines and M. phaseolina in Ohio. Systematic-grid sampling was used to determine the population densities of H. glycines and M. phaseolina, and soybean yield estimates. Though not used in any statistical analysis, M. phaseolina colony forming units from plant tissue, charcoal rot severity, and H. glycines type were also recorded and summarized. In two greenhouse experiments, treatments consisted of H. glycines alone, M. phaseolina alone, and coinfestation of soybean with both pathogens. Moran's I test indicated that the yield from five fields was spatially correlated (P < 0.05) and aggregated. In these fields, to account for spatial dependence, spatial regression models were fitted to the data. Spatial regression analyses revealed a significant interaction effect between H. glycines and M. phaseolina on soybean yield for fields with high initial population densities of both pathogens. In the greenhouse experiments, H. glycines reproduction was significantly (P < 0.05) reduced in the presence of M. phaseolina; however, soybean tissue fungal colonization was not affected by the presence of H. glycines. The direct mechanisms by which H. glycines and M. phaseolina interact were not demonstrated in this study. Future studies must be conducted in the field and greenhouse to better understand this interaction effect.

Genetic Diversity and Population Structure of Pythium irregulare from Soybean and Corn Production Fields in Ohio.

High levels of genetic diversity have been described within the Pythium irregulare complex from several host plants; however, little is known about the population structure in fields used for grain production. Therefore, the objective of this study was to evaluate the genetic diversity and population structure of 53 isolates baited from 28 soybean and corn production fields from 25 counties in Ohio. Genetic diversity was characterized based on sequence analysis of the internal transcribed spacer (ITS1-5.8S-ITS2) region and with 21 simple sequence repeat (SSR) markers. In addition, aggressiveness on soybean, optimum growth temperature, and sensitivity to metalaxyl fungicide were determined. ITS sequence analysis indicated that four isolates clustered with P. cryptoirregulare, whereas the remaining isolates clustered with P. irregulare that was subdivided into two groups (1 and 2). Cluster analysis of SSR data revealed a similar subdivision, which was also supported by structure analysis. The isolates from group 2 grew at a slower rate, but both groups of P. irregulare and P. cryptoirregulare recovered in this study had the same optimum growth at 27°C. Variability of aggressiveness and sensitivity toward metalaxyl fungicide was also observed among isolates within each group. The results from this study will help in the selection of isolates to be used in screening for resistance, assessment of fungicide efficacy, and disease management recommendations.

Improved apple latent spherical virus-induced gene silencing in multiple soybean genotypes through direct inoculation of agro-infiltrated Nicotiana benthamiana extract.

BACKGROUND: Virus induced gene silencing (VIGS) is a powerful genomics tool for interrogating the function of plant genes. Unfortunately, VIGS vectors often produce disease symptoms that interfere with the silencing phenotypes of target genes, or are frequently ineffective in certain plant genotypes or tissue types. This is especially true in crop plants like soybean [Glycine max (L.) Merr]. To address these shortcomings, we modified the inoculation procedure of a VIGS vector based on Apple latent spherical virus (ALSV). The efficacy of this new procedure was assessed in 19 soybean genotypes using a soybean Phytoene desaturase (GmPDS1) gene as the VIGS target. Silencing of GmPDS1 was easily scored as photo-bleached leaves and/or stems. RESULTS: In this report, the ALSV VIGS vector was modified by mobilizing ALSV cDNAs into a binary vector compatible with Agrobacterium tumefaciens-mediated delivery, so that VIGS-triggering ALSV variants could be propagated in agro-infiltrated Nicotiana benthamiana leaves. Homogenate of these N. benthamiana leaves was then applied directly onto the unifoliate of young soybean seedlings to initiate systemic gene silencing. This rapid inoculation method bypassed the need for a particle bombardment apparatus. Among the 19 soybean genotypes evaluated with this new method, photo-bleaching indicative of GmPDS1 silencing was observed in nine, with two exhibiting photo-bleaching in 100% of the inoculated individuals. ALSV RNA was detected in pods, embryos, stems, leaves, and roots in symptomatic plants of four genotypes. CONCLUSIONS: This modified protocol allowed for inoculation of soybean plants via simple mechanical rubbing with the homogenate of N. benthamiana leaves agro-infiltrated with ALSV VIGS constructs. More importantly, inoculated plants showed no apparent virus disease symptoms which could otherwise interfere with VIGS phenotypes. This streamlined procedure expanded this functional genomics tool to nine soybean genotypes.

Rigid and remodelled: cerebrovascular structure and function after experimental high-thoracic spinal cord transection.

High-thoracic or cervical spinal cord injury (SCI) is associated with several critical clinical conditions related to impaired cerebrovascular health, including: 300-400% increased risk of stroke, cognitive decline and diminished cerebral blood flow regulation. The purpose of this study was to examine the influence of high-thoracic (T3 spinal segment) SCI on cerebrovascular structure and function, as well as molecular markers of profibrosis. Seven weeks after complete T3 spinal cord transection (T3-SCI, n = 15) or sham injury (Sham, n = 10), rats were sacrificed for either middle cerebral artery (MCA) structure and function assessments via ex vivo pressure myography, or immunohistochemical analyses. Myogenic tone was unchanged, but over a range of transmural pressures, inward remodelling occurred after T3-SCI with a 40% reduction in distensibility (both P < 0.05), and a 33% reduction in vasoconstrictive reactivity to 5-HT trending toward significance (P = 0.09). After T3-SCI, the MCA had more collagen I (42%), collagen III (24%), transforming growth factor ß (47%) and angiotensin II receptor type 2 (132%), 27% less elastin as well as concurrent increased wall thickness and reduced lumen diameter (all P < 0.05). Sympathetic innervation (tyrosine hydroxylase-positive axon density) and endothelium-dependent dilatation (carbachol) of the MCA were not different between groups. This study demonstrates profibrosis and hypertrophic inward remodelling within the largest cerebral artery after high-thoracic SCI, leading to increased stiffness and possibly impaired reactivity. These deleterious adaptations would substantially undermine the capacity for regulation of cerebral blood flow and probably underlie several cerebrovascular clinical conditions in the SCI population.

Pathotype Diversity of Phytophthora sojae in Eleven States in the United States.

Pathotype diversity of Phytophthora sojae was assessed in 11 states in the United States during 2012 and 2013. Isolates of P. sojae were recovered from 202 fields, either from soil samples using a soybean seedling bioassay or by isolation from symptomatic plants. Each isolate was inoculated directly onto 12 soybean differentials; no Rps gene or Rps 1a, 1b, 1c, 1k, 3a, 3b, 3c, 4, 6, 7, or 8. There were 213 unique virulence pathotypes identified among the 873 isolates collected. None of the Rps genes were effective against all the isolates collected but Rps6 and Rps8 were effective against the majority of isolates collected in the northern regions of the sampled area. Virulence toward Rps1a, 1b, 1c, and 1k ranged from 36 to 100% of isolates collected in each state, while virulence to Rps6 and Rps8 was less than 36 and 10%, respectively. Depending on the state, the effectiveness of Rps3a ranged from totally effective to susceptible to more than 40% of the isolates. Pathotype complexity has increased in populations of P. sojae in the United States, emphasizing the increasing importance of stacked Rps genes in combination with high partial resistance as a means of limiting losses to P. sojae.

Population Structure Among and Within Iowa, Missouri, Ohio, and South Dakota Populations of Phytophthora sojae.

Phytophthora root and stem rot, caused by Phytophthora sojae, is an economically important disease of soybean throughout the Midwestern United States. This disease has been successfully managed with resistance (Rps) genes; however, pathogen populations throughout the Midwest have developed virulence to many Rps genes, including those that have not been deployed. To gain a better understanding of the processes that influence P. sojae evolution, the population genetic structure was compared among populations using one isolate collected from 17, 33, and 20 fields in Iowa, Ohio, and South Dakota, respectively, as well as multiple isolates from individual fields in Iowa, Ohio, and Missouri. Genotypic diversity was measured using 21 polymorphic microsatellite (simple-sequence repeat) markers. and pathotype diversity using 15 soybean differentials. For all but three of the populations with low sample size, there was a high level of pathotype diversity and a low to moderate level of genotypic diversity among the populations for both comparisons between states and within-field variation. None of the Rps-gene differentials were resistant to all of the isolates. There were 103 unique multilocus genotypes identified in this study and only 2 were identified from the same field. Although no clones were identified in more than one field, pairwise FST indicated that some gene flow within neighboring fields does occur but not across the region, including fields from neighboring states. These results suggest that there is a strong probability that each state may have their own or several regional populations, as well as provide further evidence of high diversity within this homothallic pathogen which may be due, in part, to limited gene flow, mutation, or outcrossing, and this likely affects the success of deployment of resistance.

Targeting leukemia stem cells in vivo with antagomiR-126 nanoparticles in acute myeloid leukemia.

Current treatments for acute myeloid leukemia (AML) are designed to target rapidly dividing blast populations with limited success in eradicating the functionally distinct leukemia stem cell (LSC) population, which is postulated to be responsible for disease resistance and relapse. We have previously reported high miR-126 expression levels to be associated with a LSC-gene expression profile. Therefore, we hypothesized that miR-126 contributes to 'stemness' and is a viable target for eliminating the LSC in AML. Here we first validate the clinical relevance of miR-126 expression in AML by showing that higher expression of this microRNA (miR) is associated with worse outcome in a large cohort of older (⩾60 years) cytogenetically normal AML patients treated with conventional chemotherapy. We then show that miR-126 overexpression characterizes AML LSC-enriched cell subpopulations and contributes to LSC long-term maintenance and self-renewal. Finally, we demonstrate the feasibility of therapeutic targeting of miR-126 in LSCs with novel targeting nanoparticles containing antagomiR-126 resulting in in vivo reduction of LSCs likely by depletion of the quiescent cell subpopulation. Our findings suggest that by targeting a single miR, that is, miR-126, it is possible to interfere with LSC activity, thereby opening potentially novel therapeutic approaches to treat AML patients.

Pharmacological targeting of miR-155 via the NEDD8-activating enzyme inhibitor MLN4924 (Pevonedistat) in FLT3-ITD acute myeloid leukemia.

High levels of microRNA-155 (miR-155) are associated with poor outcome in acute myeloid leukemia (AML). In AML, miR-155 is regulated by NF-κB, the activity of which is, in part, controlled by the NEDD8-dependent ubiquitin ligases. We demonstrate that MLN4924, an inhibitor of NEDD8-activating enzyme presently being evaluated in clinical trials, decreases binding of NF-κB to the miR-155 promoter and downregulates miR-155 in AML cells. This results in the upregulation of the miR-155 targets SHIP1, an inhibitor of the PI3K/Akt pathway, and PU.1, a transcription factor important for myeloid differentiation, leading to monocytic differentiation and apoptosis. Consistent with these results, overexpression of miR-155 diminishes MLN4924-induced antileukemic effects. In vivo, MLN4924 reduces miR-155 expression and prolongs the survival of mice engrafted with leukemic cells. Our study demonstrates the potential of miR-155 as a novel therapeutic target in AML via pharmacologic interference with NF-κB-dependent regulatory mechanisms. We show the targeting of this oncogenic microRNA with MLN4924, a compound presently being evaluated in clinical trials in AML. As high miR-155 levels have been consistently associated with aggressive clinical phenotypes, our work opens new avenues for microRNA-targeting therapeutic approaches to leukemia and cancer patients.

A Coordinated Effort to Manage Soybean Rust in North America: A Success Story in Soybean Disease Monitoring.

Existing crop monitoring programs determine the incidence and distribution of plant diseases and pathogens and assess the damage caused within a crop production region. These programs have traditionally used observed or predicted disease and pathogen data and environmental information to prescribe management practices that minimize crop loss. Monitoring programs are especially important for crops with broad geographic distribution or for diseases that can cause rapid and great economic losses. Successful monitoring programs have been developed for several plant diseases, including downy mildew of cucurbits, Fusarium head blight of wheat, potato late blight, and rusts of cereal crops. A recent example of a successful disease-monitoring program for an economically important crop is the soybean rust (SBR) monitoring effort within North America. SBR, caused by the fungus Phakopsora pachyrhizi, was first identified in the continental United States in November 2004. SBR causes moderate to severe yield losses globally. The fungus produces foliar lesions on soybean (Glycine max) and other legume hosts. P. pachyrhizi diverts nutrients from the host to its own growth and reproduction. The lesions also reduce photosynthetic area. Uredinia rupture the host epidermis and diminish stomatal regulation of transpiration to cause tissue desiccation and premature defoliation. Severe soybean yield losses can occur if plants defoliate during the mid-reproductive growth stages. The rapid response to the threat of SBR in North America resulted in an unprecedented amount of information dissemination and the development of a real-time, publicly available monitoring and prediction system known as the Soybean Rust-Pest Information Platform for Extension and Education (SBR-PIPE). The objectives of this article are (i) to highlight the successful response effort to SBR in North America, and (ii) to introduce researchers to the quantity and type of data generated by SBR-PIPE. Data from this system may now be used to answer questions about the biology, ecology, and epidemiology of an important pathogen and disease of soybean.

Increased anti-leukemic activity of decitabine via AR-42-induced upregulation of miR-29b: a novel epigenetic-targeting approach in acute myeloid leukemia.

Histone deacetylase (HDAC) inhibitors either alone or in combination with hypomethylating agents have limited clinical effect in acute myeloid leukemia (AML). Previously, we demonstrated that AML patients with higher miR (microRNA)-29b expression had better response to the hypomethylating agent decitabine. Therefore, an increase in miR-29b expression preceding decitabine treatment may provide a therapeutic advantage. We previously showed that miR-29b expression is suppressed by a repressor complex that includes HDACs. Thus, HDAC inhibition may increase miR-29b expression. We hypothesized that priming AML cells with the novel HDAC inhibitor (HDACI) AR-42 would result in increased response to decitabine treatment via upregulation of miR-29b. Here, we show that AR-42 is a potent HDACI in AML, increasing miR-29b levels and leading to downregulation of known miR-29b targets (that is, SP1, DNMT1, DNMT3A and DNMT3B). We then demonstrated that the sequential administration of AR-42 followed by decitabine resulted in a stronger anti-leukemic activity in vitro and in vivo than decitabine followed by AR-42 or either drug alone. These preclinical results with AR-42 priming before decitabine administration represent a promising, novel treatment approach and a paradigm shift with regard to the combination of epigenetic-targeting compounds in AML, where decitabine has been traditionally given before HDACIs.

First Report of Soybean vein necrosis-associated virus in Ohio Soybean Fields.

Soybean vein necrosis-associated virus (SVNaV), a newly discovered tospovirus that infects soybean, was first described as widespread in a number of southern and midwestern states, but so far has not been reported in Ohio (1). Here we describe its occurrence in six different soybean leaf samples collected from five Ohio counties: Champaign, Hardin, Sandusky, Seneca, and Wyandot. Specifically, SVNaV was initially identified through a comprehensive survey during the summer of 2011 that used high throughput sequencing to detect genome sequences of viruses present in a pool of 110 field samples collected from 24 Ohio counties. Three assembled contigs, with sizes of 7,551, 4,937, and 1,554 nucleotides (nt) respectively, share 99% nt identity with the three SVNaV genomic RNAs (L, M, and S), and thus constitute partial sequences of the SVNaV Ohio (OH) isolate. The distribution of this virus was further delineated using reverse transcription (RT)-PCR with primers SVNaV-1734F (5' CCATCTTTCTTTCCAGGCATTTCA 3') and SVNaV-S-2421R (5' GATTCAAGTTCAGCGAGTTCTACAA 3'). All plants from which the SVNaV-positive samples were collected showed typical virus symptoms, including systemic mosaic accompanied by leaf deformation, chlorosis, vein necrosis, and rusty spots on mature leaves. These symptoms are largely consistent with the previous report by Zhou and colleagues (1). Intriguingly, further analysis with RT-PCR revealed that five out of the six SVNaV-positive samples also contained a second virus, with Bean pod mottle virus found in four of the samples, and Tobacco ringspot virus in the fifth. Since it is not yet possible to initiate SVNaV infection mechanically, it is difficult to determine whether the co-infecting viruses contribute to the disease symptoms and yield losses. It should be noted that SVNaV may have been in Ohio for some time since symptoms similar to those reported by Zhou and colleagues (1) have been observed in soybean fields of this state since at least 2009. Furthermore, while in 2011 these symptoms were observed in only a few fields, as reflected by the detection of SVNaV in six of the 110 samples, the 2012 growing season has seen a big jump of symptomatic plants and fields. The current report confirms its presence with molecular evidence and lays the groundwork for further assessment of its impact on soybean production. Reference: (1) J. Zhou et al. Virus Genes 43:289, 2011.

Infection of Soybean Seed by Fusarium graminearum and Effect of Seed Treatments on Disease Under Controlled Conditions.

Fusarium graminearum causes seed decay and damping-off of soybean. This study evaluated the effect of inoculum density of F. graminearum, temperature, and fungicide seed treatments on disease development. To determine the optimum conditions for disease development, individual soybean seed was inoculated with 100 µl of a suspension of 2.5 × 102, 2.5 × 103, 2.5 × 104, or 2.5 × 105 macroconidia/ml in a rolled-towel assay at temperatures of 18, 22, and 25°C. Inoculum concentrations of 2.5 × 104 macroconidia/ml or higher were necessary for optimum disease development at all temperatures. The efficacy of captan, fludioxonil, mefenoxam + fludioxonil, azoxystrobin, trifloxystrobin, and pyraclostrobin as seed treatments was then evaluated with the same assay at 2.5 × 104 and 2.5 × 105 macroconidia/ml. Seed treated with captan at 61.9 g a.i. or fludioxonil at 2.5 or 5.0 g a.i. per 100 kg developed smaller lesions than other seed treatments and the nontreated control. Based on these results, there are limited choices in fungicide seed treatments for managing this seedling disease, and it is possible that shifts in seed treatment products may have played a role in the recent emergence of this soybean pathogen.

First Report of Phytophthora sansomeana Causing Wilting and Stunting on Corn in Ohio.

During the spring of 2004, corn seedlings with symptoms of wilting and stunting were observed in corn fields with emergence problems in Madison and Brown counties, Ohio. Phytophthora isolates were recovered from sections of root tissue of diseased seedlings placed on dilute V8 media amended with pentachloronitrobenzene, iprodione, benlate, neomycin sulfate, and chloramphenicol. Colonies were rosaceous on potato dextrose agar, with a growth rate of 5 mm per day. Homothallic isolates with paragynous antheridia were observed on lima bean agar (LBA); oogonia were 35 to 50 µm in diameter. Sporangia were ovoid to obpyriform, nonpapillate, with an average size of 49 × 30 µm. Pathogenicity was tested on corn seeds using a petri dish assay with 3-day-old cultures on LBA and a sand-cornmeal cup test amended with inoculum from 7-day-old cultures on LBA (1). After 1 week in the petri dish assay, the seeds failed to germinate completely and were covered with white, fungal-like, aerial mycelia and the pathogen was recovered from brown discolored radicle roots. In the cup assay, 2-week-old seedlings developed the same symptoms observed in the field; the pathogen was also isolated from brown discolored roots. In both assays, no symptoms developed in the noninoculated controls. Both pathogenicity tests were repeated two times. Genomic DNA was extracted from mycelia of two isolates and the internal transcribed spacer (ITS) region was amplified and sequenced using ITS6/ITS4 primers (2). Both isolates had identical ITS sequences (GenBank Accession No. GQ853880). A BLAST search of the NCBI database showed 100% homology with the sequence of the haplotype isolate of Phytophthora sansomeana (Accession No. EU925375). P. sansomeana is a new species characterized principally by a large oogonial diameter (37 to 45 µm), rapid growth rate (7 to 10 mm/day), and an ITS sequence falling in Cooke's clade 8 (4). Pathogenicity tests, morphological characteristics, and the ITS sequence analysis indicate that P. samsomena is the causal agent of the symptoms observed on corn seedlings. P. sansomeana has been reported as a pathogen of soybean in Indiana, Douglas-fir in Oregon, and weeds in alfalfa fields in New York (4). To our knowledge, this is the first report of P. sansomeana infecting corn in Ohio, albeit other isolates have previously been recovered from soybean in the state. There are four previous reports of Phytophthora spp. affecting corn in the United States and Mexico (3). Crop rotation will have little effect in management of this pathogen since corn and soybean are produced in the same fields continuously throughout the state. References: (1) K. E. Broders et al. Plant. Dis. 91:727, 2007. (2) D. E. L. Cooke et al. Fungal Genet. Biol. 30:17, 2000. (3) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN. 1989. (4) E. M. Hansen et al. Mycologia 101:129, 2009.

Association of soil chemical and physical properties with Pythium species diversity, community composition, and disease incidence.

A high-throughput baiting and identification process identified more than 7,000 isolates of Pythium from 88 locations in Ohio. Isolates were identified using direct-colony polymerase chain reaction followed by single-strand conformational polymorphism, and communities were assembled using the Jaccard similarity coefficient and cluster analysis. Both univariate and multivariate statistics were used to evaluate differences in soil properties between communities, and canonical discriminant analysis (CDA) was used to assess the strength of the association of soil variables within communities from 83 of the locations. In all, 21 species of Pythium were identified but only 6 were recovered from >40% of the locations. Five communities were formed using the cluster analysis, and significant differences were observed in disease incidence, as well as soil pH, calcium, magnesium, and cation exchange capacity between communities. Stepwise multiple discriminant analysis and CDA identified pH, calcium, magnesium, and field capacity as contributing the most to the separation of the five Pythium communities. There was a strong association between abiotic soil components and the structure of Pythium communities, as well as diversity of Pythium spp. collected from agronomic production fields in Ohio.

Integrated Management Strategies for Phytophthora sojae Combining Host Resistance and Seed Treatments.

Phytophthora sojae has re-emerged as a serious soybean pathogen in the past decade. This may be due in part to changes in resistance levels in current cultivars, adoption of P. sojae populations to deployed Rps genes, and highly favorable environments in the past decade. This multilocation study evaluated the effect of seed treatments on the incidence and severity of Phytophthora root and stem rot on soybeans with different combinations of Rps genes and levels of partial resistance. The efficacy of the seed treatments was highly variable across locations. Seed treatments (metalaxyl and mefenoxam) provided protection and increased yields across cultivars in locations where rain or irrigation occurred shortly after planting (Ohio, South Dakota, and Ontario). However, there were no significant differences in stand or yield consistently across cultivars in Iowa, Nebraska, Wisconsin, or Ohio, where heavy precipitation did not occur until later growth stages. The environment, levels of inoculum, and pathogen complex may have played a role in the different responses to the seed treatments and to the different combinations of Rps genes and levels of partial resistance to P. sojae in the cultivars. Fields that are poorly drained and have P. sojae populations with complex pathotypes may benefit the most from seed treatments. Individual fields where producers may see the greatest benefit to utilizing these integrated management strategies will need to be identified.

Genetic Analysis of Soybean Plant Introductions with Resistance to Phytophthora sojae.

ABSTRACT Phytophthora sojae, which causes Phytophthora root and stem rot of soybean, is a serious disease worldwide and is managed primarily by deploying cultivars with resistance. Thirty-two soybean plant introductions (PIs), all but three of which were from South Korea, were proposed as new sources of single-gene resistance to P. sojae. The objective of this study was to characterize the inheritance of resistance to P. sojae in these PIs. Twenty-two soybean populations from crosses of these PIs and the susceptible cv. Williams were inoculated with P. sojae OH17 (vir 1b, 1d, 2, 3a, 3b, 3c, 4, 5, 6, 7), and OH25 (vir 1a, 1b, 1c, 1k, 7). These isolates were selected because they are virulent on soybeans with all known Rps genes and many Rps gene combinations. Thirteen of the twenty-two populations had consistent segregation responses following inoculations between the two generations. In two PIs, resistance was conferred by two genes to OH17 and three genes to OH25. Resistance to both isolates was conferred by a single gene in PI 398440 although the individual families were not resistant to the same isolates. The data suggest that six of the populations have three-Rps gene combinations as previously proposed, while another four may have either a novel Rps gene or a four-Rps gene combination. Based on this phenotypic analysis, novel and uncharacterized Rps genes may be present in this material. More importantly, these PIs may serve as sources of novel Rps genes that can be used to more effectively manage Phytophthora root and stem rot.

Molecular Marker Analysis of Soybean Plant Introductions with Resistance to Phytophthora sojae.

ABSTRACT Molecular analysis of sources of resistance to plant pathogens should expedite and confirm novel gene discovery and consequently the development of disease resistant cultivars. Recently, soybean plant introductions (PIs) were identified that contain putative novel Rps genes for resistance to Phytophthora sojae. The number of resistance genes that confer resistance to P. sojae isolates OH17 (1b,1d,2,3a,3b,3c,4,5,6,7) and OH25 (1a,1b,1c,1k,7) was then determined in several of the PIs. The objective of this study was to determine if the Rps genes present in these PIs were associated with eight described Rps loci that have been mapped on soybean molecular linkage groups F, G, J, and N. Nine F(2:3) soybean populations were genotyped with simple sequence repeat (SSR) markers linked to previously mapped Rps loci. The nine PI populations all had SSR markers associated (P < 0.01) with resistance to P. sojae isolate OH17 in the Rps1 region. Rps1c is a likely candidate in eight PIs but novel genes may also be possible, while novel genes may confer resistance in one PI to P. sojae isolate OHI7. Two or more Rps genes, including some that are potentially novel, confer resistance to P. sojae isolate OH25 in eight of the populations. However, based on the response to these two isolates, virulence already exists for at least some of the novel genes identified in this study.

Characterization of Pythium spp. Associated with Corn and Soybean Seed and Seedling Disease in Ohio.

Cool, moist conditions in combination with minimum tillage, earlier planting, and recent shifts in commercial fungicide seed-treatment active ingredients have led to an increase in corn (Zea mays) and soybean (Glycine max) seedling establishment problems. This situation resulted in an investigation of Pythium spp. associated with seed and seedling diseases. Samples of diseased corn and soybean seedlings were collected from 42 production fields in Ohio. All isolates of Pythium recovered were identified to species using morphological and molecular techniques and evaluated in an in vitro pathogenicity assay on both corn and soybean seed, and a subset of the isolates was tested for sensitivity to fungicides currently used as seed treatments. Eleven species and two distinct morphological groups of Pythium were identified, of which six species were moderately to highly pathogenic on corn seed and nine species were highly pathogenic on soybean seed. There was significant variation (P < 0.05) in sensitivity to mefenoxam, azoxystrobin, trifloxystrobin, and captan both across and within species. Multiple species of Pythium had the capacity to reduce germination of both corn and soybean seed. Results indicated that mefenoxam, azoxystrobin, trifloxystrobin, or captan, when used individually, may not inhibit all pathogenic species of Pythium found in Ohio soils.

Evaluation of Fusarium graminearum Associated with Corn and Soybean Seed and Seedling Disease in Ohio.

Fusarium graminearum is an important pathogen of cereal crops in Ohio causing primarily head blight in wheat and stalk and ear rot of corn. During the springs of 2004 and 2005, 112 isolates of F. graminearum were recovered from diseased corn and soybean seedlings from 30 locations in 13 Ohio counties. These isolates were evaluated in an in vitro pathogenicity assay on both corn and soybean seed, and 28 isolates were tested for sensitivity to the seed treatment fungicides azoxystrobin, trifloxystrobin, fludioxonil, and captan. All of the isolates were highly pathogenic on corn seed and moderately to highly pathogenic on soybean seed. Fludioxonil was the only fungicide that provided sufficient inhibition of mycelial growth; however, several fludioxonil-resistant mutants were identified during the sensitivity experiments. These results indicate that F. graminearum is an important pathogen of both corn and soybean seed and seedlings in Ohio, and that continued use of fludioxonil potentially may select for less sensitive isolates of F. graminearum.