Optimization of universal allogeneic CAR-T cells combining CRISPR and transposon-based technologies for treatment of acute myeloid leukemia.

Despite the potential of CAR-T therapies for hematological malignancies, their efficacy in patients with relapse and refractory Acute Myeloid Leukemia has been limited. The aim of our study has been to develop and manufacture a CAR-T cell product that addresses some of the current limitations. We initially compared the phenotype of T cells from AML patients and healthy young and elderly controls. This analysis showed that T cells from AML patients displayed a predominantly effector phenotype, with increased expression of activation (CD69 and HLA-DR) and exhaustion markers (PD1 and LAG3), in contrast to the enriched memory phenotype observed in healthy donors. This differentiated and more exhausted phenotype was also observed, and corroborated by transcriptomic analyses, in CAR-T cells from AML patients engineered with an optimized CAR construct targeting CD33, resulting in a decreased in vivo antitumoral efficacy evaluated in xenograft AML models. To overcome some of these limitations we have combined CRISPR-based genome editing technologies with virus-free gene-transfer strategies using Sleeping Beauty transposons, to generate CAR-T cells depleted of HLA-I and TCR complexes (HLA-IKO/TCRKO CAR-T cells) for allogeneic approaches. Our optimized protocol allows one-step generation of edited CAR-T cells that show a similar phenotypic profile to non-edited CAR-T cells, with equivalent in vitro and in vivo antitumoral efficacy. Moreover, genomic analysis of edited CAR-T cells revealed a safe integration profile of the vector, with no preferences for specific genomic regions, with highly specific editing of the HLA-I and TCR, without significant off-target sites. Finally, the production of edited CAR-T cells at a larger scale allowed the generation and selection of enough HLA-IKO/TCRKO CAR-T cells that would be compatible with clinical applications. In summary, our results demonstrate that CAR-T cells from AML patients, although functional, present phenotypic and functional features that could compromise their antitumoral efficacy, compared to CAR-T cells from healthy donors. The combination of CRISPR technologies with transposon-based delivery strategies allows the generation of HLA-IKO/TCRKO CAR-T cells, compatible with allogeneic approaches, that would represent a promising option for AML treatment.

Severe laryngeal edema after CAR-T cell treatment in a patient with multiple myeloma: A case report.

This case aims to report an unusual clinical situation with uncommon and severe side effects, which can even be life threatening for the patient. The ENT and Hematology specialist should be aware of diagnosing and treating adequately.

A KNIME Workflow to Assist the Analogue Identification for Read-Across, Applied to Aromatase Activity.

The reduction and replacement of in vivo tests have become crucial in terms of resources and animal benefits. The read-across approach reduces the number of substances to be tested, exploiting existing experimental data to predict the properties of untested substances. Currently, several tools have been developed to perform read-across, but other approaches, such as computational workflows, can offer a more flexible and less prescriptive approach. In this paper, we are introducing a workflow to support analogue identification for read-across. The implementation of the workflow was performed using a database of azole chemicals with in vitro toxicity data for human aromatase enzymes. The workflow identified analogues based on three similarities: structural similarity (StrS), metabolic similarity (MtS), and mechanistic similarity (McS). Our results showed how multiple similarity metrics can be combined within a read-across assessment. The use of the similarity based on metabolism and toxicological mechanism improved the predictions in particular for sensitivity. Beyond the results predicting a large population of substances, practical examples illustrate the advantages of the proposed approach.

First report of Fusarium graminearum causing Fusarium Head Blight (FHB) of wheat and barley in Lower Mainland of British Columbia, Canada.

Fusarium head blight (FHB), predominantly caused by Fusarium graminearum is one of the most economically important fungal diseases of small-grain cereals. Since the early 1990s, FHB has been a devastating wheat disease in parts of Canada and the United States, causing significant economic impacts on the cereal grain industry through reduced seed quality and yield, and grain contamination with fungal toxins (Brar et al. 2019). Spikes of wheat and barley with bleached spikelets and pinkish coloration were observed with low incidence and high severity in August 2021 field stripe rust nursery at UBC Totem Plant Science Farm in Vancouver, Canada (Supplementary File 1). FHB-like Symptomatic spikes were collected during the growing season. The Fusarium damaged kernels (FDK) were surface-sterilized with 1% sodium hypochlorite (NaOCl) for 1.5 min, rinsed three times in distilled water and dried using sterile filter paper discs in Biological Safety Cabinet. The kernels were placed on Petri dishes containing three layers of moist blotter papers and incubated in the dark at 22-25°C for 24 hours. The Petri dishes were transferred into a -20°C freezer for 24 hours, followed by five days of incubation at 22-25°C under fluorescent light, during which distilled water was added onto blotter papers every day to maintain moisture. After incubation, mycelium growing on kernels was transferred to potato dextrose agar (PDA) media and subcultured based on the colony and conidial morphology of F. graminearum (Leslie and Summerell 2006). The colonies selected grew white mycelia with a pink pigment at the bottom. Macroconidia with five to six septate were produced after seven days and microconidia were absent. Seven isolates derived from different wheat samples were derived from single conidia and identified based on amplicon sequencing using a MinION Flongle flow cell described by Boutigny et al. (2019). Reads which passed the integrated MinKNOW quality control step were mapped to the Partial translation elongation factor 1- α (EF1a) gene, using primers EF1-F2 (5'TCATC GGCCACGTCGACTCT3') and EF1-R3 (5'TACCAGCCTCGAACTCACCA3'). The consensus sequence for each sample was aligned to the reference sequence (JF740867.1) using BLASTn, revealing all the similarities of more than 99.5% (Supplementary File 2). The morphological characteristics (colony, pink pigment, shape of macroconidia, absence of microconidia) (Leslie and Summerell, 2006) and sequencing results indicated that the seven isolates from wheat were F. graminearum of the 3ADON chemotype. Besides, Koch's postulates were performed by spray-inoculating healthy inflorescences of eight wheat plants derived from the cross Avocet/CDC Silex at half anthesis stage (one isolate per plant and one non-inoculated control). Each spike was thoroughly sprayed with 1ml of spore suspension containing 5 × 104 conidia per ml (4-5 spikes per plant). The spikes on one plant were treated with distilled water (1 ml per spike) as a blank control. The inoculated spikes were covered with moist plastic bags for 48 hours, and the plants were placed in a growth chamber under a 12-h photoperiod at 18°C. Seven days later, spikes of the spores-treated plants exhibited bleached spikelets, which is a typical symptom of FHB, and there was no disease on the control plant. F. graminearum was re-isolated from FDK of diseased spikes using the isolation methodology and identified by morphology described above. To our knowledge and based on a literature review, this is the first report of F. graminearum causing FHB on wheat and barley in the Lower Mainland of British Columbia. The reason for the concealment of F. graminearum in BC might be the small acreage of commercially grown small-grain cereals. Further, there is limited cultivation of winter wheat and barley in the region for forage/silage, but the crops are harvested at the soft dough stage leaving limited grain/spike residue for the next crop. While presently there is very low acreage of cereal host crops of F. gramineraum in Lower Mainland, this acreage might increase in future years as winter cereals are slowly expanding in the region as cover crops, forages, and even grain production for sale to forgae producers or for local breweries in case of barley; therefore, finding of F. gramineraum could have economic consequences on cereal production in the region in future. Further investigation is needed to better understand the aggressiveness of the strains and their population structure of the pathogen in the Region.

11C-Methionine PET/CT in Assessment of Multiple Myeloma Patients: Comparison to 18F-FDG PET/CT and Prognostic Value.

Multiple myeloma (MM) is the second most common haematological malignancy and remains incurable despite therapeutic advances. 18F-FDG (FDG) PET/CT is a relevant tool MM for staging and it is the reference imaging technique for treatment evaluation. However, it has limitations, and investigation of other PET tracers is required. Preliminary results with L-methyl-[11C]- methionine (MET), suggest higher sensitivity than 18F-FDG. This study aimed to compare the diagnostic accuracy and prognostic value of 1FDG and MET in MM patients. We prospectively compared FDG and MET PET/CT for assessment of bone disease and extramedullary disease (EMD) in a series of 52 consecutive patients (8 smoldering MM, 18 newly diagnosed MM and 26 relapsed MM patients). Bone marrow (BM) uptake patterns and the detection of focal lesions (FLs) and EMD were compared. Furthermore, FDG PET parameters with known MM prognostic value were explored for both tracers, as well as total lesion MET uptake (TLMU). Median patient age was 61 years (range, 37-83 years), 54% were male, 13% of them were in stage ISS (International Staging System) III, and 31% had high-risk cytogenetics. FDG PET/CT did not detect active disease in 6 patients, while they were shown to be positive by MET PET/CT. Additionally, MET PET/CT identified a higher number of FLs than FDG in more than half of the patients (63%). For prognostication we focussed on the relapsed cohort, due to the low number of progressions in the two other cohorts. Upon using FDG PET/CT in relapsed patients, the presence of more than 3 FLs (HR 4.61, p = 0.056), more than 10 FLs (HR 5.65, p = 0.013), total metabolic tumor volume (TMTV) p50 (HR 4.91, p = 0.049) or TMTV p75 (HR 5.32, p = 0.016) were associated with adverse prognosis. In MET PET/CT analysis, TMTV p50 (HR 4.71, p = 0.056), TMTV p75 (HR 6.27, p = 0.007), TLMU p50 (HR 8.8, p = 0.04) and TLMU p75 (HR 6.3, p = 0.007) adversely affected PFS. This study confirmed the diagnostic and prognostic value of FDG in MM. In addition, it highlights that MET has higher sensitivity than FDG PET/CT for detection of myeloma lesions, including FLs. Moreover, we show, for the first time, the prognostic value of TMTV and TLMU MET PET/CT in the imaging evaluation of MM patients.

Position statement: nonoperative management of lateral epicondylitis in adults.

We sought to compare methods of nonsurgical treatment of lateral epicondylitis in men and women older than 18 years to develop a guideline intended for orthopedic surgeons and other health care providers who assess, counsel and care for these patients. We searched Medline, Embase and Cochrane through to Mar. 9, 2021, and included all English-language studies comparing nonsurgical approaches. We compared physiotherapy versus no active treatment, corticosteroids versus placebo, platelet-rich plasma (PRP) versus placebo, and autologous blood injection versus placebo. Outcomes of interest were pain outcomes (visual analogue scale scores) and functional outcomes. We rated the quality of the evidence and strength of recommendations using the Grading of Recommendations Assessment, Development, and Evaluation (GRADE) approach. This guideline will benefit patients seeking nonsurgical intervention for lateral epicondylitis by improving counselling on nonsurgical treatment options and possible outcomes. It will also benefit surgical providers by improving their knowledge of various nonsurgical approaches. Data presented could be used to develop frameworks and tools for shared decision-making.

Inclusion of information technology-based assessments of health-related quality of life in routine oncology practice in Uruguay.

BACKGROUND: Previous research has shown that the inclusion of patient-reported outcomes measures in the patient's visit to the oncologists might improve the quality of global health care. The aim of the study was to assess the feasibility, acceptance, and utility perceived by patients and oncologists of health-related quality of life (HRQL) assessments obtained prior to clinical visits, and to evaluate if this has an impact on patient's well-being in a sample of Spanish-speaking patients from Uruguay. METHODS: Patients assisted regularly in the Oncology Clinic were randomized into two groups: an intervention group that completed a set of questionnaires (European Organisation for Research and Treatment of Cancer-Quality of Life Questionnaire-C30 (EORTC QLQ-C30) and Hospital Anxiety and Depression Scale using a touch screen device and a control group that did not respond to these questionnaires. At 2 months, the responses of all the participants to the Functional Assessment of Cancer Therapy-General (FACT-G) were collected over a telephone to determine whether there were differences in the HRQL between the intervention and control groups. The graphed scores of the intervention group were included in the clinical history of the patient during consultation. Patients and physicians completed the questionnaires on the usefulness of these measurements. RESULTS: In total, 58 patients participated in this study: 36 in the intervention group and 22 in the control group; 65% of the participants were female, and median age was 59 years (18-79). Regarding patients, 97% found the questionnaires easy to complete and thought that they included important questions. As for oncologists, 68.8% used the information and 87.5% found it useful for the consultation. There were no significant differences in the FACT-G scores between the intervention and control groups. CONCLUSIONS: The routine HRQL assessments using an electronic device prior to the consultations were positively valued by almost all patients and physicians. This could significantly contribute to a better understanding of the patient's overall problems during consultation. These results confirm the benefits of integrating the patient's self-reported quality of life outcomes into consultations.

Nonoperative treatment of lateral epicondylitis: a systematic review and meta-analysis.

BACKGROUND: There is an ongoing controversy regarding the nonoperative treatment of lateral epicondylitis. Given that the evidence surrounding the use of various treatment options for lateral epicondylitis has expanded, an overall assessment of nonoperative treatment options is required. The purpose of this systematic review and meta-analysis was to compare physiotherapy (strengthening), corticosteroids (CSIs), platelet-rich plasma (PRP), and autologous blood (AB) with no active treatment or placebo control in patients with lateral epicondylitis. METHODS: MEDLINE, Embase, and Cochrane were searched through till March 8, 2021. Additional studies were identified from reviews. All English-language randomized trials comparing nonoperative treatment of patients >18 years of age with lateral epicondylitis were included. RESULTS: A total of 5 randomized studies compared physiotherapy (strengthening) with no active treatment. There were no significant differences in pain (mean difference: -0.07, 95% confidence interval [CI]: -0.56 to 0.41) or function (standardized mean difference [SMD]: -0.08, 95% CI: -0.46 to 0.30). Seven studies compared CSI with a control. The control group had statistically superior pain (mean difference: 0.70, 95% CI: 0.22 to 1.18) and functional scores (SMD: -0.35, 95% CI: -0.54 to -0.16). Two studies compared PRP with controls, and no differences were found in pain (SD: -0.15, 95% CI: -1.89 to 1.35) or function (SMD: 0.14, 95% CI: -0.45 to 0.73). Three studies compared AB with controls, and no differences were observed in pain (0.49, 95% CI: -2.35 to 3.33) or function (-0.07, 95% CI: -0.64 to 0.50). DISCUSSION: The available evidence does not support the use of nonoperative treatment options including physiotherapy (strengthening), CSI, PRP, or AB in the treatment of lateral epicondylitis.

Stem cell architecture drives myelodysplastic syndrome progression and predicts response to venetoclax-based therapy.

Myelodysplastic syndromes (MDS) are heterogeneous neoplastic disorders of hematopoietic stem cells (HSCs). The current standard of care for patients with MDS is hypomethylating agent (HMA)-based therapy; however, almost 50% of MDS patients fail HMA therapy and progress to acute myeloid leukemia, facing a dismal prognosis due to lack of approved second-line treatment options. As cancer stem cells are the seeds of disease progression, we investigated the biological properties of the MDS HSCs that drive disease evolution, seeking to uncover vulnerabilities that could be therapeutically exploited. Through integrative molecular profiling of HSCs and progenitor cells in large patient cohorts, we found that MDS HSCs in two distinct differentiation states are maintained throughout the clinical course of the disease, and expand at progression, depending on recurrent activation of the anti-apoptotic regulator BCL-2 or nuclear factor-kappa B-mediated survival pathways. Pharmacologically inhibiting these pathways depleted MDS HSCs and reduced tumor burden in experimental systems. Further, patients with MDS who progressed after failure to frontline HMA therapy and whose HSCs upregulated BCL-2 achieved improved clinical responses to venetoclax-based therapy in the clinical setting. Overall, our study uncovers that HSC architectures in MDS are potential predictive biomarkers to guide second-line treatments after HMA failure. These findings warrant further investigation of HSC-specific survival pathways to identify new therapeutic targets of clinical potential in MDS.

Exploration of structural requirements for azole chemicals towards human aromatase CYP19A1 activity: Classification modeling, structure-activity relationships and read-across study.

Human aromatase, also called CYP19A1, plays a major role in the conversion of androgens into estrogens. Inhibition of aromatase is an important target for estrogen receptor (ER)-responsive breast cancer therapy. Use of azole compounds as aromatase inhibitors is widespread despite their low selectivity. A toxicological evaluation of commonly used azole-based drugs and agrochemicals with respect to CYP19A1 is currently requested by the European Union- Registration, Evaluation, Authorization and Restriction of Chemicals (EU-REACH) regulations due to their potential as endocrine disruptors. In this connection, identification of structural alerts (SAs) is an effective strategy for the toxicological assessment and safe drug design. The present study describes the identification of SAs of azole-based chemicals as guiding experts to predict the aromatase activity. Total 21 SAs associated with aromatase activity were extracted from dataset of 326 azole-based drugs/chemicals obtained from Tox21 library. A cross-validated classification model having high accuracy (error rate 5%) was proposed which can precisely classify azole chemicals into active/inactive toward aromatase. In addition, mechanistic details and toxicological properties (agonism/antagonism) of azoles with respect to aromatase were explored by comparing active and inactive chemicals using structure-activity relationships (SAR). Lastly, few structural alerts were applied to form chemical categories for read-across applications.

Skin sensitization quantitative QSAR models based on mechanistic structural alerts.

Allergic contact dermatitis is increasingly of interest for the hazard characterization of chemicals. in vivo animal testing is usually adopted but in silico approaches are becoming the new frontier due to their swiftness and economic efficiency. Indeed, in silico models can rationalise the experimental outcomes besides having predictive ability. The aim of the present work was to explore the electrophilic chemical behaviour responsible for allergic contact dermatitis using quantitative QSAR regression models. Eight models were proposed, using an experimental LLNA dataset of 366 chemicals. Each model is unique to encode a type of electrophilic reactivity domain. The models were obtained using autocorrelation, electro-topological and atom centered fragment based on two-dimensional descriptors, which incorporated the electronic and stereochemical features of substances interacting with skin proteins to induce skin cell proliferation. Finally, simple steps were proposed to integrate the eight models for the application on the test chemicals.

Prognostic impact of micromegakaryocytes in primary myelodysplastic syndromes.

Micromegakaryocytes (microMKs) are considered a myelodysplastic feature of myeloid neoplasms in adults, with an adverse prognosis connotation. However, this notion in MDS has not been well proved. In our cohort of 287 MDS, patients with microMKs showed lower overall survival (OS) (HR, 2.12; 95% CI, 1.47-3.06; p = 0.000036) and higher risk of acute myeloid leukemia (AML) evolution (HR, 4.8; 95% CI, 2.9-11.01; p = 0.00021). Results were validated with an independent cohort. In multivariate analysis, the presence of microMKs maintained its independent association with OS (HR, 1.54, 95% CI, 1.13-2.1, p = 0.0059) and AML transformation (HR, 2.28, 95% CI, 1.2-4.4, p = 0.014). Moreover, by adding 1 point to the IPSS-R score in patients with microMKs, we improved the IPSS-R accuracy. Interestingly, adding that 1-point, 29% of intermediate IPSS-R risk group patients were upgraded to the high-risk group. In summary, we confirmed that the presence of microMKs implies worse outcomes in MDS and suggested a modification improving IPSS-R.

Actitudes hacia las sexualidades periféricas en estudiantes universitarios de La Rioja, Argentina y Huancayo, Perú / Attitudes towards peripheral sexualities in university studentsof a Rioja, Argentina and Huancayo, Peru

El objetivo del estudio fue conocer las actitudes hacia la diversidad sexual en escenarios aca-démicos de dos universidades públicas: La Rioja Argentina y la Universidad Nacional del Centro del Perú. Se comparó las características de las actitudes hacia las sexualidades periféricas en estudiantes de ambas universidades. La investigación se desarrolló bajo el enfoque cuantitati-vo, de tipo observacional, prospectivo y transversal,de nivel exploratorio, descriptivo-relacional, con diseño comunitario, dado que la unidad de estudio es la población y se da una exploración con comparaciones múltiples. La población estuvo constituida por 150 estudiantes de las carreras profesionales de Trabajo Social en ambas universidades. Los resultados eviden-cian tendencias favorables hacia actitudes positivas respecto a las personas LGBTI+, con dife-rencias significativas en las dimensiones cognitiva y conductual según universidad. Se encontró tambiénrelación significativa de las actitudes con la religión y el género de los estudiantes. (AU)

The objective of the study was to know the attitudes towards sexual diversity in academic set-tings of two public universities: La Rioja Argentina and the National University of the Center of Peru. The characteristics of attitudes towards peripheral sexualities in students from both universities were compared. The research was developed under a quantitative, observational, prospective, and cross-sectional approach, exploratory, descriptive-relational, with communi-ty design, since the unit of study is the population and an exploration with multiple compari-sons is given. The population was constituted by 150 students of the professional careers of Social Work in both universities. The results show favorable trends towards positive attitudes towards LGBTI+ people, with significant differences in the cognitive and behavioral dimen-sions, according to the university. A significant relationship was also found between attitudes with religion and the gender of the students. (AU)

A Multicenter Analysis of the Outcome of Cancer Patients with Neutropenia and COVID-19 Optionally Treated with Granulocyte-Colony Stimulating Factor (G-CSF): A Comparative Analysis.

BACKGROUND: Approximately 15% of patients infected by SARS-CoV-2 develop a distress syndrome secondary to a host hyperinflammatory response induced by a cytokine storm. Myelosuppression is associated with a higher risk of infections and mortality. There are data to support methods of management for neutropenia and COVID-19. We present a multicenter experience during the first COVID-19 outbreak in neutropenic cancer patients infected by SARS-CoV-2. METHODS: Clinical retrospective data were collected from neutropenic cancer patients with COVID-19. Comorbidities, tumor type, stage, treatment, neutropenia severity, G-CSF, COVID-19 parameters, and mortality were analyzed. A bivariate analysis of the impact on mortality was carried out. Additionally, we performed a multivariable logistic regression to predict respiratory failure and death. RESULTS: Among the 943 cancer patients screened, 83 patients (11.3%) simultaneously had neutropenia and an infection with COVID-19. The lungs (26%) and breasts (22%) were the primary locations affected, and most patients had advanced disease (67%). In the logistic model, as adjusted covariates, sex, age, treatment (palliative vs. curative), tumor type, and the lowest level of neutrophils were used. A significant effect was obtained for the number of days of G-CSF treatment (OR = 1.4, 95% CI [1,1,03,92], p-value = 0.01). CONCLUSIONS: Our findings suggest that a prolonged G-CSF treatment could be disadvantageous for these cancer patients with infections by COVID-19, with a higher probability of worse outcome.

Local Fractal Connections to Characterize the Spatial Processes of Deforestation in the Ecuadorian Amazon.

Deforestation by human activities is a common issue in Amazonian countries. This occurs at different spatial and temporal scales causing primary forest loss and land fragmentation issues. During the deforestation process as the forest loses connectivity, the deforested patches create new intricate connections, which in turn create complex networks. In this study, we analyzed the local connected fractal dimension (LCFD) of the deforestation process in the Sumaco Biosphere Reserve (SBR) with two segmentation methods, -CA-wavelet and K-means-to categorize the complexity of deforested patches' connections and then relate these with the spatial processes. The results showed an agreement with both methods, in which LCFD values below 1 corresponded to isolated patches with simple shapes and those above 1 signified more complex and connected patches. From CA-wavelet a threshold of 1.57 was detected allowing us to identify and discern low and high land transformation, while the threshold for K-means was 1.61. Both values represent the region from which deforestation performs local aggressive expansion networks. The thresholds were used to map the LCFD in which all spatial processes were visually detected. However, the threshold of 1.6 ± 0.03 was more effective in discerning high land transformation. such as shrinkage and attrition, in the deforestation process in the SBR.

CAR T-Cells in Multiple Myeloma Are Ready for Prime Time.

The survival of patients with multiple myeloma (MM) has been dramatically improved in the last decade thanks to the incorporation of second-generation proteasome inhibitors (PI), immunomodulatory drugs (IMID), and, more recently, anti-CD38 monoclonal antibodies (MoAb). Nevertheless, still, a major proportion of MM patients will relapse, underscoring the need for new therapies in this disease. Moreover, survival in patients failing the current standard of care regimens (including PI, IMIDs, and anti-CD38 MoAb), which is now defined as triple-class refractory, remains dismal, and new drugs with different mechanism of action are needed. B-cell maturation antigen (BCMA)-targeted therapies and in particular chimeric antigen receptor T cell (CAR T-cell) treatment have emerged as promising platforms to overcome refractoriness to conventional drugs. In this manuscript, we review the current available data regarding CAR T-cell therapy for MM, with a special focus on target selection, clinical results, limitations, and future strategies.