First report of Gymnotelium blasdaleanum causing Saskatoon serviceberry rust in Canada.

Saskatoon serviceberry (Amelanchier alnifolia) is a tall shrub native to the western regions of North America. In British Columbia, serviceberries are a resource for Indigenous communities, used in cooking and for medicinal purposes (Turner et al. 1990). The Saskatoon serviceberry is popular for ornamental and food purposes, with increasing demand for commercial production in British Columbia. (FLNR, 2003). In June 2023 leaf and fruit samples displaying signs of a rust fungus were collected from three ornamental Saskatoon serviceberry shrubs on the University of British Columbia's campus in Vancouver, BC (49°15'35.0"N 123°15'05.6"W). Morphological characteristics were taken from six leaves and berries. Infected leaf tissue was misshapen due to the development of aecia on the abaxial side of the leaves. Approximately 80% of the berries were enveloped in aecia, while infected leaf tissue constituted only around 5% across all three shrubs. Aecia were aecidioid (aecidium type) 0.25 to 0.35mm in diameter, hypophylous and, fructicolous. Peridial cells had a rhomboid shape measuring 21-29 × 18-23 µm (average dimension 25 × 20 µm, n = 30). Aeciospores were globoid with yellowish walls, verrucose and the dimensions ranged from 16-24 × 12-15 µm, (average dimensions 19 ×15 µm, n = 30) (Fig. x). These morphological features fit well with description of Gymnotelium blasdaleanum (Dietel & Holw.) Arthur (= Gymnosporangium libocedri (Henn.) F. Kern) (Arthur 1934). Judging from U.S. National Fungal Databases (https://fungi.ars.usda.gov/) G. blasdaleanum has never been reported in Canada, thus this discovery represents the first report of G. blasdaleanum in the country, specifically in the province of British Columbia. G. blasdaleanum is a hetero-demicyclic rust fungus with a broad aecial host range which includes several Rosaceous genera such as Amelanchier, Crataegus, Cydonia, Malus, Pyrus, and Sorbus (Farr & Rossman 2019). The telial host range is limited to California incense cedar (Calocedrus decurrens) and was not observed on nearby trees, some located within one kilometer of the serviceberries. To confirm morphological identification, DNA was extracted from infected leaves and fruits from all three plants using a modified protocol (Russell et al., 2010). The D1/D2 region was amplified using primers LR6 and 2Rust1R (Beenken, et al., 2012). A BLASTn search of all three sequences revealed 99.52 to 99.62% identity to available sequence in GenBank from Gymnotelium blasdaleanum (AF522168). Newly generated sequences were submitted to the GenBank under accession numbers OR567878, OR568568, and OR654105. Specimens from three Saskatoon serviceberry plants were provided to the UBC herbarium (Beaty Biodiversity Museum) and deposited in their fungarium (F35820). Infected fruits undergo deformation and premature dropping, posing a significant threat to ornamental and fruit production varieties of serviceberries (EPPO, 2006). The spread and establishment of the G. blasdaleanum is highly dependent on the presence of C. decurrens because of its limited range. However, California incense cedar is planted outside its natural range in suitable environments for G. blasdaleanum to thrive such as southern BC allowing the rust pathogen to spread to Canada. To prevent potential spread into other agricultural industries, particularly the 256-acre pear cultivation, continued planting of C. decurrens in British Columbia should be closely monitored. (BC MFLNRO, 2003).

Uncovering the history of recombination and population structure in western Canadian stripe rust populations through mating type alleles.

BACKGROUND: The population structure of crop pathogens such as Puccinia striiformis f. sp. tritici (Pst), the cause of wheat stripe rust, is of interest to researchers looking to understand these pathogens on a molecular level as well as those with an applied focus such as disease epidemiology. Cereal rusts can reproduce sexually or asexually, and the emergence of novel lineages has the potential to cause serious epidemics such as the one caused by the 'Warrior' lineage in Europe. In a global context, Pst lineages in Canada were not well-characterized and the origin of foreign incursions was not known. Additionally, while some Pst mating type genes have been identified in published genomes, there has been no rigorous assessment of mating type diversity and distribution across the species. RESULTS: We used a whole-genome/transcriptome sequencing approach for the Canadian Pst population to identify lineages in their global context and evidence tracing foreign incursions. More importantly: for the first time ever, we identified nine alleles of the homeodomain mating type locus in the worldwide Pst population and show that previously identified lineages exhibit a single pair of these alleles. Consistently with the literature, we find only two pheromone receptor mating type alleles. We show that the recent population shift from the 'PstS1' lineage to the 'PstS1-related' lineage is also associated with the introduction of a novel mating type allele (Pst-b3-HD) to the Canadian population. We also show evidence for high levels of mating type diversity in samples associated with the Himalayan center of diversity for Pst, including a single Canadian race previously identified as 'PstPr' (probable recombinant) which we identify as a foreign incursion, most closely related to isolates sampled from China circa 2015. CONCLUSIONS: These data describe a recent shift in the population of Canadian Pst field isolates and characterize homeodomain-locus mating type alleles in the global Pst population which can now be utilized in testing several research questions and hypotheses around sexuality and hybridization in rust fungi.

Uromyces savulescui on statice (Limonium sinuatum) in the Americas and reevaluation of its reported geographic range.

Limonium sinuatum (Plumbaginaceae) is the most commonly cultivated recognizable cut flower crop in the genus Limonium. It is known by several common names including statice and sea lavender, due to its lilac-colored flowers and the fact that it naturally inhabits mainly coastal areas (Mellesse et al, 2013). Limonium sinuatum is native to the Mediterranean, although as a popular garden plant, has been naturalized in other parts of the world including coastal areas of California (USDA NRCS 2020). Cultivated L. sinuatum is used in fresh and dry flower arrangements in the Americas, comprising approximately 20% of the floriculture cultivated area in Ecuador (Vega and Morales 2011; Abascal Cañas 2017). In December 2014, L. sinuatum plants in the public park "Baños del Inca" in Cajamarca, Peru (S 7 9'46"; W 78 27'53"), were found infected with a rust disease. The plants were scattered in the park but infection incidence was 100% as individual plants were all found to be infected (Fig 1). Based on the percentage of symptomatic areas, including the yellow halos around pustules, calculated with ImageJ (Collins, 2007) from field photographs, the disease severity was estimated to be 58.9% in average, ranging from 19.8% up to 90.0%. Uredinia were present on both sides of the leaves as well as on stems and were roundish, oblong, pulverulent, and cinnamon brown in color; urediniospores 25.5 to 35.0 × 22.5 to 31.0 µm, were globoid to ellipsoid; urediniospore walls were cinnamon-brown, 2.5 to 3.0 µm thick, densely verrucose, with 2 to 3 equatorial germ pores. Few telia were present on leaves; these were scattered roundish or oblong, and greyish in color; teliospores 26.5 to 41.0 × 16.0 to 25.0 µm, were ellipsoid to obovoid, mostly attenuated at the apex; teliospore walls were colorless, 2-3 µm thick at sides, and up to 10 µm thick at apex. Teliospores readily germinated in sori producing basidia and basidiospores (Fig. 2). The rust features and dimensions of rust spores are consistent with available descriptions of Uromyces savulescui Rayss (Guyot 1951; Vakalounakis and Malathrakis 1987). To confirm identity, a 576 bp region of the 28S subunit of the ribosomal DNA repeat was sequenced following previously published protocols and primers (Aime 2006, Aime et al. 2018). The resulting sequence (GenBank Accession No. OR291160) shared 99.83% (573/574 bp) identity with a sequence deposited as Uromyces limonii (DC.) Lev. (accession KY764194, BPI910295, Demers et al. unpublished) from L. sinuatum in Ethiopia. However, U. limonii produces orange uredinia, thin-walled yellow-orange urediniospores, teliospores with mostly light chestnut brown wall and infects different hosts (Savile and Conners 1951). It is likely that KY764194 represents a misannotated record of U. savulescui. While Koch's postulates can be a useful tool for establishing causality in certain infectious diseases, their use may be limited when it comes to rust diseases based on old herbarium specimens. In our case, due to the age of the specimen, which is almost nine years old, various other methods were employed to identify the pathogen. These methods included microscopic examination for morphological criteria of the urediniospores and teliospores, as well as molecular techniques like 28S rDNA sequencing. Rust disease on L. sinuatum has been previously reported in Ecuador but the causal agent was identified as a Puccinia sp. and reported that the rust was able to destroy entire plots in humid conditions (Vega and Morales 2011). Whether this report also represent U. savulescui is not certain, but given that the urediniospores of Puccinia species are generally 2-celled, it is unlikely. García-Hernández et al. (2008) reported U. limonii on Limonium spp. from Chile, and Coca (2020) also reported U. limonii on Limonium sp., from Bolivia. However, judging from the photomicrographs (Coca 2020), the rust in the latter report is definitely U. savulescui and not U. limonii. Uromyces savulescui has been previously reported from the Mediterranean region and the Canary Islands (Vakalounakis and Malathrakis 1987). To our knowledge there is no report of this rust in the Americas, excepting the probable misidentifications already listed herein. The specimen has been deposited in the Arthur Fungarium at Purdue University as PURN15037.

Substantial lifetime enhancement for Si-based photoanodes enabled by amorphous TiO2 coating with improved stoichiometry.

Amorphous titanium dioxide (TiO2) film coating by atomic layer deposition (ALD) is a promising strategy to extend the photoelectrode lifetime to meet the industrial standard for solar fuel generation. To realize this promise, the essential structure-property relationship that dictates the protection lifetime needs to be uncovered. In this work, we reveal that in addition to the imbedded crystalline phase, the presence of residual chlorine (Cl) ligands is detrimental to the silicon (Si) photoanode lifetime. We further demonstrate that post-ALD in-situ water treatment can effectively decouple the ALD reaction completeness from crystallization. The as-processed TiO2 film has a much lower residual Cl concentration and thus an improved film stoichiometry, while its uniform amorphous phase is well preserved. As a result, the protected Si photoanode exhibits a substantially improved lifetime to ~600 h at a photocurrent density of more than 30 mA/cm2. This study demonstrates a significant advancement toward sustainable hydrogen generation.

First report of Fusarium graminearum causing Fusarium Head Blight (FHB) of wheat and barley in Lower Mainland of British Columbia, Canada.

Fusarium head blight (FHB), predominantly caused by Fusarium graminearum is one of the most economically important fungal diseases of small-grain cereals. Since the early 1990s, FHB has been a devastating wheat disease in parts of Canada and the United States, causing significant economic impacts on the cereal grain industry through reduced seed quality and yield, and grain contamination with fungal toxins (Brar et al. 2019). Spikes of wheat and barley with bleached spikelets and pinkish coloration were observed with low incidence and high severity in August 2021 field stripe rust nursery at UBC Totem Plant Science Farm in Vancouver, Canada (Supplementary File 1). FHB-like Symptomatic spikes were collected during the growing season. The Fusarium damaged kernels (FDK) were surface-sterilized with 1% sodium hypochlorite (NaOCl) for 1.5 min, rinsed three times in distilled water and dried using sterile filter paper discs in Biological Safety Cabinet. The kernels were placed on Petri dishes containing three layers of moist blotter papers and incubated in the dark at 22-25°C for 24 hours. The Petri dishes were transferred into a -20°C freezer for 24 hours, followed by five days of incubation at 22-25°C under fluorescent light, during which distilled water was added onto blotter papers every day to maintain moisture. After incubation, mycelium growing on kernels was transferred to potato dextrose agar (PDA) media and subcultured based on the colony and conidial morphology of F. graminearum (Leslie and Summerell 2006). The colonies selected grew white mycelia with a pink pigment at the bottom. Macroconidia with five to six septate were produced after seven days and microconidia were absent. Seven isolates derived from different wheat samples were derived from single conidia and identified based on amplicon sequencing using a MinION Flongle flow cell described by Boutigny et al. (2019). Reads which passed the integrated MinKNOW quality control step were mapped to the Partial translation elongation factor 1- α (EF1a) gene, using primers EF1-F2 (5'TCATC GGCCACGTCGACTCT3') and EF1-R3 (5'TACCAGCCTCGAACTCACCA3'). The consensus sequence for each sample was aligned to the reference sequence (JF740867.1) using BLASTn, revealing all the similarities of more than 99.5% (Supplementary File 2). The morphological characteristics (colony, pink pigment, shape of macroconidia, absence of microconidia) (Leslie and Summerell, 2006) and sequencing results indicated that the seven isolates from wheat were F. graminearum of the 3ADON chemotype. Besides, Koch's postulates were performed by spray-inoculating healthy inflorescences of eight wheat plants derived from the cross Avocet/CDC Silex at half anthesis stage (one isolate per plant and one non-inoculated control). Each spike was thoroughly sprayed with 1ml of spore suspension containing 5 × 104 conidia per ml (4-5 spikes per plant). The spikes on one plant were treated with distilled water (1 ml per spike) as a blank control. The inoculated spikes were covered with moist plastic bags for 48 hours, and the plants were placed in a growth chamber under a 12-h photoperiod at 18°C. Seven days later, spikes of the spores-treated plants exhibited bleached spikelets, which is a typical symptom of FHB, and there was no disease on the control plant. F. graminearum was re-isolated from FDK of diseased spikes using the isolation methodology and identified by morphology described above. To our knowledge and based on a literature review, this is the first report of F. graminearum causing FHB on wheat and barley in the Lower Mainland of British Columbia. The reason for the concealment of F. graminearum in BC might be the small acreage of commercially grown small-grain cereals. Further, there is limited cultivation of winter wheat and barley in the region for forage/silage, but the crops are harvested at the soft dough stage leaving limited grain/spike residue for the next crop. While presently there is very low acreage of cereal host crops of F. gramineraum in Lower Mainland, this acreage might increase in future years as winter cereals are slowly expanding in the region as cover crops, forages, and even grain production for sale to forgae producers or for local breweries in case of barley; therefore, finding of F. gramineraum could have economic consequences on cereal production in the region in future. Further investigation is needed to better understand the aggressiveness of the strains and their population structure of the pathogen in the Region.

Experimentally informed structure optimization of amorphous TiO2 films grown by atomic layer deposition.

Amorphous titanium dioxide TiO2 (a-TiO2) has been widely studied, particularly as a protective coating layer on semiconductors to prevent corrosion and promote electron-hole conduction in photoelectrochemical reactions. The stability and longevity of a-TiO2 is strongly affected by the thickness and structural heterogeneity, implying that understanding the structure properties of a-TiO2 is crucial for improving the performance. This study characterized the structural and electronic properties of a-TiO2 thin films (∼17 nm) grown on Si by atomic layer deposition (ALD). Fluctuation spectra V(k) and angular correlation functions were determined with 4-dimensional scanning transmission electron microscopy (4D-STEM), which revealed the distinctive medium-range ordering in the a-TiO2 film. A realistic atomic model of a-TiO2 was established guided by the medium-range ordering and the previously reported short-range ordering of a-TiO2 film, as well as the interatomic potential. The structure was optimized by the StructOpt code using a genetic algorithm that simultaneously minimizes energy and maximizes the match to experimental short- and medium-range ordering. The StructOpt a-TiO2 model presents improved agreements with the medium-range ordering and the k-space location of the dominant 2-fold angular correlations compared with a traditional melt-quenched model. The electronic structure of the StructOpt a-TiO2 model was studied by ab initio calculations and compared to the crystalline phases and experimental results. This work uncovered the medium-range ordering in a-TiO2 thin films and provided a realistic a-TiO2 structure model for further investigation of structure-property relationships and materials design. In addition, the improved multi-objective optimization package StructOpt was provided for structure determination of complex materials guided by experiments and simulations.

First report of Uromyces rumicis on Rumex crispus in Canada.

Rumex crispus L. (curled dock) is a noxious weed in both grasslands (mainly pastures) and arable lands, but is also an early colonizer of many disturbed areas in lowland and upland regions. Rumex crispus is of agricultural significance because it competes with sown or native pasture and crops species and occupies areas that could be utilized by more palatable crop species. Rumex crispus can grow on almost all soil types but less often on peat and acidic soils. The range of altitude to which the species has become adapted varies from sea level to 3,500 m (Zaller 2004). This plant species has Eurasian origin and is widely distributed through temperate regions of North America as an introduced species. There is no previous rust report on R. crispus in Canada. On other Rumex species two Puccinia species viz. Puccinia acetosae (Schumach.) Körn., and P. ornata Arthur & Holw., have been previously reported from Canada (Farr & Rossman 2022). During the recent field survey from southern British Columbia, Langley, heavily rust infected leaves of R. crispus were observed. Uredinia and telia were present on both sides of the leaf mainly on the lower side. Uredinia early exposed, brown, and pulverulent. Urediniospores were obovoid, ellipsoid or oblong, measuring 20-28 × 17-23 µm. Urediniospore walls are yellowish brown to brown, 1.5-2 µm thick; covered in evenly distributed echinulae, spaced 2 to 3 µm apart, with smooth (non-echinulate) patches at the equator of the urediniospores. Urediniospores with 2- (mostly 3 and less often 2) germ pores, usually supraequatorial (at the upper part of the spore), or distributed irregularly (scattered), or 2 germ pores supraequatorial, one equatorial or all germ pores equatorial, germ pores covered with flat papilla. Telia similar to the uredinia, dark brown. Teliospores more or less globoid, ellipsoid, broadly ellipsoid, obovoid or oblong, 25--36 × 15-23 µm, brownish yellow to brown, smooth, 2-3 um thick, with apical or sup-apical germ pore, covered with a hemispherical, yellowish papilla, pedicels colorless, short. The above-mentioned characters fit Majewski's (1977) description for Uromyces rumicis (Schumach.) G. Winter. To confirm identity, the first 903 bp of the 5' end of the 28S rDNA of the above specimen was amplified following protocols of Aime (2006) and Aime et al. (2018) (GenBank accession no. ON166844). BLAST queries of the sequence shared 99.56% identity (900/903) with U. rumicis (GenBank accession no. KY764197). To our knowledge this is the first report of U. rumicis from Canada (Farr and Rossma 2022). There is only one previous published report of this rust species in North America made by French (1989) who reported U. rumicis on R. crispus from California. Uromyces rumicis is quite common on Rumex species including R. crispus in Eurasia and has also been reported on this host from Africa (Farr and Rossman 2022). It appears that the above rust fungus species may have been introduced to the North America by accompanying its host plant. A voucher specimen of infected R. crispus with U. rumicis was deposited at Arthur Fungarium (PUR) under the accession number PUR N24014. Uromyces rumicis is a heteromacrocyclic rust with aecial state on Ranunculaceae members especially Ranunculus ficaria L. This species is another introduced plant in North America. However, there is no report of the aecial state of this rust in North America to date. Existence of only two reports of U. rumicis in California and British Columbia, making it likely that U. rumicis became established in the West Coast of North America probably no earlier than the second half of the 20th century.

Uromyces rebeccae, sp. nov., a newly described rust on the federally endangered plant, California sea-blite (Suaeda californica).

Rust disease was observed on populations of Suaeda californica near Morro Bay, California. The pathogen was identified as a species of Uromyces based on teliospore and urediniospore morphology and nuc 28S rDNA sequence analysis. The isolate was compared with previously described species of Uromyces that infect members of Chenopodiaceae, prompting a taxonomic reevaluation of Uromyces species on Suaeda. Herein, Uromyces rebeccae is described. It can be differentiated from the closely related U. chenopodii (syn.: Aecidium chenopodii-fruticosi; U. giganteus) based on host range, teliospore morphology, and 28S sequence data. The new combination, Uromyces chenopodii-fruticosi, is made for Aecidium chenopodii-fruticosi, the oldest name for Eurasian Suaeda rust. Finally, it was determined that U. giganteus likely does not occur in the United States and that the rust of S. taxifolia in the United States likely comprises a third, yet unnamed taxon, different from both U. rebeccae and U. chenopodii-fruticosi. This is the first record of a rust fungus on S. californica. An identification key for Uromyces species reported on Chenopodiaceae is provided.

A new species of Cintractiella (Ustilaginales) from the volcanic island of Kosrae, Caroline Islands, Micronesia.

Cintractiella is an unusual genus of smut fungi containing two described species that produce sori as adventitious gall-like spikelets on members of tribe Hypolytreae (subfam. Mapanioideae, Cyperaceae). In September 200, during a botanical expedition on the volcanic island of Kosrae located in the eastern Caroline Islands and within the Federated States of Micronesia, a specimen of Mapaniapacifica was collected displaying Cintractiella-like sori in adventitious spikelets on the host leaves. Sori were hypophyllous, occurring in groups of spikelets composed of olivaceous-brown scale-like leaves, 1-1.5 mm wide and up to 6 mm long. Microscopic comparison with the protologue and drawings of the type material of C.lamii show several differences in teliospore and sori characters between it and the newly collected material on Mapania. To our knowledge, this represents only the second known collection of any member of Cintractiella on vegetative organs of Hypolytreae and a third species for this genus and the only known smut species infecting Mapania, herein described as Cintractiellakosraensis sp. nov.

Pucciniamodiolae in North America: distribution and natural host range.

Pucciniamodiolae, a rust fungus pathogen of Carolina bristlemallow, Modiolacaroliniana (Malvaceae), is newly reported from North America, appears to be well established along the Gulf coast and is likely to have been introduced from South America. Its taxonomy, distribution and natural host range are discussed and a lectotype designated for this species. Malvasylvestris and Alcearosea are reported as new hosts for the rust. Additional new records for Malvaceae rusts are made for P.modiolae on Alcearosea from Brazil, P.heterospora on Herissantiacrispa in Florida and P.heterogenea on Malva sp. in Peru. Finally, an identification key for the microcyclic Puccinia species on members of Malvaceae in North America is provided.

Competing sexual and asexual generic names in Pucciniomycotina and Ustilaginomycotina (Basidiomycota) and recommendations for use.

With the change to one scientific name for pleomorphic fungi, generic names typified by sexual and asexual morphs have been evaluated to recommend which name to use when two names represent the same genus and thus compete for use. In this paper, generic names in Pucciniomycotina and Ustilaginomycotina are evaluated based on their type species to determine which names are synonyms. Twenty-one sets of sexually and asexually typified names in Pucciniomycotina and eight sets in Ustilaginomycotina were determined to be congeneric and compete for use. Recommendations are made as to which generic name to use. In most cases the principle of priority is followed. However, eight generic names in the Pucciniomycotina, and none in Ustilaginomycotina, are recommended for protection: Classicula over Naiadella, Gymnosporangium over Roestelia, Helicobasidium over Thanatophytum and Tuberculina, Melampsorella over Peridermium, Milesina over Milesia, Phragmidium over Aregma, Sporobolomyces over Blastoderma and Rhodomyces, and Uromyces over Uredo. In addition, eight new combinations are made: Blastospora juruensis, B. subneurophyla, Cronartium bethelii, C. kurilense, C. sahoanum, C. yamabense, Milesina polypodii, and Prospodium crusculum combs. nov.

Application of Transmitted Kikuchi Diffraction in Studying Nano-oxide and Ultrafine Metallic Grains.

Transmitted Kikuchi diffraction (TKD) is an emerging SEM-based technique that enables investigation of highly refined grain structures. It offers higher spatial resolution by utilizing conventional electron backscattered diffraction equipment on electron-transparent samples. A successful attempt has been made to reveal nano-oxide grain structures as well as ultrafine severely deformed metallic grains. The effect of electron beam current was studied. Higher beam currents enhance pattern contrast and intensity. Lower detector exposure times could be employed to accelerate the acquisition time and minimize drift and carbon contamination. However, higher beam currents increase the electron interaction volume and compromise the spatial resolution. Lastly, TKD results were compared to orientation mapping results in TEM (ASTAR). Results indicate that a combination of TKD and EDS is a capable tool to characterize nano-oxide grains such as Al2O3 and Cr2O3 with similar crystal structures.

Tranzschelia in the Americas revisited: two new species and notes on the Tranzschelia thalictri complex.

Two new species of Tranzschelia (Pucciniales) are described from the Americas. Tranzschelia pseudofusca is a microcyclic species on Anemone spp. (Ranunculaceae) with North American distribution. T. mexicana on Prunus salicifolia (Rosaceae) is found in Colombia, Ecuador and Mexico. It is assumed that T. mexicana is a macrocyclic host-alternating species. T. thalictri, a holarctic microcyclic species, has variable morphology and probably is an aggregate of related species. Specimens are documented with scanning electron microscopy (ESEM) and light microscopy including a simple new technique to illuminate urediniospore germ pores. Results are discussed with respect to similar species, distribution and life-cycle characters. A key for American species on telial hosts is provided.

Investigation of potential antibacterial properties of methanol extracts from fungus Ganoderma applanatum.

In this study we searched for antibacterial compounds in methanol extracts of three layers (tube layer, context and cutis) of Ganoderma applanatum fruit body against Bacillus subtilis ATCC 6051 as a gram-positive bacterium and Escherichia coli ATCC 25922 and Pseudomonas syringae pv. syringae DPIC 219 as gram-negative bacteria. We found antibacterial properties in all three layers only against gram-negative bacteria. The fractions were isolated and purified by thin layer chromatography (TLC) and high-performance liquid chromatography. After purification, four major compounds - A, B, C and D - were tested for antibacterial properties, and B and D were found to possess antibacterial properties. The results of TLC and spectral data, including mass spectra and (1)H NMR of compounds B and C, showed that they were saturated fatty acids and compound D was palmitic acid (hexadecanoic acid) (16:0).