Evaluation of two different analytical methods for circulating tumor cell detection in peripheral blood of patients with primary breast cancer.

BACKGROUND: Evidence is accumulating that circulating tumor cells (CTC) out of peripheral blood can serve as prognostic marker not only in metastatic but also in early breast cancer (BC). Various methods are available to detect CTC. Comparisons between the different techniques, however, are rare. MATERIAL AND METHODS: We evaluate two different methods for CTC enrichment and detection in primary BC patients: the FDA-approved CellSearch System (CSS; Veridex, Warren, USA) and a manual immunocytochemistry (MICC). The cut-off value for positivity was ≥1 CTC. RESULTS: The two different nonoverlapping patient cohorts evaluated with one or the other method were well balanced regarding common clinical parameters. Before adjuvant CHT 21.1% (416 out of 1972) and 20.6% (247 out of 1198) of the patients were CTC-positive, while after CHT 22.5% (359 out of 1598) and 16.6% (177 out of 1066) of the patients were CTC-positive using CSS or MICC, respectively. CTC positivity rate before CHT was thus similar and not significantly different (P = 0.749), while CTC positivity rate immediately after CHT was significantly lower using MICC compared to CSS (P < 0.001). CONCLUSION: Using CSS or MICC for CTC detection, we found comparable prevalence of CTC before but not after adjuvant CHT.

Detection of chromosomal aneuploidies in fetal cells isolated from maternal blood using single-chromosome dual-probe FISH analysis.

Detection of chromosomal aneuploidies using fetal cells isolated from maternal blood, for prenatal non-invasive genetic investigation, has been a long-sought goal of clinical genetics to replace amniocentesis and chorionic villous sampling to avoid any risk to the fetus. The purpose of this study was to develop a sensitive and specific new assay for diagnosing aneuploidy with circulating fetal cells isolated from maternal blood as previously reported using two novel approaches: (i) simultaneous immunocytochemistry (ICC) evaluation using a monoclonal antibody for i-antigen, followed by fluorescence in situ hybridization (FISH); (ii) dual-probe FISH analysis of interphase nuclei using two differently labeled probes, specific for different loci of chromosomes 21 and 18; in addition, short tandem repeats (STR) analysis on single cells isolated by micromanipulation was applied to confirm the presence of fetal cells in the cell sample enriched from maternal blood. Blood samples were obtained from women carrying trisomic fetuses, and from non-pregnant women and men as controls. Using ICC-FISH approach, a large heterogeneity in immunostaining pattern was observed, which is a source of very subjective signal interpretation. Differently, dual-probe FISH analysis provided for a correct diagnosis of all pregnancies: the mean percentage of trisomic cells was 0.5% (range, 0.36-0.76%), while the mean percentage of trisomic cells in the control group (normal pregnancies or non-pregnant women) was ≤0.20%. The application of the dual-probe FISH protocol on fetal cells isolated from maternal blood enables accurate molecular detection of fetal aneuploidy, thus providing a foundation for development of non-invasive prenatal diagnostic testing.

Na+/H+ exchanger-dependent intracellular alkalinization is an early event in malignant transformation and plays an essential role in the development of subsequent transformation-associated phenotypes.

In this study we investigate the mechanism of intracellular pH change and its role in malignant transformation using the E7 oncogene of human papillomavirus type 16 (HPV16). Infecting NIH3T3 cells with recombinant retroviruses expressing the HPV16 E7 or a transformation deficient mutant we show that alkalinization is transformation specific. In NIH3T3 cells in which transformation can be turned on and followed by induction of the HPV16 E7 oncogene expression, we demonstrate that cytoplasmic alkalinization is an early event and was driven by stimulation of Na+/H+ exchanger activity via an increase in the affinity of the intracellular NHE-1 proton regulatory site. Annulment of the E7-induced cytoplasmic alkalinization by specific inhibition of the NHE-1, acidification of culture medium, or clamping the pHi to nontransformed levels prevented the development of later transformed phenotypes such as increased growth rate, serum-independent growth, anchorage-independent growth, and glycolytic metabolism. These findings were verified in human keratinocytes (HPKIA), the natural host of HPV. Results from both NIH3T3 and HPKIA cells show that alkalinization acts on pathways that are independent of the E2F-mediated transcriptional activation of cell cycle regulator genes. Moreover, we show that the transformation-dependent increase in proliferation is independent of the concomitant stimulation of glycolysis. Finally, treatment of nude mice with the specific inhibitor of NHE-1, DMA, delayed the development of HPV16-keratinocyte tumors. Our data confirm that activation of the NHE-1 and resulting cellular alkalinization is a key mechanism in oncogenic transformation and is necessary for the development and maintenance of the transformed phenotype.

Induction of S phase and apoptosis by the human papillomavirus type 16 E7 protein are separable events in immortalized rodent fibroblasts.

The HPV16 E7 oncoprotein neutralizes several cell cycle checkpoints, favouring the entry of quiescent cells into S phase. This activity is mediated in part by association of E7 with the pocket proteins and consequent activation of E2F transcription factors. In addition, HPV16 E7 protein is able to promote apoptosis. In this study we demonstrate that the ability to induce apoptosis is a common property of E7s belonging to both benign and malignant HPV types. The E7-induced apoptosis is mediated by inactivation of pRb, whilst neutralization of the other two pRB-related proteins, p107 and 130, is not sufficient to trigger apoptosis. Moreover, we show that certain point mutations in the conserved region 1 (CR1) of HPV16 E7 abolish the induction of apoptosis without altering the ability to stimulate S phase. Thus, these two E7-mediated cellular events, apoptosis and S phase entry, can be separated in immortalized rodent fibroblasts. Our findings demonstrate that the E7-mediated pRb destabilization is not required for its ability to drive quiescent cells into S phase and to induce apoptosis. Finally, expression of E7 proteins in NIH3T3, which lack a functional p19ARF, does not lead to p53 accumulation, indicating that the E7 impacts upon additional cellular pathways to promote apoptosis.

Separation of C/EBPalpha-mediated proliferation arrest and differentiation pathways.

Cell proliferation and terminal differentiation are mutually exclusive in most cell lineages. The b-zip transcription factor CCAAT/enhancer-binding protein alpha (C/EBPalpha) induces proliferation arrest and differentiation in many cell types, suggesting that both activities are linked. Here we show that C/EBPalpha-mediated proliferation arrest and differentiation pathways can be separated by the E7 oncoprotein of the "high-risk" human papilloma virus 16. The E7 oncoprotein overrides C/EBPalpha-mediated cell cycle withdrawal without compromising the transactivation activity of C/EBPalpha or its ability to participate in differentiation. Uncoupling of both pathways depends on the casein kinase II site of the oncoprotein but not on its ability to neutralize pocket proteins or the cyclin-dependent kinase inhibitor protein p21. Our results suggest a bifurcation of C/EBPalpha-mediated proliferation arrest and differentiation pathways.

Overriding of cyclin-dependent kinase inhibitors by high and low risk human papillomavirus types: evidence for an in vivo role in cervical lesions.

High risk types of human papillomavirus (HPV) are agents in the aetiology of cervical carcinoma. The products of two early genes, E6 and E7, appear to be the principal transforming proteins. Studies of various monolayer cell culture systems have shown that the E7 oncoprotein of human papillomavirus type 16 is able to neutralize or bypass the inhibitory effect of the cell cycle-dependent kinase (CDK) inhibitors (CKIs) p21WAF1/CIP1 and p27KIP1. To understand whether the p21WAF1/CIP1 or p27KIP1 neutralization also plays a role in vivo, we performed studies on clinical specimens. Forty-five cervical biopsies, including HPV-negative mucosa, HPV 16-positive preinvasive (low and high grade lesions) and invasive neoplasia as well as HPV 6-positive condyloma acuminatum were analysed by single and double immunohistology. We examined the positive cell cycle regulator cyclin A and the universal cell cycle marker Ki67 as well as the negative cell cycle regulators p21WAF1/CIP1 and p27KIP1. Here, we show that in a significant fraction of cells the G1 block can be overcome despite high levels of CKIs in HPV lesions. This phenomenon, which was more evident for p21WAF1/CIP1 than for p27KIP1 was most marked in low grade lesions and in condylomata acuminata, in which a high viral productivity is expected. These results indicate that the overriding of CKI inactivation by viral oncoproteins appears to be a conserved property between low and high risk HPV types. We conclude that the CKI neutralization by HPVs is likely to be required for viral DNA replication rather than for malignant transformation of the host cell.

(A,G)-oligonucleotides form extraordinary stable triple helices with a critical R.Y sequence of the murine c-Ki-ras promoter and inhibit transcription in transfected NIH 3T3 cells.

The promoter of the murine c-Ki-ras proto-oncogene contains a critical homopurine-homopyrimidine sequence which is recognized by a protein factor and is a potential site for triplex-forming oligonucleotides (TFOs). The TFOs designed to bind this critical c-Ki-ras target have either an AG or a GT sequence motif. Of the two types, the first is found to form triplexes with extraordinarily high stability. For instance, both d(AGGGAGGGAGGAAGGGAGGG) (20AG) and d(GGGAGGGAGGGAAGGAGGGAGGGAGGGAGC) (30AG) are able to bind the c-Ki-ras target at 65 degrees C and to resist a polyacrylamide gel temperature of 55 degrees C. By contrast, the triplex formed by d(TGGGTGGGTGGTTGGGTGGG) (20GT) is largely dissociated at a gel temperature of 55 degrees C. The affinity constants of the TFOs at 37 degrees C, 50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2 (standard buffer) were determined through band-shift experiments and found to be respectively 1.0 x 10(6), 4.0 x 10(6), and 2.5 x 10(7) M-1 for 20GT, 30AG, and 20AG. The AG-triplexes exhibit in standard buffer monophasic melting profiles (Tm approximately 75 degrees C) and circular dichoroism spectra showing the typical negative ellipticity at 212 nm, which is a hallmark for triplex DNA. The rate at which the TFOs bind to the c-Ki-ras target at 37 degrees C was examined under pseudo-first-order conditions. When the TFOs are in excess over the target and in the micromolar concentration range, the kinetics of triplex formation are slow, characterized by association half-lives of about 1 h. The ability of the TFOs to act as artificial transcription repressors was examined in a cellular system employing transient transfection experiments. Cultured NIH 3T3 fibroblast cells were cotransfected with a DNA mixture composed by a TFO and plasmid pKRS-413 containing the chloramphenicol acetyltransferase (CAT) gene driven by the c-Ki-ras promoter. It was found that the CAT activity is specifically inhibited by the TFOs in a dose-dependent manner. As expected, stronger CAT repression is obtained with 20AG, the oligonucleotide which forms the more stable triplex. These data suggest that (A,G)-oligonucleotides may provide a valuable means for the selective repression of the c-Ki-ras gene expression.

Guanine-rich oligonucleotides targeted to a critical R . Y site located in the Ki-ras promoter. The effect of competing self-structures on triplex formation.

The promoter of the murine Ki-ras proto-oncogene contains a (C+G)-rich homopurine . homopyrimidine (R . Y) sequence that is essential for transcription activity. We have designed two G-rich oligonucleotides, d(TGGGTGGGTGGTTGGGTGGG) (20GT) and d(AGGGAGGGAGGAAGGGAGGG) (20AG), that have the potential to bind the critical Ki-ras sequence via triplex-helix formation. Band-shift experiments have shown that 20GT binds the Ki-ras R . Y duplex with a delta G value of -40 +/- 5 kJ/mol, while 20AG appeared to have a lower affinity under the experimental conditions adopted: 50 mM Tris/HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2, 25 degrees C. In the absence of Mg2+, 20GT did not bind to the Ki-ras R . Y target, while 20AG exhibited the same affinity observed in the magnesium-containing buffer. To gain insight into the solution properties of 20GT and 20AG, we have performed several experiments including polyacrylamide gel electrophoresis (PAGE), hydroxyapatite chromatography, ultraviolet absorption melting and circular dichroism (CD). We found that 20AG rapidly self-associates into presumably a duplex, even at low concentration (< 1 microM), while 20GT forms aggregates slowly, a process favoured by high oligonucleotide concentrations (> 25 microM). The critical Ki-ras sequence was inserted in Bluescript KS+, downstream from the T7 promoter, to investigate to what extent 20AG and 20GT, which are directed against the R . Y target, are able to inhibit T7 RNA polymerase transcription, under near-physiological conditions. Transcription experiments conducted in vitro at pH 7.4 have shown that oligonucleotide 20GT produced a remarkable repression of T7 RNA polymerase activity in the concentration range (10-25 microM), whereas 20AG had little effect on transcription. In conclusion, the results of this work together with other data reported in the literature [Olivas, W. M. & Maher, L. J. III (1995) Biochemistry 34, 278-284; Noonberg, S. B., François, J.-C., Garestier, T. & Hélène, C. (1995) Nucleic Acids Res. 23, 1956-1963], demonstrate that G-rich oligonucleotides, in particular (G,A)-sequences, may raise problems for in vivo application due to self-aggregation.

Inhibition of T7 RNA polymerase transcription by phosphate and phosphorothioate triplex-forming oligonucleotides targeted to a R.Y site downstream from the promoter.

The effect of triplex-forming oligonucleotides (TFO) on the transcription activity of T7 RNA polymerase has been investigated by an in vitro assay. The TFOs, either containing only phosphate (PO2) or phosphate and phosphorothioate (POS) internucleotide linkages, were targeted to a 30-bp homopurine. homopyrimidine (R.Y) site cloned in plasmid Bluescript KS+ about four helical turns downstream from the T7 RNA promoter. Band-shift and ultraviolet absorption melting experiments showed that the designed pyrimidine PO2 and POS TFOs form stable triple-helical complexes with the R.Y target duplex (the delta GTFO values of triplex formation vary from -42 to -63 kJ/mol). The triple-helical complexes resulting from POS oligonucleotides were less stable (by 4-12 kJ/mol) than those obtained with PO2 analogues, the magnitude of destabilization being dependent on the number of POS groups present in the third strand. The designed TFOs were shown to efficiently repress bacteriophage T7 RNA polymerase transcription under different experimental conditions. The repression depended on pH, TFO concentration and temperature. When the TFO/template ratio was fixed to 100, a strong repressive effect was observed with normal and phosphorothioate pyrimidine TFOs, also under physiological conditions. In contrast, a purine-rich oligonucleotide containing 44% of guanine residues promoted only a weak transcription inhibition, even at a TFO/template ratio as high as 750. Both PO2- and POS-containing pyrimidine TFOs produced their strong repressive effect on T7 RNA polymerase transcription even when they were added to the reaction mixture simultaneously with the polymerase. A mechanism of transcription repression is discussed. The data reported in this paper are useful for designing oligonucleotides acting as artificial repressors in the antigene strategy and indicate that the R.Y target need not to be precisely confined to the promoter.

Pyrimidine phosphorothioate oligonucleotides form triple-stranded helices and promote transcription inhibition.

The ability of phosphorothioate (POS) oligonucleotides to recognise and bind to homopurine-homopyrimidine DNA double-stranded sites via triple helix formation has been investigated. It has been found that the homologous pyrimidine POS sequences Y11-Si (i = 0, 1,2,3,4,10), which have been obtained by an increasing sulphur substitution in the sugar-phosphate backbone of d(CTTCCTCCTCT) (Y11), and the target hairpin duplex d(GAAGGAGGAGA-T4-TCTCCTCCTTC) (h26) can form stable triple helices, as indicated by PAGE, CD and UV melting experiments. The thermal stability of the triple helices depends on the number of POS linkages in the third Y11 strand, varying from 48 degrees C (Y11, with only phosphate groups, PO2) to 31 degrees C (Y11-S10 containing exclusively thioate groups). On average, a Tm depression of about 2 degrees C per POS linkage introduced in Y11 was observed. CD data indicate that the sulphurization of the third strand results in minimal changes of triple-stranded structures. The energetics of the triplex-to-hairpin plus single-strand transition has been determined by van't Hoff analyses of the melting curves. In free energy terms, the POS triplexes h26.Y11-Si are less stable than the normal PO2 h26.Y11 triplex by values between 2.7 and 5.4 kcal/mol, depending on the number of POS linkages contained in the third strand. Phosphorothioate oligonucleotides being resistant towards several nucleases offer an interesting choice as gene blockers in antisense strategy. Thus, their ability to inhibit transcription via triple helix formation has been examined in vitro. We found that triplex-forming POS oligonucleotides of 20 bases in length (with a cytosine contents of 45%), containing either 10% or 26% thioate groups, strongly repress the transcription activity of the bacteriophage T7 RNA polymerase at pH 6.9, when used in excess compared to the target (mol oligo/mol template = 125). The here reported data are useful for designing phosphorothioate oligonucleotides targeted to genomic DNA in antigene strategy.

Effect of 5-methylcytosine on the structure and stability of DNA. Formation of triple-stranded concatenamers by overlapping oligonucleotides.

A triple helix can be formed upon binding of a pyrimidine oligonucleotide to the major groove of a homopurine-homopyrimidine (R.Y) double-stranded DNA target site. Here, we report that this reaction can be influenced by base methylation. The pyrimidine strand 5'-TmCTmCTmCTmCTTmCT (mY12), whose cytosine residues are methylated at C5, does not bind the duplex 5'-AGAGAGAGAAGA.3'-TCTCTCTCTTCT (R12.Y12) to yield a 12-triad triplex, as would be expected from these DNA sequences. Rather, a complex of overlapping oligonucleotides, which we define concatenamer, is formed. The concatenamer is clearly evidenced by polyacrylamide gel electrophoresis (PAGE) since it migrates with a smeared band of very low mobility. The stoichiometry of the concatenamer, determined by both UV mixing curves and electrophoresis, is surprisingly found to be (R12.2mY12)n, thus showing that the unmethylated Y12 strand is excluded from the complex. Denaturation experiments performed by ultraviolet absorbance (UV) and differential scanning calorimetry (DSC) show that the concatenamers melt with a single and highly cooperative transition whose Tm strongly depends on pH. Overall, the data point to the conclusion that the concatenamers are in triple helix, where the methylated mY12 strand is engaged in both Watson-Crick and Hoogsteen base pairings, thus displacing the Y12 strand from the R12.Y12 duplex. A possible mechanism of concatenamer formation is proposed. The results presented in this paper show that 5-methylcytosine brings about a strong stabilizing effect on both double and triple DNA helices, and that pyrimidine oligonucleotides containing 5-methylcytosine can displace from R.Y duplexes the analogous non-methylated strand. The advantage of using methylated oligonucleotides in antisense technology is discussed.

Sequence-specific DNA-triplex formation at imperfect homopurine-homopyrimidine sequences within a DNA plasmid.

The ability of pyrimidine-rich and purine-rich oligodeoxynucleotides to form stable triple-helical structures with imperfect R.Y target sites, containing C interruptions in the purine strand (CG inversions) and located within Bluescript KS+, a plasmid of 2959 bp, has been investigated by electrophoresis, ultraviolet absorbance and cleavage-protection experiments. First, we synthesized double-stranded oligonucleotides corresponding to the plasmid sites and studied their interaction with oligopyrimidines which oppose either G or T to CG inversions. The resulting imperfect DNA triplexes were detected by gel-mobility shift. Their melting profiles were found to be biphasic, and the triplex-to-duplex plus single-strand transition was affected by hysteresis. The 21-nucleotide triplex containing three GC.G mismatched triads had tm = 45 degrees C, while the same triplex, but with three GC.T triads, had tm = 31 degrees C. Moreover, replacing C with 5-methylcytosine in the third strand resulted in a significant stabilization of the defective triplex, tm = 49 degrees C. The potential of the 21-nucleotide oligopyrimidines to recognize and bind in a sequence-specific manner to imperfect R.Y sequences in Bluescript KS+ has been investigated by means of a restriction-endonuclease-protection assay, taking advantage of the fact that one R.Y sequence of Bluescript KS+ was partially overlapped with a HaeII site. Effective endonuclease inhibition was observed with oligopyrimidines opposing G-to-GC inversions, at 10-50 microM. By contrast, the oligopyrimidine opposing T-to-CG inversions did not exhibit any interference with endonuclease activity in our standard conditions. Finally, we have tested the ability of purine-rich strands to bind the R.Y sites of Bluescript KS+. A very weak cleavage protection was observed by using an oligomer (130 microM) with a polarity antiparallel to the purine strand of the target site. The resulting Y.R.R triplex was stabilized by CG.G (GC.G) and TA.A base triplets. This triplex denatures with a low cooperative melting profile suggesting the absence of strong interactions between the third strand and the target site.