Lifespan socioeconomic context is associated with cytomegalovirus and late-differentiated CD8+ T and NK cells: Initial results in older adults.

OBJECTIVE: Lower socioeconomic status (SES) can accelerate immune aging; however, it is unknown whether and how lifespan socioeconomic context (SEC) -the relative wealth and quality of the communities an individual lives in across their lifespan- impacts immune aging. We examined the effects of childhood and adulthood SEC on late-differentiated immune cells and investigated the mediating and moderating role of cytomegalovirus (CMV), a key driver of immune aging. METHODS: Adults 60 years and older (N = 109) reported their addresses from birth to age 60, which were coded for county-level employment, education, and income to construct a latent SEC variable, averaged across ages 0-18 (childhood SEC) and 19-60 (adulthood SEC). Blood was drawn semiannually over 5 years for CMV serostatus and flow cytometry estimates of late-differentiated CD8+ T and natural killer (NK) cells. Models were adjusted for chronological age, time, gender, and individual SES (current income and education). RESULTS: Lower childhood SEC was associated with higher percentages of late-differentiated CD8+ T and NK cells via CMV seropositivity (indirect effects ps .015-.028). Additionally, an interaction between CMV serostatus and SEC on CD8+ T cell aging (p = .049) demonstrated that adulthood SEC was negatively associated with immune aging among CMV- but not CMV+ adults. CONCLUSIONS: Beyond current SES, socioeconomic context related to immune aging in distinct patterns by lifespan phase. Lower childhood SEC importantly may influence who acquires CMV, which in turn, predicts higher levels of immune aging, whereas higher adulthood SEC was protective against immune aging among CMV- older adults. These initial results need to be explored in larger samples.

Differential Inhibition of Anaplerotic Pyruvate Carboxylation and Glutaminolysis-Fueled Anabolism Underlies Distinct Toxicity of Selenium Agents in Human Lung Cancer.

Past chemopreventive human trials on dietary selenium supplements produced controversial outcomes. They largely employed selenomethionine (SeM)-based diets. SeM was less toxic than selenite or methylseleninic acid (MSeA) to lung cancer cells. We thus investigated the toxic action of these Se agents in two non-small cell lung cancer (NSCLC) cell lines and ex vivo organotypic cultures (OTC) of NSCLC patient lung tissues. Stable isotope-resolved metabolomics (SIRM) using 13C6-glucose and 13C5,15N2-glutamine tracers with gene knockdowns were employed to examine metabolic dysregulations associated with cell type- and treatment-dependent phenotypic changes. Inhibition of key anaplerotic processes, pyruvate carboxylation (PyC) and glutaminolysis were elicited by exposure to MSeA and selenite but not by SeM. They were accompanied by distinct anabolic dysregulation and reflected cell type-dependent changes in proliferation/death/cell cycle arrest. NSCLC OTC showed similar responses of PyC and/or glutaminolysis to the three agents, which correlated with tissue damages. Altogether, we found differential perturbations in anaplerosis-fueled anabolic pathways to underlie the distinct anti-cancer actions of the three Se agents, which could also explain the failure of SeM-based chemoprevention trials.

Automation in flow cytometry: Guidelines and review of systems.

Automation in flow cytometry has recently advanced from the partial laboratory automation and robotics islets, to more fully integrated systems. This article reviews three manufacturers' newest sample preparation systems: the Beckman CellMek, the Sysmex PS-10, and the BD FACSDuet. These three instruments are capable of performing many of the manual steps in flow cytometry sample processing (pipetting, staining, lysing, washing, fixing). General description, capabilities, advantages, and disadvantages of each system are compared. Overall, these systems have the potential to become mainstay items in today's busy clinical flow cytometry laboratories, and save a significant amount of hands-on time for laboratory staff.

Life stressors and immune aging: Protective effects of cognitive reappraisal.

Stressful life events may accelerate aspects of immune aging, but habitual use of an adaptive emotion regulation strategy, cognitive reappraisal, may attenuate these effects. This study examined whether cognitive reappraisal moderates the associations between life stressor frequency and stressor desirability on aspects of immune aging, including late-differentiated CD8+ T and natural killer (NK) cells and inflammatory markers (IL-6, TNF-α, and CRP), both between and within people in a longitudinal sample of 149 older adults (mean age = 77.8, range: 64-92 years). Participants reported stressful life events, use of cognitive reappraisal, and provided blood semiannually for up to 5 years to assess aspects of immune aging. Multilevel models, adjusted for demographic and health covariates, tested the between-person (stable, trait-like differences) and within-person associations (dynamic fluctuations) among life stressors and reappraisal on immune aging. Experiencing more frequent life stressors than usual was associated with higher levels of late-differentiated NK cells within person, but this effect was accounted for by experiencing health-related stressors. Unexpectedly, experiencing more frequent and less desirable stressors were associated with lower average levels of TNF-α. As expected, reappraisal moderated the associations between life stressors and late-differentiated NK cells between people and IL-6 within people. Specifically, older adults who experienced less desirable stressors but also used more reappraisal had significantly lower proportions of late-differentiated NK cells on average and lower levels of IL-6 within-person. These results suggest cognitive reappraisal may play a protective role in attenuating the effects of stressful life events on aspects of innate immune aging in older adults.

Resources and lymphocyte terminal maturity among older adults.

OBJECTIVE: Women's financial resources were associated with more terminal maturity in natural killer lymphocytes, generally associated with loss of proliferative potential, during the "Great Recession". This preregistered analysis expanded on that finding in a longitudinal design including both genders and examining the role of cytomegalovirus (CMV) serostatus. METHOD: Older adults (N = 138, 57% women) were assessed longitudinally during 2012-2017; including self-reported psychological, social, financial, and status-skill resources, CMV antibody titers and serostatus, and assessment of T and natural killer lymphocyte terminal maturity (LTM). RESULTS: Neither total nor financial resources were associated with LTM. Adjusting only for age, more psychological resources (e.g., meaning, hope, humor) were associated with lower T LTM (percent: γ = -1.11 [-1.78, -.44]; number: γ = -.99 [-1.70, -.27]). There were no significant interactions with age, gender, or CMV serostatus; however, additionally adjusting for serostatus reduced the effect of psychological resources (percent: γ = -.41 [-93, .12]; number: (γ = -.40 [-.94, .13]). CONCLUSIONS: Outside the context of the "Great Recession", psychological resources but not financial resources were associated with terminal maturity in T cells, a relationship related to CMV serostatus. Further studies in different and more diverse samples, and in different eras, are needed to understand what resources are most protective against immunological aging, when, and for whom. (PsycInfo Database Record (c) 2023 APA, all rights reserved).

The role of late-differentiated T cells, a proxy for IFN-γ-production, in older adults' social networks.

Interferon-γ (IFN-γ), an inflammatory biomarker that promotes antiviral immunity, may be a prerequisite for sociability. IFN-γ production in older adulthood is driven by late-differentiated CD8+ T cells, particularly CD28-and CD57+ subsets, which increase with age, reduce immune response, and increase chronic disease risk. The present study investigated the relationship between late-differentiated T cells (LDTC) and sociability in a longitudinal study of healthy aging. 139 older adults (Mage = 77.95, range 65-93; 58% female, 57% college educated, and 94% Caucasian) provided data at up to 10 occasions (M = 7). Social network size and diversity and cytomegalovirus (CMV) status were collected at every wave. Percentage of LDTC was measured at up to 4 waves and averaged for each participant. There were no significant main effects of LDTC or interactions between LDTC and time on social network size or diversity. Adjustment for baseline age, gender, and sensitivity analyses including CMV and imputed data did not change results. IFN-γ may not play a role in dictating social behavior in older adults. Alternately, LDTC may not have accurately represented circulating levels of IFN-γ. Future work should continue exploring IFN-γ and social behavior, particularly as it relates to age-related changes. The role of IFN-γ-producing, late-differentiated T cells in older adults' social networks.

Mechanisms underlying the effects of caloric restriction on hypertension.

Hypertension is a major risk factor for cardiovascular disease (CVD) as well as a major contributor to all-cause mortality and disability worldwide. The pathophysiology of hypertension is highly attributed to a dysfunctional endothelium and vascular remodeling. Despite the wide use of pharmacological therapies that modulate these pathways, a large percentage of patients continue to have uncontrolled hypertension, and the use of non-pharmacological interventions is increasingly investigated. Among these, caloric restriction (CR) appears to be a promising nutritional intervention for the management of hypertension. However, the mechanisms behind this effect are not yet fully understood, although an evolving view supports a significant impact of CR on vascular structure and function, specifically at the level of vascular endothelial cells, vascular smooth muscle cells along with their extracellular matrix (ECM). Accumulating evidence suggests that CR promotes endothelium-dependent vasodilation through activating eNOS and increasing nitric oxide (NO) levels through multiple cascades involving modulation of oxidative stress, autophagy, and inflammation. Indeed, CR diminishes phenotypic shift, and suppresses proliferation and migration of VSMCs via pathways involving NO and mTOR. By regulating transforming growth factor-ß and matrix metalloproteinases, CR appears to reduce ECM and collagen deposition in vascular walls. Here, we offer a detailed discussion of how these mechanisms contribute to CR's influence on reducing blood pressure. Such mechanisms could then provide a valuable foundation on which to base new therapeutic interventions for hypertension.

Streptococcus gordonii-Induced miRNAs Regulate CCL20 Responses in Human Oral Epithelial Cells.

The mechanisms through which oral commensal bacteria mitigates uncontrolled inflammatory responses of the oral mucosa remain unknown. Here, we show that representative oral bacterial species normally associated with oral health [S. gordonii (Sg), V. parvula (Vp), A. naeslundii (An), C. sputigena (Cs), and N. mucosa (Nm)] enhanced differential chemokine responses in oral epithelial cells (OECs), with some bacteria (An, Vp, and Nm) inducing higher chemokine levels (CXCL1, CXCL8) than others (Sg, Cs). Although all bacterial species (except Cs) increased CCL20 mRNA levels consistent with protein elevations in cell lysates, only An, Vp, and Nm induced higher CCL20 secretion, similar to the effect of the oral pathogen F. nucleatum (Fn). In contrast, most CCL20 remained associated with OECs exposed to Sg and negligible amounts released into the cell supernatants. Consistently, Sg attenuated An-induced CCL20. MiR-4516 and miR-663a were identified as Sg-specifically induced miRNAs modulating validated targets of chemokine-associated pathways. Cell transfection with miR-4516 and miR-663a decreased An- and Fn-induced CCL20. MiRNA upregulation and attenuation of An-induced CCL20 by Sg were reversed by catalase. Up-regulation of both miRNAs was specifically enhanced by oral streptococci H2O2-producers. These findings suggest that CCL20 levels produced by OECs in response to bacterial challenge are regulated by Sg-induced miR-4516 and miR-663a in a mechanism that involves hydrogen peroxide. This type of molecular mechanism could partly explain the central role of specific oral streptococcal species in balancing inflammatory and antimicrobial responses given the critical role of CCL20 in innate (antimicrobial) and adaptive immunity (modulates Th17 responses).

Loss of CLN3, the gene mutated in juvenile neuronal ceroid lipofuscinosis, leads to metabolic impairment and autophagy induction in retinal pigment epithelium.

Juvenile neuronal ceroid lipofuscinosis (JNCL, aka. juvenile Batten disease or CLN3 disease) is a lysosomal storage disease characterized by progressive blindness, seizures, cognitive and motor failures, and premature death. JNCL is caused by mutations in the Ceroid Lipofuscinosis, Neuronal 3 (CLN3) gene, whose function is unclear. Although traditionally considered a neurodegenerative disease, CLN3 disease displays eye-specific effects: Vision loss not only is often one of the earliest symptoms of JNCL, but also has been reported in non-syndromic CLN3 disease. Here we described the roles of CLN3 protein in maintaining healthy retinal pigment epithelium (RPE) and normal vision. Using electroretinogram, fundoscopy and microscopy, we showed impaired visual function, retinal autofluorescent lesions, and RPE disintegration and metaplasia/hyperplasia in a Cln3 ~ 1 kb-deletion mouse model [1] on C57BL/6J background. Utilizing a combination of biochemical analyses, RNA-Seq, Seahorse XF bioenergetic analysis, and Stable Isotope Resolved Metabolomics (SIRM), we further demonstrated that loss of CLN3 increased autophagic flux, suppressed mTORC1 and Akt activities, enhanced AMPK activity, and up-regulated gene expression of the autophagy-lysosomal system in RPE-1 cells, suggesting autophagy induction. This CLN3 deficiency induced autophagy induction coincided with decreased mitochondrial oxygen consumption, glycolysis, the tricarboxylic acid (TCA) cycle, and ATP production. We also reported for the first time that loss of CLN3 led to glycogen accumulation despite of impaired glycogen synthesis. Our comprehensive analyses shed light on how loss of CLN3 affect autophagy and metabolism. This work suggests possible links among metabolic impairment, autophagy induction and lysosomal storage, as well as between RPE atrophy/degeneration and vision loss in JNCL.

A Potential Role of Phospholipase 2 Group IIA (PLA2-IIA) in P. gingivalis-Induced Oral Dysbiosis.

Porphyromonas gingivalis is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which P. gingivalis could abrogate the host-microbe symbiotic relationship leading to oral dysbiosis remain unclear. We have recently demonstrated that P. gingivalis specifically increased the antimicrobial properties of oral epithelial cells, through a strong induction of the expression of PLA2-IIA in a mechanism that involves activation of the Notch-1 receptor. Moreover, gingival expression of PLA2-IIA was significantly increased during initiation and progression of periodontal disease in non-human primates and interestingly, those PLA2-IIA expression changes were concurrent with oral dysbiosis. In this chapter, we present an innovative hypothesis of a potential mechanism involved in P. gingivalis-induced oral dysbiosis and inflammation based on our previous observations and a robust body of literature that supports the antimicrobial and proinflammatory properties of PLA2-IIA as well as its role in other chronic inflammatory diseases.

A longitudinal study of the stability, variability, and interdependencies among late-differentiated T and NK cell subsets in older adults.

The stability and variability of older adults' late-differentiated peripheral blood T and natural killer (NK) cells over time remains incompletely quantified or understood. We examined the variability and change over time in T and NK cell subsets in a longitudinal sample of older adults; the effects of sex, cytomegalovirus (CMV) serostatus, and chronic disease severity on immune levels and trajectories; and interdependencies among T and NK cell subsets. Older adults (N = 149, age 64-94 years, 42% male) provided blood every 6 months for 2.5 years (up to 5 waves) to evaluate late-differentiated CD8 T cells (CD28-, CD57+) and CD56dimNK cells (CD57+, NKG2C+, FcɛRIγ-). In multilevel models, most of the variance in immune subsets reflected stable differences between people. However, CD56dimNK cell subsets (CD57+ and FcɛRIγ-) also increased with age, whereas T cell subsets did not. Independent of age, all subsets examined were higher in CMV-positive older adults. Men had higher levels of CD56dim CD57+ than women. Chronic disease was not associated with any immune subset investigated. T and NK cell subsets correlated within each cell type, but interdependencies differed by CMV serostatus. Our results suggest the accumulation of these stable cell populations may be driven less by chronological aging, even less by chronic disease severity, and more by CMV, which may differentially skew T and NK cell differentiation.

Perceived stress, cytomegalovirus titers, and late-differentiated T and NK cells: Between-, within-person associations in a longitudinal study of older adults.

Cytomegalovirus (CMV) and psychological stress are implicated as drivers of immunological aging. It is unknown, however, whether associations among CMV titers, stress, and immune aging are more stable or dynamic over time. The present investigation tested the between-person (stable differences) and within-person (dynamic fluctuations) associations of CMV titers and perceived stress on late-differentiated T and natural killer (NK) peripheral blood cells in a longitudinal study of older adults aged 64-92 years (N = 149). Participants reported stress levels and provided blood biannually for 2.5 years (up to 5 waves per person) to assess CMV IgG titers and composites of late-differentiated CD8 T cells (CD28- and CD57 + subsets) and CD56dim NK cells (CD57+, NKG2C+, and FcεRIγ- subsets). In multilevel models that controlled for demographic variables, higher CMV titers were associated with higher proportions and counts of aged T and NK cells between people and lower counts of aged T cells within people. Perceived stress was associated with higher counts of aged T cells between people, but was not associated with aged NK cells. A significant interaction between stress and CMV titers on T cells between people indicated that older adults with lower stress levels and lower CMV titers had the lowest proportions of late-differentiated T cells, whereas those with higher stress levels had high proportions, regardless of CMV control. Our results provide evidence for longer-term, between-person associations among CMV titers, stress, and immunological aging, rather than dynamic within-person associations. We propose that targeting factors that promote low, stable perceived stress in older adults may retard T cell differentiation and ultimately support healthy aging.

Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA.

The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.

mTOR Inhibitor Everolimus in Regulatory T Cell Expansion for Clinical Application in Transplantation.

BACKGROUND: Experimental and preclinical evidence suggest that adoptive transfer of regulatory T (Treg) cells could be an appropriate therapeutic strategy to induce tolerance and improve graft survival in transplanted patients. The University of Kentucky Transplant Service Line is developing a novel phase I/II clinical trial with ex vivo expanded autologous Treg cells as an adoptive cellular therapy in renal transplant recipients who are using everolimus (EVR)-based immunosuppressive regimen. METHODS: The aim of this study was to determine the mechanisms of action and efficacy of EVR for the development of functionally competent Treg cell-based adoptive immunotherapy in transplantation to integrate a common EVR-based regimen in vivo (in the patient) and ex vivo (in the expansion of autologous Treg cells). CD25 Treg cells were selected from leukapheresis product with a GMP-compliant cell separation system and placed in 5-day (short) or 21-day (long) culture with EVR or rapamycin (RAPA). Multi-parametric flow cytometry analyses were used to monitor the expansion rates, phenotype, autophagic flux, and suppressor function of the cells. phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin signaling pathway profiles of treated cells were analyzed by Western blot and cell bioenergetic parameters by extracellular flux analysis. RESULTS: EVR-treated cells showed temporary slower growth, lower metabolic rates, and reduced phosphorylation of protein kinase B compared with RAPA-treated cells. In spite of these differences, the expansion rates, phenotype, and suppressor function of long-term Treg cells in culture with EVR were similar to those with RAPA. CONCLUSIONS: Our results support the feasibility of EVR to expand functionally competent Treg cells for their clinical use.

Gene expression analysis of neuropeptides in oral mucosa during periodontal disease in non-human primates.

BACKGROUND: Neuropeptides (NPs) are innate pivotal regulators of the immunoinflammatory response. Nevertheless, their role in the pathogenesis of periodontal disease remains unknown. Changes in gene expression of 10 NPs and 16 NP receptors (NPRs) coincident with the initiation, progression, and resolution of periodontitis were determined. METHODS: The ligature-induced periodontitis model was used in rhesus monkeys (n = 18). Gingival tissue samples were taken at baseline (preligatures), at 2 weeks and at 1 month (initiation), and at 3 months (progression) postligation. Ligatures were removed and samples taken 2 months later (resolution). Total RNA was isolated from tissues and NP/NPR gene expression microarray analysis was performed. Gene expression changes were validated by quantitative polymerase chain reaction and immunohistochemistry. RESULTS: Unexpectedly, the expression of pro-inflammatory NPs/NPRs did not change during periodontitis or with resolution. However, increased expression of the anti-inflammatory NPs adrenomedullin (ADM) and galanin (GAL), and the NPRs calcitonin receptor-like (CALCRL) and receptor activity-modifying protein-2 and -3 (RAMP2 and RAMP3) were observed during initiation and progression of disease. The expression of the same NPs/NPRs exhibited a significant positive correlation with both molecular (interleukin-1ß, matrix mettaloproteinase-9, and receptor activator of nuclear factor-kappa B ligand) and clinical measures of gingival inflammation and tissue destruction. CONCLUSION: Initiation and progression of periodontitis involve significant overexpression of ADM, GAL, CALCRL, RAMP2, and RAMP3. These anti-inflammatory NPs/NPRs could play a role in the unresolved infection and inflammation that normally drives tissue destruction in periodontitis. Both ADM and GAL potentially are new candidates to consider as biomolecules associated with periodontal disease activity.

Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA.

P. gingivalis (Pg) is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which mucosal responses to the oral microbiota in the presence of specific pathogens such as Pg could abrogate the host-microbe symbiotic relationship leading to periodontitis remain unclear. Herein, we identified the Notch-1/PLA2-IIA axis as a new molecular pathway through which Pg could be specifically modulating oral epithelial antimicrobial and inflammatory responses. Pg activated Notch-1, and inhibition or silencing of Notch-1 completely abrogated Pg-induced PLA2-IIA in oral epithelial cells (OECs). Activation of Notch-1 and PLA2-IIA production were associated with Pg-produced gingipains. Other oral Gram-positive and Gram-negative species failed to induce similar responses. Pg enhanced OEC antimicrobial activity through PLA2-IIA. Increased Notch-1 activation correlated with higher PLA2-IIA gingival expression and changes in the abundance of specific oral bacteria phyla during periodontal disease. Oral bacterial species exhibited differential antimicrobial susceptibility to PLA2-IIA. These findings support previous evidence suggesting an important role for epithelial Notch-1 activation and PLA2-IIA production during health and disease at mucosal surfaces, and provide new mechanistic information concerning the regulation of epithelial antimicrobial and pro-inflammatory responses modulated by oral pathogenic bacteria associated with periodontal disease.

Human Body Composition and Immunity: Visceral Adipose Tissue Produces IL-15 and Muscle Strength Inversely Correlates with NK Cell Function in Elderly Humans.

Natural killer (NK) lymphocyte-mediated cytotoxicity and cytokine secretion control infections and cancers, but these crucial activities decline with age. NK cell development, homeostasis, and function require IL-15 and its chaperone, IL-15 receptor alpha (IL-15Rα). Macrophages and dendritic cells (DC) are major sources of these proteins. We had previously postulated that additional IL-15 and IL-15Rα is made by skeletal muscle and adipose tissue. These sources may be important in aging, when IL-15-producing immune cells decline. NK cells circulate through adipose tissue, where they may be exposed to local IL-15. The objectives of this work were to determine (1) if human muscle, subcutaneous adipose tissue (SAT), and visceral adipose tissue (VAT) are sources of IL-15 and IL-15 Rα, and (2) whether any of these tissues correlate with NK cell activity in elderly humans. We first investigated IL-15 and IL-15Rα RNA expression in paired muscle and SAT biopsies from healthy human subjects. Both tissues expressed these transcripts, but IL-15Rα RNA levels were higher in SAT than in skeletal muscle. We also investigated tissue obtained from surgeries and found that SAT and VAT expressed equivalent amounts of IL-15 and IL-15Rα RNA, respectively. Furthermore, stromal vascular fraction cells expressed more IL-15 RNA than did adipocytes. To test if these findings related to circulating IL-15 protein and NK cell function, we tested 50 healthy adults aged > 70 years old. Plasma IL-15 levels significantly correlated with abdominal VAT mass in the entire cohort and in non-obese subjects. However, plasma IL-15 levels did not correlate with skeletal muscle cross-sectional area and correlated inversely with muscle strength. Plasma IL-15 did correlate with NK cell cytotoxic granule exocytosis and with CCL4 (MIP-1ß) production in response to NKp46-crosslinking. Additionally, NK cell responses to K562 leukemia cells correlated inversely with muscle strength. With aging, immune function declines while infections, cancers, and deaths increase. We propose that VAT-derived IL-15 and IL-15Rα is a compensatory NK cell support mechanism in elderly humans.

The periodontal war: microbes and immunity.

Maintenance of periodontal health or transition to a periodontal lesion reflects the continuous and ongoing battle between the vast microbial ecology in the oral cavity and the array of resident and emigrating inflammatory/immune cells in the periodontium. This war clearly signifies many 'battlefronts' representing the interface of the mucosal-surface cells with the dynamic biofilms composed of commensal and potential pathogenic species, as well as more recent knowledge demonstrating active invasion of cells and tissues of the periodontium leading to skirmishes in connective tissue, the locality of bone and even in the local vasculature. Research in the discipline has uncovered a concerted effort of the microbiome, using an array of survival strategies, to interact with other bacteria and host cells. These strategies aid in colonization by 'ambushing, infiltrating and outflanking' host cells and molecules, responding to local environmental changes (including booby traps for host biomolecules), communicating within and between genera and species that provide MASINT (Measurement and Signature Intelligence) to enhance sustained survival, sabotage the host inflammatory and immune responses and by potentially adopting a 'Fabian strategy' with a war of attrition and resulting disease manifestations. Additionally, much has been learned regarding the ever-increasing complexity of the host-response armamentarium at both cellular and molecular levels that is addressed in this review. Knowledge regarding how these systems fully interact requires both new laboratory and clinical tools, as well as sophisticated modeling of the networks that help maintain homeostasis and are dysregulated in disease. Finally, the triggers resulting in a 'coup de main' by the microbiome (exacerbation of disease) and the characteristics of susceptible hosts that can result in 'pyrrhic victories' with collateral damage to host tissues, the hallmark of periodontitis, remains unclear. While much has been learned, substantial gaps in our understanding of the 'parameters of this war' remain elusive toward fulfilling the Sun Tzu adage: 'If you know the enemy and know yourself, you need not fear the result of a hundred battles.'

Data correlations between gender, cytomegalovirus infection and T cells, NK cells, and soluble immune mediators in elderly humans.

We describe a cohort of 50 elderly subjects, age at least 70 years. We present gender-specific findings in T lymphocyte markers and soluble immune mediators. We show the correlation between cytomegalovirus infection status with CD56(dim) NK cell responses to a variety of stimuli and with CD56(bright)/CD56(dim) NK cell ratio. We also present the correlation of retinol binding protein (RBP)-4 plasma levels with NK cell responses and we explore the relationship between gender and adiponectin, 25(OH)D (vitamin D), and RBP4 in affecting CD56(dim) NK cell responses. These data are discussed in Al-Attar et al. (2016) [1].