RESUMEN
The last decades have witnessed a rapid development of noninvasive plant phenotyping, capable of detecting plant stress scale levels from the subcellular to the whole population scale. However, even with such a broad range, most phenotyping objects are often just concerned with leaves. This review offers a unique perspective of noninvasive plant stress phenotyping from a multi-organ view. First, plant sensing and responding to abiotic stress from the diverse vegetative organs (leaves, stems, and roots) and the interplays between these vital components are analyzed. Then, the corresponding noninvasive optical phenotyping techniques are also provided, which can prompt the practical implementation of appropriate noninvasive phenotyping techniques for each organ. Furthermore, we explore methods for analyzing compound stress situations, as field conditions frequently encompass multiple abiotic stressors. Thus, our work goes beyond the conventional approach of focusing solely on individual plant organs. The novel insights of the multi-organ, noninvasive phenotyping study provide a reference for testing hypotheses concerning the intricate dynamics of plant stress responses, as well as the potential interactive effects among various stressors.
RESUMEN
To investigate the flow characteristics in front chamber and rear chamber in pump mode and pump as turbine mode, a 3D computational model of a centrifugal pump was established, including the front and rear chamber. Based on Realizable k-ε turbulence model, numerical calculations of incompressible flow were carried out for internal viscous flow in two operating modes. Further analysis was conducted on the flow stability and hydraulic losses under two modes using energy gradient theory and entropy production theory. The numerical simulation results are within reasonable error compared to the experimental results in pump operation mode, which ensures the reliability of the numerical calculation method. The results indicate that the volumetric efficiency in both two modes is on an upward trend with increasing flow, but the volumetric efficiency of the pump mode is more significantly affected by changes in flow; the distribution patterns of dimensionless circumferential velocity and dimensionless radial velocity in the front and rear chambers under two operating modes are similar, but the distribution pattern of dimensionless radial velocity in the front chamber in turbine mode is significantly different from other operating conditions; flow instability is most likely to occur at the outlet of impeller, and the energy loss in clearance of wear-rings is greater than that in the pump chamber.
RESUMEN
Neurodevelopmental disorders in children have become a significant global public health concern, impacting child health worldwide. In China, the current intervention model for high-risk infants involves early diagnosis and early treatment. However, in recent years, overseas studies have explored novel preventive early intervention strategies for neurodevelopmental disorders in high-risk infants, achieving promising results. This article provides a comprehensive review of the optimal timing, methods, and intervention models of the preventive early intervention strategies for neurodevelopmental disorders in high-risk infants. The aim is to enhance the awareness and knowledge of healthcare professionals regarding preventive early intervention strategies for neurodevelopmental disorders in high-risk infants, facilitate clinical research and application of such interventions in China, and ultimately reduce the incidence of neurodevelopmental disorders in this high-risk population.
Asunto(s)
Trastornos del Neurodesarrollo , Lactante , Niño , Humanos , Trastornos del Neurodesarrollo/prevención & control , Trastornos del Neurodesarrollo/epidemiología , Intervención Educativa Precoz , Factores de Riesgo , ChinaRESUMEN
PURPOSE: This study aimed to establish a nomogram using routinely available clinicopathological parameters to predict the pathological response in patients with locally advanced gastric cancer (LAGC) undergoing neoadjuvant treatment. MATERIALS AND METHODS: We conducted this study based on the ongoing Neo-CRAG trial, a prospective study focused on preoperative treatment in patients with LAGC. A total of 221 patients who underwent surgery following neoadjuvant chemotherapy (nCT) or neoadjuvant chemoradiotherapy (nCRT) at Sun Yat-sen University Cancer Center between June 2013 and July 2022 were included in the analysis. We defined complete or near-complete pathological regression and ypN0 as good response (GR), and determined the prognostic value of GR by Kaplan-Meier survival analysis. Eventually, a nomogram for predicting GR was developed based on statistically identified predictors through multivariate logistic regression analysis and internally validated by the bootstrap method. RESULTS: GR was confirmed in 54 patients (54/221, 24.4%). Patients who achieved GR had a longer progression-free survival and overall survival. Then, five independent factors, including pretreatment tumor differentiation, clinical T stage, monocyte count, CA724 level, and the use of nCRT, were identified. Based on these predictors, the nomogram was established with an area under the curve (AUC) of 0.777 (95% CI, 0.705-0.850) and a bias-corrected AUC of 0.752. CONCLUSION: A good pathological response after neoadjuvant treatment was associated with an improved prognosis in LAGC patients. The nomogram we established exhibits a high predictive capability for GR, offering potential value in devising personalized and precise treatment strategies for LAGC patients.
Asunto(s)
Nomogramas , Neoplasias Gástricas , Humanos , Terapia Neoadyuvante/métodos , Estudios Prospectivos , Neoplasias Gástricas/tratamiento farmacológicoRESUMEN
Surface enhanced Raman spectroscopy (SERS) is a powerful analytical technique that has found application in the trace detection of a wide range of contaminants. In this paper, we report on the fabrication of 2D silver nanodendrites, on silicon chips, synthesized by electrochemical reduction of AgNO3at microelectrodes. The formation of nanodendrites is tentatively explained in terms of electromigration and diffusion of silver ions. Electrochemical characterization suggests that the nanodendrites do not stay electrically connected to the microelectrode. The substrates show SERS activity with an enhancement factor on the order of 106. Density functional theory simulations were carried out to investigate the suitability of the fabricated substrate for pesticide monitoring. These substrates can be functionalized with cyclodextrin macro molecules to help with the detection of molecules with low affinity with silver surfaces. A proof of concept is demonstrated with the detection of the herbicide 2-methyl-4-chlorophenoxyacetic acid (MCPA).
RESUMEN
PURPOSE: The aim of this study was to investigate the treatment results and long-term quality of life in patients with early-stage extranodal natural killer/T-cell lymphoma who were prospectively treated with simultaneous boost intensity modulated radiation therapy (SIB-IMRT) with 3 dose gradients. METHODS AND MATERIALS: Sixty patients with stage I-II nasal cavity natural killer/T-cell lymphoma (NKTCL) and Waldeyer's ring NKTCL were enrolled in a single-arm, prospective, phase 2 clinical trial from August 2011 to April 2015. All patients were treated with definitive radiation therapy combined with short-course induction chemotherapy. A newly designed SIB-IMRT scheme was uniformly adopted, with 54.6 Gy for the gross tumor volume (GTV) of the primary tumor and GTV of the positive lymph nodes, 50.7 Gy for the high-risk clinical target volume (CTV), and 45.5 Gy for the low-risk CTV, all delivered in 26 daily fractions. Before SIB-IMRT, L-asparaginase-based induction chemotherapy was used in 95.0% (57/60) of patients. RESULTS: With a median follow-up time of 95.8 months, the 5-year locoregional recurrence-free survival, progression-free survival, and overall survival rates were 83.3%, 81.7%, and 88.3%, respectively. Dosimetric analysis in the first 21 patients showed satisfying conformality for planning target volume of GTV, high-risk CTV, and low-risk CTV, while the organs at risk were well protected. The results of long-term quality-of-life investigations in patients without progression were favorable, and nasal discomfort was the most common symptom. No grade 3 or 4 acute or late toxicities were observed. CONCLUSIONS: The scheme of target volume delineation and dose setting that we designed has favorable clinical effects with mild side effects in treating patients with stage I-II nasal cavity NKTCL and Waldeyer's ring NKTCL.
Asunto(s)
Linfoma Extranodal de Células NK-T , Radioterapia de Intensidad Modulada , Humanos , Radioterapia de Intensidad Modulada/métodos , Calidad de Vida , Estudios Prospectivos , Dosificación Radioterapéutica , Linfoma Extranodal de Células NK-T/radioterapia , Linfoma Extranodal de Células NK-T/tratamiento farmacológico , Células Asesinas NaturalesRESUMEN
African swine fever (ASF), caused by the African swine fever virus (ASFV), is now widespread in many countries and severely affects the commercial rearing of swine. Rapid and early diagnosis is crucial for the prevention of ASF. ASFV mature virions comprise the inner envelope protein, p22, making it an excellent candidate for the serological diagnosis and surveillance of ASF. In this study, the prokaryotic-expressed p22 recombinant protein was prepared and purified for immunization in mice. Four monoclonal antibodies (mAbs) were identified using hybridoma cell fusion, clone purification, and immunological assays. The epitopes of mAbs 14G1 and 22D8 were further defined by alanine-scanning mutagenesis. Our results showed that amino acids C39, K40, V41, D42, C45, G48, E49, and C51 directly bound to 14G1, while the key amino acid epitope for 22D8 included K161, Y162, G163, D165, H166, I167, and I168. Homologous and structural analysis revealed that these sites were highly conserved across Asian and European ASFV strains, and the amino acids identified were located on the surface of p22. Thus, our study contributes to a better understanding of the antigenicity of the ASFV p22 protein, and the results could facilitate the prevention and control of ASF.
Asunto(s)
Virus de la Fiebre Porcina Africana , Fiebre Porcina Africana , Porcinos , Animales , Ratones , Virus de la Fiebre Porcina Africana/genética , Fiebre Porcina Africana/epidemiología , Fiebre Porcina Africana/prevención & control , Mapeo Epitopo , Anticuerpos Monoclonales , Anticuerpos Antivirales , Epítopos , AminoácidosRESUMEN
Posttraumatic stress disorder (PTSD) is a complex disorder that involves physiological, emotional, and cognitive dysregulation that may occur after exposure to a life-threatening event. In contrast with the condition of learned fear with resilience to extinction, abnormal fear with impaired fear extinction and exaggeration are considered crucial factors for the pathological development of PTSD. The prefrontal cortex (mPFC) is considered a critical region of top-down control in fear regulation, which involves the modulation of fear expression and extinction. The pathological course of PTSD is usually chronic and persistent; a number of studies have indicated temporal progression in gene expression and phenotypes may be involved in PTSD pathology. In the current study, we use a well-established modified single-prolonged stress (SPS&FS) rat model to feature PTSD-like phenotypes and compared it with a footshock fear conditioning model (FS model); we collected the frontal tissue after extreme stress exposure or fear conditioning and extracted RNA for transcriptome-level gene sequencing. We compared the genetic profiling of the mPFC at early (<2 h after solely FS or SPS&FS exposure) and late (7 days after solely FS or SPS&FS exposure) stages in these two models. First, we identified temporal differences in the expressional patterns between these two models and found pathways such as protein synthesis factor eukaryotic initiation factor 2 (EIF2), transcription factor NF-E2-related factor 2 (NRF2)-mediated oxidative stress response, and acute phase responding signaling enriched in the early stage in both models with significant p-values. Furthermore, in the late stage, the sirtuin signaling pathway was enriched in both models; other pathways such as STAT3, cAMP, lipid metabolism, Gα signaling, and increased fear were especially enriched in the late stage of the SPS&FS model. However, pathways such as VDR/RXR, GP6, and PPAR signaling were activated significantly in the FS model's late stage. Last, the network analysis revealed the temporal dynamics of psychological disorder, the endocrine system, and also genes related to increased fear in the two models. This study could help elucidate the genetic temporal alteration and stage-specific pathways in these two models, as well as a better understanding of the transcriptome-level differences between them.
RESUMEN
Posttraumatic stress disorder (PTSD) is a complex syndrome that may occur after life-threatening events. Fear memory abnormalities may play vital roles in the pathogenesis of PTSD. Previous work has found that fear memories are not rigid; the retrieval of fear memories may change over time. Furthermore, prior studies suggest that theta wave (4 Hz) activity is highly correlated with fear expression in an animal model. However, the relationship between pathological fear memory and potential brain wave features in PTSD remains largely uncharacterized. Here, we hypothesized that after traumatic stress exposure, the longitudinal dynamics of abnormal fears in PTSD animal models could be reflected by the measurement of local field potentials (LFPs). Using a well-established modified single-prolonged stress and footshock (SPS & FS) PTSD rat model, animals were restrained for 2 h and subsequently subjected to 20 min of forced swimming, then exposed to diethyl ether until they lost consciousness and placed in a conditioning chamber for fear conditioning. To characterize the temporal changes, we characterized freezing behavior brain wave features during the conditioning chamber re-exposure in the early (10 and 30 min; 2, 4, and 6 h) and late (day 1, 3, 7, and 14) phases after traumatic stress exposure. Our results indicate that SPS & FS rats showed co-morbid PTSD phenotypes including significantly higher levels of anxiety-, depression-, and anhedonia-like behaviors, and impaired fear extinction. Delta wave (0.5-4 Hz) suppression in the medial prefrontal cortex, amygdala, and ventral hippocampus occurred 10 and 30 min after traumatic stress, followed by continuous delta wave activity from 2 h to day 14, correlating with fear levels. tDCS reduced delta activity and alleviated PTSD-like phenotypes in the SPS & FS group. In this study, profiling abnormal fears with brain wave correlates may improve our understanding of time-dependent pathological fear memory retrieval in PTSD and facilitate the development of effective intervention strategies.
RESUMEN
Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.
Asunto(s)
Neoplasias de la Mama , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B , Humanos , Femenino , Ribonucleoproteína Nuclear Heterogénea A1/genética , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/genética , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/metabolismo , Neoplasias de la Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Empalme Alternativo , Exones/genética , Proteínas de la Membrana/genética , Proteínas de la Membrana/metabolismo , Proteínas Supresoras de Tumor/metabolismoRESUMEN
A11 dopaminergic neurons regulate somatosensory transduction by projecting from the diencephalon to the spinal cord, but the function of this descending projection in itch remained elusive. Here, we report that dopaminergic projection neurons from the A11 nucleus to the spinal dorsal horn (dopaminergicA11-SDH ) are activated by pruritogens. Inhibition of these neurons alleviates itch-induced scratching behaviors. Furthermore, chemogenetic inhibition of spinal dopamine receptor D1-expressing (DRD1+ ) neurons decreases acute or chronic itch-induced scratching. Mechanistically, spinal DRD1+ neurons are excitatory and mostly co-localize with gastrin-releasing peptide (GRP), an endogenous neuropeptide for itch. In addition, DRD1+ neurons form synapses with GRP receptor-expressing (GRPR+ ) neurons and activate these neurons via AMPA receptor (AMPAR). Finally, spontaneous itch and enhanced acute itch induced by activating spinal DRD1+ neurons are relieved by antagonists against AMPAR and GRPR. Thus, the descending dopaminergic pathway facilitates spinal itch transmission via activating DRD1+ neurons and releasing glutamate and GRP, which directly augments GRPR signaling. Interruption of this descending pathway may be used to treat chronic itch.
Asunto(s)
Receptores de Bombesina , Médula Espinal , Humanos , Receptores de Bombesina/genética , Receptores de Bombesina/metabolismo , Péptido Liberador de Gastrina/genética , Péptido Liberador de Gastrina/metabolismo , Médula Espinal/metabolismo , Ácido Glutámico/metabolismo , Dopamina/metabolismo , Prurito/genética , Prurito/metabolismo , Neuronas Dopaminérgicas/metabolismo , Receptores AMPA/genética , Receptores AMPA/metabolismoRESUMEN
BACKGROUND: Massive pulmonary embolism (PE) results in extremely high mortality rates. Veno-arterial extracorporeal membrane oxygenation (VA-ECMO) can provide circulatory and oxygenation support and rescue patients with massive PE. However, there are relatively few studies of extracorporeal cardiopulmonary resuscitation (ECPR) in patients with cardiac arrest (CA) secondary to PE. The aim of the present study is to investigate the clinical use of ECPR in conjunction with heparin anticoagulation in patients with CA secondary to PE. CASE SUMMARY: We report the cases of six patients with CA secondary to PE treated with ECPR in the intensive care unit of our hospital between June 2020 and June 2022. All six patients experienced witnessed CA whilst in hospital. They had acute onset of severe respiratory distress, hypoxia, and shock rapidly followed by CA and were immediately given cardiopulmonary resuscitation and adjunctive VA-ECMO therapy. During hospitalization, pulmonary artery computed tomography angiography was performed to confirm the diagnosis of PE. Through anticoagulation management, mechanical ventilation, fluid management, and antibiotic treatment, five patients were successfully weaned from ECMO (83.33%), four patients survived for 30 d after discharge (66.67%), and two patients had good neurological outcomes (33.33%). CONCLUSION: For patients with CA secondary to massive PE, ECPR in conjunction with heparin anticoagulation may improve outcomes.
RESUMEN
BACKGROUND: To explore the hematological toxicity (HT) induced by neoadjuvant chemoradiotherapy (nCRT) compared with neoadjuvant chemotherapy (nCT) and to identify the appropriate vertebral body (VB) dosimetric parameters for predicting HT in patients with locally advanced gastric cancer (GC). METHODS: In the phase III study, 302 patients with GC from an ongoing multi-center randomized clinical trial (NCT01815853) were included. Patients from two major centers were grouped into training and external validation cohorts. The nCT group received three cycles of XELOX chemotherapy, while the nCRT received the same dose-reduced chemotherapy plus 45 Gy radiotherapy. The complete blood counts at baseline, during neoadjuvant treatment, and in the preoperative period were compared between the nCT and nCRT groups. The VB was retrospectively contoured and the dose-volume parameters were extracted in the nCRT group. Patients' clinical characteristics, VB dosimetric parameters, and HTs were statistically analyzed. Instances of HT were graded according to the Common Terminology Criteria for Adverse Events v5.0 (CTCAE v5.0). The receiver operating characteristic (ROC) curves were generated to identify the optimal cut-off points for dosimetric variables and verify the prediction efficiency of the dosimetric index in both training and external validation cohorts. RESULTS: In the training cohort, 27.4% Grade 3 + HTs were noted in the nCRT group and 16.2% in the nCT group (P = 0.042). A similar result was exhibited in the validation cohort, with 35.0% Grade 3 + HTs in the nCRT group and 13.2% in the nCT group (P = 0.025). The multivariate analysis of the training cohort revealed that V5 was associated with Grade 3 + leukopenia (P = 0.000), Grade 3 + thrombocytopenia (P = 0.001), and Grade 3 + total HTs (P = 0.042). The Spearman correlation analysis identified a significant correlation of V5 with the white blood cell nadir (P = 0.0001) and platelet nadir (P = 0.0002). The ROC curve identified the optimal cut-off points for V5 and showed that V5 < 88.75% could indicate a decreased risk of Grade 3 + leukopenia, thrombocytopenia, and total HTs in the training as well as the external validation cohorts. CONCLUSIONS: Compared with nCT, nCRT could increase the risk of Grade 3 + HT in patients with locally advanced GC. Dose constraints of V5 < 88.75% in irradiated VB could reduce the incidence of Grade 3 + HT.
Asunto(s)
Leucopenia , Neoplasias Gástricas , Trombocitopenia , Humanos , Estudios Retrospectivos , Neoplasias Gástricas/tratamiento farmacológico , Neoplasias Gástricas/radioterapia , Quimioradioterapia/efectos adversos , Trombocitopenia/inducido químicamente , Trombocitopenia/complicaciones , Leucopenia/etiología , Terapia Neoadyuvante/efectos adversosRESUMEN
OBJECTIVES: To study the efficacy and safety of repeated application of rituximab (RTX) at a low dose (200 mg/m2) versus the recommended dose (375 mg/m2) for remission maintenance in frequently relapsing nephrotic syndrome (FRNS) or steroid-dependent nephrotic syndrome (SDNS). METHODS: A randomized controlled trial was conducted for 29 children with FRNS/SDNS who received systemic treatment in the Department of Nephrology, Anhui Provincial Children's Hospital, from September 2020 to December 2021. These children were divided into a recommended dose group (n=14) and a low dose group (n=15) using a random number table. The two groups were compared in terms of general characteristics, changes in CD19 expression after RTX treatment, number of relapses, glucocorticoid dose, adverse reactions of RTX, and hospital costs. RESULTS: After RTX treatment, both the low dose group and the recommended dose group achieved B-lymphocyte depletion and had significant reductions in the number of relapses and glucocorticoid dose (P<0.05). The low dose group had a comparable clinical effect to the recommended dose group after RTX treatment (P>0.05), and the low dose group had a significant reduction in hospital costs for the second, third, and fourth times of hospitalization (P<0.05). There were no serious adverse reactions in either group during RTX treatment and late follow-up, and there was no significant difference in adverse reactions between the two groups (P>0.05). CONCLUSIONS: Repeated RTX treatment at a low dose has comparable clinical efficacy and safety to that at the recommended dose and can significantly reduce the number of FRNS/SDNS relapses and the amount of glucocorticoids used, with little adverse effect throughout the treatment cycle. Therefore, it holds promise for clinical application.
Asunto(s)
Síndrome Nefrótico , Humanos , Niño , Síndrome Nefrótico/tratamiento farmacológico , Rituximab/efectos adversos , Glucocorticoides/efectos adversos , Estudios Prospectivos , Proteínas Adaptadoras Transductoras de SeñalesRESUMEN
OBJECTIVES: To assess LRP5-/6 gene polymorphisms and its association with risk of abnormal bone mass (ABM) in postmenopausal women. METHODS: The study recruited 166 patients with ABM (case group) and 106 patients with normal bone mass (control group) based on bone mineral density (BMD) results. Multi-factor dimensionality reduction (MDR) was used to analyze the interaction between the Low-density lipoprotein receptor-related protein 5 (LRP5) gene (rs41494349, rs2306862) and the Low-density lipoprotein receptor-related protein 6 (LRP6) gene (rs10743980, rs2302685) and the subjects' clinical characteristics of age and menopausal years. RESULTS: (1) Logistic regression analysis showed that the subjects with the CT or TT genotype at rs2306862 had a higher risk of ABM than those with the CC genotype (OR = 2.353, 95%CI = 1.039-6.186; OR = 2.434, 95%CI = 1.071, 5.531; P < 0.05). The subjects with the TC genotype at rs2302685 had a higher risk of ABM than those with the TT genotype (OR = 2.951, 95%CI = 1.030-8.457, P < 0.05). (2) When taking the three Single-nucleotide polymorphisms (SNPs) together, the accuracy was the highest with the cross-validation consistency of 10/10 (OR = 1.504, 95%CI:1.092-2.073, P < 0.05), indicating that the LRP5 rs41494349 and LRP6 rs10743980, rs2302685 were interactively associated with the risk of ABM. (3) Linkage disequilibrium (LD) results revealed that the LRP5 (rs41494349,rs2306862) were in strong LD (D' > 0.9, r2 > 0.3). AC and AT haplotypes were significantly more frequently distributed in the ABM group than in the control group, indicating that subjects carrying the AC and AT haplotypes were associated with an increased risk of ABM (P < 0.01). (4) MDR showed that rs41494349 & rs2302685 & rs10743980 & age were the best model for ABM prediction. The risk of ABM in "high-risk combination" was 1.00 times that of "low-risk combination"(OR = 1.005, 95%CI: 1.002-1.008, P < 0.05). (5) MDR showed that there was no significant association between any of the SNPs and menopausal years and ABM susceptibility. CONCLUSION: These findings indicate that LRP5-rs2306862 and LRP6-rs2302685 polymorphisms and gene-gene and gene-age interactions may increase the risk of ABM in postmenopausal women. There was no significant association between any of the SNPs and menopausal years and ABM susceptibility.
Asunto(s)
Densidad Ósea , Proteína-5 Relacionada con Receptor de Lipoproteína de Baja Densidad , Femenino , Humanos , Densidad Ósea/genética , Genotipo , Proteína-5 Relacionada con Receptor de Lipoproteína de Baja Densidad/genética , Polimorfismo de Nucleótido Simple/genética , Posmenopausia/genéticaRESUMEN
Background: Few studies concentrate on spleen dosimetry of radiotherapy for gastric cancer (GC). Although there is no consensus on the spleen dose-volume threshold for lymphopenia, several studies indicated that the higher the spleen dose, the higher the risk of lymphopenia. This study aimed to identify the appropriate spleen dosimetric parameters for predicting grade 4 + lymphopenia in patients with locally advanced GC. Material and methods: A total of 295 patients treated with nCRT and nChT from June 2013 to December 2021 at two major centers were included, of whom 220 were assigned to the training cohort and 75 to the external validation cohort. Results: Grade 4 + lymphopenia was more common in the nCRT than in the nChT group (49.5% vs. 0, P < 0.001 in the training cohort; 25.0% vs. 0, P = 0.001 in the external validation cohort). Age ≥ 60 years (P = 0.006), lower pretreatment absolute lymphocyte count (P = 0.001), higher spleen volume (SPV) (P = 0.001), and higher V20 (P = 0.003) were significant risk factors of grade 4 + lymphopenia for patients treated with nCRT. Patients with grade 4 + lymphopenia had significantly worse PFS (P = 0.043) and showed a negative correlation trend with OS (P = 0.07). Limiting V20 to < 84.5% could decrease the incidence of grade 4 + lymphopenia by 35.7%. The predictive effectiveness of the multivariable model in the training and external validation cohorts was 0.880 and 0.737, respectively. Conclusion: Grade 4 + lymphopenia during nCRT was more common than nChT, and was associated with a worse PFS in GC patients. Constraining the spleen V20 to < 84.5% may indirectly improve outcomes through lymphocyte preservation.
RESUMEN
The formation of one unavoidable byproduct in traditional disproportionation reactions limits their applications in synthesis. Inspired by convergent disproportionation, we develop an iodine-induced cyclization and oxidation of allylic alcohols to produce highly functionalized bicyclo[3.2.1]octanes through creation of six new bonds. Guided by the mechanism, we elaborated a variety of other bicyclo[3.2.1]octanes bearing distinct groups with presynthesized dienes and enones as the starting materials. This work provides a divergent access to bicyclo[3.2.1]octane frameworks.
RESUMEN
Ferrofluids are oil-based liquids containing magnetic particles that interact with magnetic fields without solidifying. Leveraging the exploration of new applications of these promising materials (such as in optics, medicine and engineering) requires high fidelity modeling and simulation capabilities in order to accurately explore ferrofluids in silico. While recent work addressed the macroscopic simulation of large-scale ferrofluids using smoothed-particle hydrodynamics (SPH), such simulations are computationally expensive. In their work, the Kelvin force model has been used to calculate interactions between different SPH particles. The application of this model results in a force pointing outwards with respect to the fluid surface causing significant levitation problems. This drawback limits the application of more advanced and efficient SPH frameworks such as divergence-free SPH (DFSPH) or implicit incompressible SPH (IISPH). In this contribution, we propose a current loop magnetic force model which enables the fast macroscopic simulation of ferrofluids. Our new force model results in a force term pointing inwards allowing for more stable and fast simulations of ferrofluids using DFSPH and IISPH.
RESUMEN
OBJECTIVES@#To study the efficacy and safety of repeated application of rituximab (RTX) at a low dose (200 mg/m2) versus the recommended dose (375 mg/m2) for remission maintenance in frequently relapsing nephrotic syndrome (FRNS) or steroid-dependent nephrotic syndrome (SDNS).@*METHODS@#A randomized controlled trial was conducted for 29 children with FRNS/SDNS who received systemic treatment in the Department of Nephrology, Anhui Provincial Children's Hospital, from September 2020 to December 2021. These children were divided into a recommended dose group (n=14) and a low dose group (n=15) using a random number table. The two groups were compared in terms of general characteristics, changes in CD19 expression after RTX treatment, number of relapses, glucocorticoid dose, adverse reactions of RTX, and hospital costs.@*RESULTS@#After RTX treatment, both the low dose group and the recommended dose group achieved B-lymphocyte depletion and had significant reductions in the number of relapses and glucocorticoid dose (P<0.05). The low dose group had a comparable clinical effect to the recommended dose group after RTX treatment (P>0.05), and the low dose group had a significant reduction in hospital costs for the second, third, and fourth times of hospitalization (P<0.05). There were no serious adverse reactions in either group during RTX treatment and late follow-up, and there was no significant difference in adverse reactions between the two groups (P>0.05).@*CONCLUSIONS@#Repeated RTX treatment at a low dose has comparable clinical efficacy and safety to that at the recommended dose and can significantly reduce the number of FRNS/SDNS relapses and the amount of glucocorticoids used, with little adverse effect throughout the treatment cycle. Therefore, it holds promise for clinical application.
Asunto(s)
Humanos , Niño , Síndrome Nefrótico/tratamiento farmacológico , Rituximab/efectos adversos , Glucocorticoides/efectos adversos , Estudios Prospectivos , Proteínas Adaptadoras Transductoras de SeñalesRESUMEN
Ferroptosis is a unique mode of iron-dependent cell death driven by lipid peroxidation. It is characterized by morphological changes in mitochondria, including densification of mitochondrial membranes and associated reduction in the volume, rupture of outer membranes and reduction or disappearance of the mitochondrial crest, which is different from that of apoptosis, autophagy and pyroptosis. Mitochondria, as the core of cell metabolism, are important organelles for iron metabolism, lipid metabolism and energy metabolism. However, it remains controversial debates as how mitochondria participate in ferroptosis and the underlying mechanisms during its progression. This review summaries the current understanding of the occurrence and defense mechanisms of ferroptosis, and the role of mitochondria in promoting and inhibiting ferroptosis, which includes the tricarboxylic acid cycle and glycolysis, reactive oxygen species, and lipid metabolism in mitochondria and their roles in driving ferroptosis. Moreover, we also summarize the defense mechanisms against ferroptosis through detoxification of mitochondrial lipid peroxidation by mitochondrial dihydroorotate dehydrogenase, as well as mitochondrial ferritin. Other mitochondrial molecules and their regulation of ferroptosis is stated at the end. This paper reviews the latest research progress of mitochondria in the process of ferroptosis, which aims to further understand the function of mitochondria in ferroptosis and its mechanism in the occurrence and development of ferroptosis, and therefore provides a theoretical foundation for the basic research of cell biology and strategies for investigation of clinical diseases.