Model-based estimation of QT intervals of mouse fetal electrocardiogram.

BACKGROUND: Abnormal prolongation in the QT interval or long QT syndrome (LQTS) is associated with several cardiac complications such as sudden infant death syndrome (SIDS). LQTS is believed to be linked to genetic mutations which can be understood by using animal models, such as mice models. Nevertheless, the research related to fetal QT interval in mice is still limited because of challenges associated with T wave measurements in fetal electrocardiogram (fECG). Reliable measurement of T waves is essential for estimating their end timings for QT interval assessment. RESULTS: A mathematical model was used to estimate QT intervals. Estimated QT intervals were validated with Q-aortic closure (Q-Ac) intervals of Doppler ultrasound (DUS) and comparison between both showed good agreement with a correlation coefficient higher than 0.88 (r > 0.88, P < 0.05). CONCLUSION: Model-based estimation of QT intervals can help in better understanding of QT intervals in fetal mice.

To assess the co-relation between corrected qt interval prolongation and abnormal scan during vasodilator nuclear stress test.

In the detection of coronary heart diseases amongst the non-invasive techniques the role of myocardial perfusion imaging is indexed. The rationale of this study was to compare the different parameters and the association between the exercise MPI and vasodilator MPI in the detection of coronary artery disease (that is prolonged Qt interval with the size of perfusion defects). It was a cross-sectional prospective study with purposive non-probability sampling technique which was conducted in a tertiary care hospital from January 2020 to June 2020 for a period of 6 months. All patients regardless of gender were included in this study and age ranging from 30 to 80 years with comorbidities ranging from diabetes, hypertension and smokers were also included. A total of 100 patients were included in this study out of which 81% were male, 50% were diabetics, 69% were hypertensive, 39% had a history of coronary artery disease, 25% were smokers and 63% had hyperlipidemia. For statistical analysis SPSS 21 was applied and significant association was observed between DTS treadmill score and the perfusion defect in vasodilator MPI, corrected Qt interval and DTS tread mill score and between corrected Qt and size of the perfusion defect (P value < 0.001). It was thus seen that the different components of the noninvasive nuclear stress test tend to co-relate and thus aid in the detection of coronary artery disease increasing the accuracy of results.

Incremental value of QT interval for the prediction of obstructive coronary artery disease in patients with chest pain.

Identification of obstructive coronary artery disease (OCAD) in patients with chest pain is a clinical challenge. The value of corrected QT interval (QTc) for the prediction of OCAD has yet to be established. We consecutively enrolled 1741 patients with suspected angina. The presence of obstructive OCAD was defined as ≥ 50% diameter stenosis by coronary angiography. The pre-test probability was evaluated by combining QTc prolongation with the CAD Consortium clinical score (CAD2) and the updated Diamond-Forrester (UDF) score. OCAD was detected in 661 patients (38.0%). QTc was longer in patients with OCAD compared with those without OCAD (444 ± 34 vs. 429 ± 28 ms, p < 0.001). QTc was increased by the severity of OCAD (P < 0.001). QTc prolongation was associated with OCAD (odds ratio (OR), 2.27; 95% confidence interval (CI), 1.81-2.85). With QTc, the C-statistics increased significantly from 0.68 (95% CI 0.66-0.71) to 0.76 (95% CI 0.74-0.78) in the CAD2 and from 0.64 (95% CI 0.62-0.67) to 0.74 (95% CI 0.72-0.77) in the UDF score, respectively. QT prolongation predicted the presence of OCAD and the QTc improved model performance to predict OCAD compared with CAD2 or UDF scores in patients with suspected angina.

Towards Mutation-Specific Precision Medicine in Atypical Clinical Phenotypes of Inherited Arrhythmia Syndromes.

Most causal genes for inherited arrhythmia syndromes (IASs) encode cardiac ion channel-related proteins. Genotype-phenotype studies and functional analyses of mutant genes, using heterologous expression systems and animal models, have revealed the pathophysiology of IASs and enabled, in part, the establishment of causal gene-specific precision medicine. Additionally, the utilization of induced pluripotent stem cell (iPSC) technology have provided further insights into the pathophysiology of IASs and novel promising therapeutic strategies, especially in long QT syndrome. It is now known that there are atypical clinical phenotypes of IASs associated with specific mutations that have unique electrophysiological properties, which raises a possibility of mutation-specific precision medicine. In particular, patients with Brugada syndrome harboring an SCN5A R1632C mutation exhibit exercise-induced cardiac events, which may be caused by a marked activity-dependent loss of R1632C-Nav1.5 availability due to a marked delay of recovery from inactivation. This suggests that the use of isoproterenol should be avoided. Conversely, the efficacy of ß-blocker needs to be examined. Patients harboring a KCND3 V392I mutation exhibit both cardiac (early repolarization syndrome and paroxysmal atrial fibrillation) and cerebral (epilepsy) phenotypes, which may be associated with a unique mixed electrophysiological property of V392I-Kv4.3. Since the epileptic phenotype appears to manifest prior to cardiac events in this mutation carrier, identifying KCND3 mutations in patients with epilepsy and providing optimal therapy will help prevent sudden unexpected death in epilepsy. Further studies using the iPSC technology may provide novel insights into the pathophysiology of atypical clinical phenotypes of IASs and the development of mutation-specific precision medicine.

Syncope due to non-sustained episodes of Torsade de Pointes associated to androgen-deprivation therapy use: a case presentation.

BACKGROUND: Abiraterone is a medication frequently used for metastatic castrate-resistant prostate cancer. We report a case of non-sustained episodes of TdP associated with severe hypokalemia due to androgen-deprivation therapy. Few case presentations describe this association; the novelty lies in the potentially lethal cardiovascular events among cancer patients receiving hormonal therapy. CASE PRESENTATION: A 70-year-old male presented with recurrent syncope without prodrome. ECG revealed frequent ventricular ectopy, non-sustained episodes of TdP, and severe hypomagnesemia and hypokalemia. During potassium and magnesium infusion for repletion, the patient underwent temporary transvenous atrial pacing. As part of the work-up, coronary angiography revealed a mild coronary artery disease, and transthoracic echocardiogram showed a moderately depressed ejection fraction. After electrolyte disturbances were corrected, the QT interval normalized, and transvenous pacing was no longer necessary. Abiraterone was discontinued during the admission, and the patient returned to baseline. CONCLUSIONS: Cancer treatment is complex and requires a multidisciplinary approach. We presented a case of non-sustained TdP associated with androgen-deprivation therapy in an elderly patient with mild coronary artery disease and moderately reduced ejection fraction. Close follow-up and increased awareness are required in patients with hormonal treatment, especially in the setting of other cardiovascular risk factors.

Epicardial adipose tissue predicted prolonged QTc interval in patients with arterial hypertension.

Introduction: It is important to identify those at higher risk for ventricular arrhythmia among hypertensive patients. Epicardial adipose tissue (EAT) leads to electromechanical changes in the heart by endocrine and paracrine effects with cytokines and mediators. Higher amount of EAT carries the risk of QT prolongation. Therefore, we investigated the association between EAT thickness and QTc interval in patients with arterial hypertension. Methods: A total of 230 patients who previously diagnosed with arterial hypertension between February 2019 to March 2020 were included in the study. Patients with atrial fibrillation, U-wave, atrioventricular block, left anterior or posterior fascicular block, right bundle branch block, left bundle branch block, and taking QT-prolonging medication were excluded. The corrected QT (QTc) interval was calculated with Bazzet's formula following the calculated QT interval in the semi-automatic application tool. EAT was measured at the point on the free wall of the right ventricle using transthoracic echocardiography. Results: The mean age was 62.1 ± 11.4 years and 95 (41.3%) of the patients were male. QTc was over 450 ms were considered as the prolonged interval. Both groups were similar in terms of age (p = .862), gender (p = .265) and other demographic characteristics. Left ventricle mass index (LVMI) (82.5 ± 29.5 vs 91.9 ± 32.6 g/1.7.m2, p = .051) and EAT thickness (5.3 ± 2.3 vs 6.6 ± 2.6 mm, p = .001) were higher in the prolonged QTc group. Serum potassium (K) level was lesser in the prolonged QTc group (4.2 ± 0.39 vs 4.1 ± 0.4 mmol/mL, p = .005). Multivariate Cox regression analysis revealed that EAT thickness [OR = 1.227, 95% CI: 1.081-1.393, p = .002] and serum K level [OR = 0.348, 95% CI: 0.157-0.772, p = .009] predicted the prolonged QTc interval, independently. Conclusion: EAT thickness predicted prolonged QTc interval in patients with arterial hypertension. Patients with higher amount of EAT should be followed by closely monitoring to prevent arrhythmic events that may develop in the future. In addition, medications that have a potential effect on QTc interval prolongation may be carefully used in patients with higher EAT thickness.

Echocardiography-Guided Risk Stratification for Long QT Syndrome.

BACKGROUND: The ability to identify those patients at the highest phenotypic risk for long QT syndrome (LQTS)-associated life-threatening cardiac events remains suboptimal. OBJECTIVES: This study sought to validate the association between electromechanical window (EMW) negativity, as derived from echocardiography, and symptomatic versus asymptomatic status in patients with LQTS. METHODS: We analyzed a cohort of 651 patients with LQTS (age 26 ± 17 years; 60% females; 158 symptomatic; 51% LQTS type 1; 33% LQTS type 2; 11% LQTS type 3; 5% multiple mutations) and 50 healthy controls. EMW was calculated as the difference between the interval from QRS onset to aortic valve closure midline, as derived for continuous-wave Doppler, and the electrocardiogram-derived QT interval for the same beat. RESULTS: A negative EMW was found among nearly all patients with LQTS compared to controls, with more profound EMW negativity in patients with symptomatic LQTS compared to those with asymptomatic LQTS (-52 ± 38 ms vs. -18 ± 29 ms; p < 0.0001). Logistic regression identified EMW, heart rate-corrected QT interval (QTc), female sex, and LQTS genotype as univariate predictors of symptomatic status. After multivariate analysis, EMW remained an independent predictor of symptomatic status (odds ratio for each 10-ms decrease in EMW: 1.37; 95% confidence interval: 1.27 to 1.48; p < 0.0001). EMW outperformed QTc in predicting symptomatic patients (area under the curve: 0.78 vs. 0.70; p = 0.01). After training and implementation, EMW correlation from echocardiographic sonographers showed excellent reliability (intraclass correlation coefficient: 0.93; 95% confidence interval: 0.89 to 0.96). CONCLUSIONS: In this validation study, patients with a history of LQTS-associated life-threatening cardiac events had a more profoundly negative EMW. EMW outperformed heart rate-corrected QT interval as a predictor of symptomatic status. EMW is now a clinically validated risk factor. In December 2019, our institution's echocardiography clinical practice committee approved use of EMW for patients with LQTS, making it a routinely reported echocardiographic finding.

Pseudo-colouring an ECG enables lay people to detect QT-interval prolongation regardless of heart rate.

Drug-induced long QT syndrome (diLQTS), characterized by a prolongation of the QT-interval on the electrocardiogram (ECG), is a serious adverse drug reaction that can cause the life-threatening arrhythmia Torsade de Points (TdP). Self-monitoring for diLQTS could therefore save lives, but detecting it on the ECG is difficult, particularly at high and low heart rates. In this paper, we evaluate whether using a pseudo-colouring visualisation technique and changing the coordinate system (Cartesian vs. Polar) can support lay people in identifying QT-prolongation at varying heart rates. Four visualisation techniques were evaluated using a counterbalanced repeated measures design including Cartesian no-colouring, Cartesian pseudo-colouring, Polar no-colouring and Polar pseudo-colouring. We used a multi-reader, multi-case (MRMC) receiver operating characteristic (ROC) study design within a psychophysical paradigm, along with eye-tracking technology. Forty-three lay participants read forty ECGs (TdP risk n = 20, no risk n = 20), classifying each QT-interval as normal/abnormal, and rating their confidence on a 6-point scale. The results show that introducing pseudo-colouring to the ECG significantly increased accurate detection of QT-interval prolongation regardless of heart rate, T-wave morphology and coordinate system. Pseudo-colour also helped to reduce reaction times and increased satisfaction when reading the ECGs. Eye movement analysis indicated that pseudo-colour helped to focus visual attention on the areas of the ECG crucial to detecting QT-prolongation. The study indicates that pseudo-colouring enables lay people to visually identify drug-induced QT-prolongation regardless of heart rate, with implications for the more rapid identification and management of diLQTS.

QT prolongation in a diverse, urban population of COVID-19 patients treated with hydroxychloroquine, chloroquine, or azithromycin.

PURPOSE: Hydroxychloroquine, chloroquine, and azithromycin have been used for treatment of COVID-19, but may cause QT prolongation. Minority populations are disproportionately impacted by COVID-19. This study evaluates the risk of QT prolongation and subsequent outcomes after administration of these medications in largely underrepresented minority COVID-19 patients. METHODS: We conducted an observational study on hospitalized COVID-19 patients in the Montefiore Health System (Bronx, NY). We examined electrocardiograms (ECG) pre/post-medication initiation to evaluate QTc, HR, QRS duration, and presence of other arrhythmias. RESULTS: One hundred five patients (mean age 67 years; 44.8% F) were analyzed. The median time from the first dose of any treatment to post-medication ECG was 2 days (IQR: 1-3). QTc in men increased from baseline (440 vs 455 ms, p < 0.001), as well as in women (438 vs 463 ms, p < 0.001). The proportion of patients with QT prolongation increased significantly (14.3% vs 34.3%, p < 0.001) even when adjusted for electrolyte abnormalities. The number of patients whose QTc > 500 ms was significantly increased after treatment (16.2% vs. 4.8%, p < 0.01). Patients with either QTc > 500 ms or an increase of 60 ms had a higher frequency of death (47.6% vs. 22.6%, p = 0.02) with an odds ratio of 3.1 (95% CI: 1.1-8.7). Adjusting for race/ethnicity yielded no significant associations. CONCLUSIONS: Hydroxychloroquine, chloroquine, and/or azithromycin were associated with QTc prolongation but did not result in fatal arrhythmias. Our findings suggest that any harm is unlikely to outweigh potential benefits of treatment. Careful risk-benefit analyses for individual patients should guide the use of these medications. Randomized control trials are necessary to evaluate their efficacies.

Noninvasive Fetal Electrocardiography in the Diagnosis of Long QT Syndrome: A Case Series.

INTRODUCTION: Early detection and monitoring for malignant arrhythmias is fundamental to prenatal care in long QT syndrome (LQTS). Recently, we studied the feasibility of isolating the fetal electrocardiogram (fECG) and measuring electrocardiographic intervals with a noninvasive fECG device using blind source separation with reference signal. Our aim was to evaluate the ability of fECG to diagnose LQTS. CASE PRESENTATIONS: We identified 3 cases of clinically suspected LQTS based on fetal echocardiogram (2 had sinus bradycardia, 1 had second-degree atrioventricular block with negative maternal anti-SSA/SSB antibody titers). With institutional review board approval, these patients were prospectively enrolled for fECG acquisition. Offline post-processing generated fECG waveforms and calculated QT intervals. Case 1 and 3 had a maternal history of LQTS. Two of the three fetuses with suspected LQTS had confirmed LQTS by postnatal ECG and genetic testing. FECG was able to identify a prolonged corrected QT interval in both cases. One of these also had fetal magnetocardiography (fMCG), which yielded similar findings to the fECG. The third fetus had a normal fECG; fMCG and postnatal ECG were also normal. CONCLUSIONS: In 3 cases, fECG findings corroborated the diagnosis of LQTS. Noninvasive fECG may offer a novel method for fECG that is portable and more clinically accessible.

Prolonged left ventricular contraction duration in apical segments as a marker of arrhythmic risk in patients with long QT syndrome.

AIMS: Long QT syndrome (LQTS) is an inherited cardiac ion channelopathy predisposing to life-threatening ventricular arrhythmias and sudden cardiac death. The aim of this study was to investigate left ventricular mechanical abnormalities in LQTS patients and establish a potential role of strain as a marker of arrhythmic risk. METHODS AND RESULTS: We included 47 patients with genetically confirmed LQTS (22 LQT1, 20 LQT2, 3 LQT3, and 2 SCN3B) and 25 healthy controls. A history of cardiac events was present in 30 LQTS subjects. Tissue Doppler and speckle tracking echocardiography were performed and contraction duration was measured by radial and longitudinal strain. The radial strain characteristic was subdivided into two planes - the basal and the apical. Left ventricular ejection fraction and global longitudinal strain were normal in LQTS patients. Mean contraction duration was longer in LQTS patients compared with controls in regard to basal radial strain (491 ± 57 vs. 437 ± 55 ms, P < 0.001), apical radial strain (450 ± 53 vs. 407 ± 53 ms, P = 0.002), and longitudinal strain (445 ± 34 vs. 423 ± 43 ms, P = 0.02). Moreover, contraction duration obtained from apical radial strain analysis was longer in symptomatic compared with asymptomatic LQTS mutation carriers (462 ± 49 vs. 429 ± 55 ms, P = 0.024), as well as in subject with mutations other than LQT1 considered to be at higher risk (468 ± 50 vs. 429 ± 49 ms, P = 0.01). CONCLUSION: Myocardial contraction duration is prolonged for both radial and longitudinal directions in LQTS patients. Regional left ventricular function analysis may contribute to risk stratification. Apical radial deformation seems to select subjects at higher risk of arrhythmic events.

COVID-19 and cardiac arrhythmias: a global perspective on arrhythmia characteristics and management strategies.

BACKGROUND: Cardiovascular and arrhythmic events have been reported in hospitalized COVID-19 patients. However, arrhythmia manifestations and treatment strategies used in these patients have not been well-described. We sought to better understand the cardiac arrhythmic manifestations and treatment strategies in hospitalized COVID-19 patients through a worldwide cross-sectional survey. METHODS: The Heart Rhythm Society (HRS) sent an online survey (via SurveyMonkey) to electrophysiology (EP) professionals (physicians, scientists, and allied professionals) across the globe. The survey was active from March 27 to April 13, 2020. RESULTS: A total of 1197 respondents completed the survey with 50% of respondents from outside the USA, representing 76 countries and 6 continents. Of respondents, 905 (76%) reported having COVID-19-positive patients in their hospital. Atrial fibrillation was the most commonly reported tachyarrhythmia whereas severe sinus bradycardia and complete heart block were the most common bradyarrhythmias. Ventricular tachycardia/ventricular fibrillation arrest and pulseless electrical activity were reported by 4.8% and 5.6% of respondents, respectively. There were 140 of 631 (22.2%) respondents who reported using anticoagulation therapy in all COVID-19-positive patients who did not otherwise have an indication. One hundred fifty-five of 498 (31%) reported regular use of hydroxychloroquine/chloroquine (HCQ) + azithromycin (AZM); concomitant use of AZM was more common in the USA. Sixty of 489 respondents (12.3%) reported having to discontinue therapy with HCQ + AZM due to significant QTc prolongation and 20 (4.1%) reported cases of Torsade de Pointes in patients on HCQ/chloroquine and AZM. Amiodarone was the most common antiarrhythmic drug used for ventricular arrhythmia management. CONCLUSIONS: In this global survey of > 1100 EP professionals regarding hospitalized COVID-19 patients, a variety of arrhythmic manifestations were observed, ranging from benign to potentially life-threatening. Observed adverse events related to use of HCQ + AZM included prolonged QTc requiring drug discontinuation as well as Torsade de Pointes. Large prospective studies to better define arrhythmic manifestations as well as the safety of treatment strategies in COVID-19 patients are warranted.

Recommendations for the measurement of the QT interval during the use of drugs for COVID-19 infection treatment. Updatable in accordance with the availability of new evidence.

COVID-19 infection has shown rapid growth worldwide, and different therapies have been proposed for treatment, in particular, the combination of immune response modulating drugs such as chloroquine and hydroxychloroquine (antimalarials) alone or in combination with azithromycin. Although the clinical evidence supporting their use is scarce, the off label use of these drugs has spread very quickly in face of the progression of the epidemic and the high mortality rate in susceptible populations. However, these medications can pathologically prolong the QT interval and lead to malignant ventricular arrhythmias such that organized guidance on QT evaluation and management strategies are important to reduce morbidity associated with the potential large-scale use.

Hipoglucemia secundaria a hiperinsulinismo en un paciente con síndrome de QT largo congénito / Hipoglycemia secondary to hyperinsulinism in a patient with congenital long QT syndrome

No disponible

Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases.

INTRODUCTION: Long QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KCNH2 gene. Up to date, >900 mutations have been reported to be related to LQT2. However, mutational screening of the KCNH2 gene is still far from completeness. Identification of KCNH2 mutations is particularly important in diagnosis of LQT2 and will gain more insights into the molecular basis for the pathogenesis of LQT2. PATIENT CONCERNS: A Chinese Han family with LQTS phenotypes was examined. DIAGNOSIS: A novel deletion-frameshift mutation, c.381_408delCAATTTCGAGGTGGTGATGGAGAAGGAC, in exon 3 of KCNH2 gene was identified in a Chinese family with LQTS. On the basis of this finding and clinical manifestations, the final diagnosis of LQT2 was made. INTERVENTIONS: Next-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the LQTS-related genes on the proband and her mother, which was confirmed by Sanger sequencing. The proband was then implanted with an implantable cardioverter defibrillator and prescribed metoprolol 47.5 mg per day. OUTCOMES: This novel heterozygous mutation results in a frameshift mutation after the 128 residue (Asparagine), which replaced the original 1031 amino acids with 27 novel amino acids (p.N128fsX156). CONCLUSION: This novel mutation presumably resulted in a frameshift mutation, p.N128fsX156. Our data expanded the mutation spectrum of KCNH2 gene and facilitated clinic diagnosis and genetic counseling for this family with LQTS.