A novel begomovirus isolated from sida contains putative cis- and trans-acting replication specificity determinants that have evolved independently in several geographical lineages.

A novel begomovirus isolated from a Sida rhombifolia plant collected in Sinaloa, Mexico, was characterized. The genomic components of sida mosaic Sinaloa virus (SiMSinV) shared highest sequence identity with DNA-A and DNA-B components of chino del tomate virus (CdTV), suggesting a vertical evolutionary relationship between these viruses. However, recombination analysis indicated that a short segment of SiMSinV DNA-A encompassing the plus-strand replication origin and the 5´-proximal 43 codons of the Rep gene was derived from tomato mottle Taino virus (ToMoTV). Accordingly, the putative cis- and trans-acting replication specificity determinants of SiMSinV were identical to those of ToMoTV but differed from those of CdTV. Modeling of the SiMSinV and CdTV Rep proteins revealed significant differences in the region comprising the small ß1/ß5 sheet element, where five putative DNA-binding specificity determinants (SPDs) of Rep (i.e., amino acid residues 5, 8, 10, 69 and 71) were previously identified. Computer-assisted searches of public databases led to identification of 33 begomoviruses from three continents encoding proteins with SPDs identical to those of the Rep encoded by SiMSinV. Sequence analysis of the replication origins demonstrated that all 33 begomoviruses harbor potential Rep-binding sites identical to those of SiMSinV. These data support the hypothesis that the Rep ß1/ß5 sheet region determines specificity of this protein for DNA replication origin sequences.

A new strain of tomato severe leaf curl virus and a unique variant of tomato yellow leaf curl virus from Mexico.

The complete genome sequence of a distinct variant of tomato yellow leaf curl virus-Israel (TYLCV-IL) and the DNA-A sequence of a new strain of tomato severe leaf curl virus (ToSLCV) isolated in San Luis Potosi, Mexico, are described and analyzed. The TYLCV-IL[MX:SLP:11] variant differs from all TYLCV-IL isolates described so far by a unique 42-nt duplicated sequence comprising a part of the conserved stem-loop element of the virion-strand replication origin and adjacent regulatory sequences. TYLCV-IL[MX:SLP:11] was associated with tomato chino La Paz virus (ToChLPV-B[MX:SLP:11]) in a Solanum pimpinellifolium plant, and with pepper huasteco yellow vein virus (PHYVV-[MX:SLP:11]) and ToSLCV-GT[MX:SLP:11] in a Solanum lycopersicum plant. In addition, a distinct ToSLCV exhibiting low sequence identity (<89 %) to other ToSLCV isolates from Mexico was found in a tomato plant collected in the same field. Sequence analysis of this new ToSLCV strain indicates that it is a recombinant of close relatives of ToSLCV-GT[MX:SLP:11] and ToChLPV-B[MX:SLP:11] found in mixed infections with TYLCV-IL[MX:SLP:11].

First Report of Beet mild curly top virus in Dry Bean in Zacatecas, Mexico.

In August 2009, yellowing, upward curling of leaves, and stunted growth were observed on 15 to 40% of dry bean (Phaseolus vulgaris cv. Aluvori) plants in each of several experimental fields in Zacatecas, Mexico. Symptoms and presence of the beet leafhopper (Circulifer tenellus) in affected fields suggested an infection by curtoviruses (Geminiviridae). Total DNA extracts from 18 plant samples exhibiting symptoms were obtained by a modified Dellaporta method (2) and subjected to PCR analysis using two pairs of new, degenerate primers specific for curtoviruses: RepQEW-for (CCRAARTAAGMATCRGCCCAYTCTTG) in combination with CP450-rev (GTCCTCGAGTAGACGGCATAGCCTGACC) and V2Gen910-for (ATGTCGACGAAGCATTTGAAGTTTGATATGGC) with Rep2GQ-rev (GAAGATCTGCWCGMGGAGGYCARCAGACGGCT). This double set of primers was used to amplify two overlapping DNA segments encompassing the complete curtovirus genome. All samples produced amplicons of the expected size (1.75 and 1.8 kb, respectively) that were cloned into pGEM-T Easy Vector (Promega, Madison, WI). Restriction fragment length polymorphism analysis of PCR clones with EcoRI and HinfI endonucleases suggested the presence of a single curtovirus species because only one restriction fragment pattern was observed in all cases. Viral amplicons from three plants were sequenced, and the overlapping DNA fragments were subsequently assembled into a complete genome sequence. Comparison of the virus sequence (Accession No. HQ634913) with sequences of all curtovirus isolates available in GenBank showed that it shared the highest nucleotide identity (98%) with Beet mild curly top virus-Mexico SLP1 from pepper (BMCTV-MX [SLP1]; Accession No. EU586260). Amino acid sequence identity of the seven predicted proteins (Rep, TrAP, REn, C4, V1, V2, and V3) encoded by the virus isolated from bean plants shared 98.0, 97.3, 98.5, 98.8, 100, 99.2, and 97.8% sequence identity, respectively, with the homologous proteins of BMCTV-MX [SLP1]. A BMCTV isolate from pepper collected in Zacatecas in 2007 (Accession No. EU586260) with 96% nucleotide sequence identity to the curtovirus identified in bean induced symptoms in P. vulgaris cv. Topcrop similar to those observed in bean in Zacatecas (1). To determine the presence of curtoviruses in the local populations of insect vectors, beet leafhoppers were collected in one of the sampled dry bean fields and total DNA was isolated from a pool of approximately 20 insects. Amplification of viral DNA with the degenerate primers RepQEW-for and CP450-rev and further sequencing of the PCR products confirmed the presence of a curtovirus DNA sharing almost identical nucleotide identity (99%) with the DNA isolated from bean plants. In 2011, symptoms similar to those observed in bean in 2009 occurred in approximately 30% of dry bean plants, suggesting that BMCTV is endemic in the Zacatecas Region. To our knowledge, this is the first report of BMCTV in legumes in Mexico. References: (1) L. F. Chen et al. Arch. Virol. 156:547, 2011. (2) S. L. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983.

Characterization of Rhynchosia yellow mosaic Yucatan virus, a new recombinant begomovirus associated with two fabaceous weeds in Yucatan, Mexico.

Rhynchosia minima (L.) DC. (Fabaceae) plants exhibiting bright golden mosaic symptoms were previously associated with begomovirus infection in Yucatan, México [1]. To characterize the begomovirus infecting these plants, the complete bipartite genome was cloned and sequenced. Sequence comparisons indicated that the virus was distinct from all other begomoviruses known to date, including those previously identified from symptomatic R. minima, and the name Rhynchosia yellow mosaic Yucatan virus (RhYMYuV) is proposed. Pairwise comparisons indicated that RhYMYuV DNA-A [2,597 nt, (EU021216)] and DNA-B [2,542 nt, (FJ792608)] components shared the highest nt sequence identity with Cabbage leaf curl virus (CaLCuV), 87% for component A and 71% for component B. Phylogenetic analysis indicated that both components of RhYMYuV are most closely related to other New World begomoviruses, having as closest relatives immediate outliers to the major Squash leaf curl virus (SLCV) clade. Recombination analysis of the RhYMYuV genome indicated that the DNA-A component has arisen through intermolecular recombination. R. minima plants inoculated with the monomeric clones developed a bright yellow mosaic similar to symptoms observed in naturally infected plants, confirming that the clones were infectious. Nicotiana benthamiana plants biolistically inoculated with monomeric clones developed curling and chlorosis in the newly emerging leaves. RhYMYuV was also detected in symptomatic Desmodium sect. Scorpiurus Benth. (Fabaceae) that were collected near the RhYMYuV-infected plants.

First Report of Tomato yellow leaf curl virus Co-infecting Pepper with Tomato chino La Paz virus in Baja California Sur, Mexico.

Chile peppers are among the most common and important crops in the State of Baja California Sur, Mexico, where diverse varieties of this crop are annually cultivated. The "chile ancho" (Capsicum annuum L. var. ancho poblano) is one of the most popular hot peppers that is exported fresh to the United States. During a survey in December of 2007 in an experimental field of the CIBNOR in El Carrizal, one of the principal farm districts in the state, a high incidence of yellowing, stunted growth with shortened internodes, foliage discoloration, malformation and crinkle, abortion of flowers, and reduction in size and quantity of fruit were noted in chile ancho. Symptoms and the presence of large populations of whiteflies in the field suggested a possible viral etiology of disease. The symptoms of disease were successfully transmitted by grafting from field plants to tomato and pepper test plants. Samples from both field and test plants were analyzed by scanning electron microscopy (SEM) and molecular techniques. SEM study revealed groups of geminate particles characteristic of begomoviruses (Geminiviridae) in phloem tissue of randomly selected symptomatic plants (four field and two test plants). Total DNA from 12 symptomatic plants (eight naturally infected and four test plants) was obtained by a modified Dellaporta method and analyzed by PCR using the begomovirus universal primers prRepDGR (2) and prC889 (3). Amplicons of ~1.4 kb were obtained from all plant samples and PCR products from four of them were cloned into pGEM-T Easy vector (Promega, Madison, WI) and subsequently analyzed by restriction fragment length polymorphism (RFLP) using EcoRI and HinfI. Two distinct restriction fragment patterns were observed among the cloned PCR products, indicating the occurrence of at least two viruses in the infected plant tissues. The four examined samples contained the same two begomoviruses according to the RFLP analysis data. The complete sequence of the genomic component A of those viruses was determined by PCR amplification of viral DNA with universal, degenerate primers previously described (2), the subsequent cloning of overlapped PCR products, and sequencing. The full-length DNA-A sequence was assembled and compared with viral sequences available at the GenBank database using BlastN and the ClustalV alignment method (MegAlign; DNASTAR, Madison, WI). The 2,781-bp complete genome sequence of one co-infecting monopartite begomovirus (Accession No. HM459851) displayed the highest identity (99%) with Tomato yellow leaf curl virus (TYLCV), isolate Guasave, Sinaloa (Accession No. FJ609655). The 2,609-bp DNA-A sequence of the second begomovirus exhibited the highest nucleotide identity (96%) with Tomato chino La Paz virus (ToChLPV)-[Baja California Sur] (Accession No. AY339619). The presence of TYLCV in this region of Mexico had not been previously reported nor was ToChLPV detected in pepper until now. To our knowledge, this is the first report of a mixed infection of pepper plants with TYLCV and a bipartite begomovirus in Baja California Peninsula. Since the high frequency of recombination events observed in begomovirus mixed infections involving TYLCV (1), it would be important to monitor the possible emergence of ToChLPV-TYLCV recombinants with higher potential virulence. References: (1) S. García-Andrés et al. Virology 365:210, 2007. (2) A. Mauricio-Castillo et al. Plant Dis. 91:1513, 2007. (3) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

First Report of Tomato golden mottle virus on Lycopersicon esculentum and Solanum rostratum in Mexico.

The Rioverde Valley is an important farming area of the San Luis Potosi State in the north-central region of Mexico, where a variety of horticultural crops (i.e., tomato, pepper, cucumber, and watermelon) are annually cultivated. In the summer of 2005, a number of plants exhibiting a variety of symptoms, including leaf yellowing, curling, and stunted growth, were observed in several tomato (Lycopersicon esculentum L.) fields. The presence of whiteflies (Bemisia tabaci Genn.) and symptoms seemed to suggest a begomoviral etiology. Leaves of 12 symptomatic tomato plants and seven plants of the weed Solanum rostratum (Dunal) growing into the same area were collected in July and September from several fields throughout the Rioverde area and assessed for the presence of begomoviruses (genus Begomovirus, family Geminiviridae) by PCR using the degenerate primers prRepDGR (CCTCCTCTAGCASWTCTNCCGTC), SL2050 (2), and prC889 (3). Amplicons of 1.4 kb were derived from viral DNA-A present in all examined S. rostratum and tomato samples, which were cloned into pGEM-T Easy Vector (Promega, Madison, WI) and subsequently analyzed by restriction fragment length polymorphism (RFLP) using MspI and HinfI. Several restriction fragment patterns were observed among the cloned PCR products, hence indicating the occurrence of different begomoviruses in the sampled fields. Sequencing of amplicons derived from one S. rostratum plant revealed the concurrent presence of Tomato severe leaf curl virus (ToSLCV; GenBank Accession No. DQ347946; [2]) and a distinct virus (GenBank Accession No. EF501978) displaying a high sequence identity with Tomato golden mottle virus from Guatemala (ToGMoV-GT94-R2; GenBank Accession No. AF32852). Restriction fragment patterns identical to that of the ToGMoV-like isolate were found in PCR clones from three additional S. rostratum plants and five tomato samples. A set of partially overlapping PCR products of 1.8 and 1.4 kb encompassing the complete DNA-A component of ToGMoV were obtained from one tomato sample by using two pairs of degenerate primers, prRepQGR-rev and prCP70 (1) and prRepDGR and prC889. Amplicons were cloned, sequenced, and compared with viral sequences available in the GenBank database using BlastN and Clustal V alignments (MegAlign, DNASTAR, Madison, WI). The 2,614-bp DNA-A sequence of the Rioverde isolate (GenBank Accession No. DQ520943) displays 93% sequence identity with the Guatemalan isolate of ToGMoV. In addition, a number of B. tabaci specimens of unidentified biotype were collected in one tomato field and total DNA was isolated from them by a modified Dellaporta method. Amplification of viral DNA present in the whiteflies was carried out and the PCR products were cloned and sequenced. One of the begomoviral DNA-A genomes isolated from the whiteflies (GenBank Accession No. EF501976) displayed 99% sequence identity with the virus isolated from plants. Previously, ToGMoV had been found only in Central America ( http://gemini.biosci.arizona.edu/viruses ), but this report considerably expands its known geographical distribution. References: (1) R. De La Torre-Almaraz et al. Plant Dis. 90:378, 2006. (2) J. A. Mauricio-Castillo et al. Plant Dis. 90:1116, 2006. (3) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

A Begomovirus Isolated from Chlorotic and Stunted Soybean Plants in Mexico is a New Strain of Rhynchosia golden mosaic virus.

Soybean (Glycine max Merr.) is an alternative crop during the summer in Sinaloa, a northern state of Mexico. During the last 4 years, symptoms of yellowing, curled leaves, and stunting have been observed on soybean plantings, and a scrutiny of field samples collected in 2003 identified a begomovirus related to Pepper golden mosaic virus in symptomatic plants (4). A new survey was conducted during the summer of 2004 when the soybean disease was prevalent in the region. Affected plants appeared as patches displaying symptoms ranging from mild to severe yellow mosaic with leaf deformation and stunted growth in several parcels of commercial fields of northern Sinaloa. More than 100 samples from symptomatic soybean plants and weeds growing within the same fields were collected and analyzed for the presence of begomoviruses using DNA hybridization with the coat protein gene of Pepper huasteco yellow vein virus as a probe. Thirty-eight soybean, 12 Rhynchosia sp., and 14 sunflower hybridization-positive samples were subsequently used for polymerase chain reaction (PCR) amplification with the degenerate primers pRep-DGR and pCP70-Mot (1). PCR products were cloned into pGEM-T Easy vector (Promega, Madison, WI) and sequenced. The amplified viral DNA (915 nt) from two soybean plants, Sb1 and Sb2 (GenBank Accession Nos. AY955101 and AY957561, respectively), one isolate from Rhynchosia minima (GenBank Accession No. AY955102), and one from Heliantus annum (GenBank Accession No. AY957560) were sequenced and compared with DNA sequences available at NCBI database using BLAST. The highest sequence similarity was obtained with the two known isolates of Rhynchosia golden mosaic virus, RhGMV [Honduras] (GenBank Accession No. AF239671), and RhGMV [Chiapas] (GenBank Accession No. AF408199), displaying a nucleotide identity of approximately 89% with the Sinaloa isolates. Sequence comparisons of the latter isolates showed that viruses in the weeds were 97% identical to one of the soybean isolates, RhGMV-Sb1, but differed significantly (88% of nucleotide identity) from the second soybean isolate, RhGMV-Sb2. The complete genome A sequence of RhGMV-Sb1 was determined using PCR amplification of viral DNA with four degenerate primers recently described (2), cloning of overlapping PCR products into pGEM-T Easy vector (Promega) and sequencing. The 2,604-bp DNA-A of RhGMV-Sb1 (GenBank Accession No. DQ347950) was compared with the homologous genome of RhGMV [Chiapas] and RhGMV [Honduras] using the CLUSTAL alignment method (MegAlign, DNASTAR software, London) and an overall nucleotide identity of 89.2 and 88.6%, respectively, was determined. Current taxonomic criteria for begomoviruses establish that a DNA-A sequence identity lower than 93% with other isolates of a virus is indicative of a separate strain (3). Therefore, the virus identified in this study is a new strain of RhGMV that is provisionally named Rhynchosia golden mosaic virus-Soybean [Mexico:Sinaloa:2004]. This is the first soybean-infecting begomovirus from the American continent whose genome A has been completely characterized as of today. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (2) R. De La Torre-Almaraz et al. Plant Dis. 90:378, 2006. (3) C. Fauquet et al. Arch. Virol. 150:2151, 2005. (4) J. Mendez-Lozano et al. Plant Dis. 90:109, 2006.

A New Strain of Tomato chino La Paz virus Associated with a Leaf Curl Disease of Tomato in Baja California Sur, Mexico.

Since 2001, geminivirus-like disease symptoms have been observed in tomato plants on the Baja California Peninsula of Mexico. These diseases have been associated with large populations of Bemisia tabaci (Genn.) in commercial fields and have caused dramatic decreases in expected yields. Leaf samples from tomato plants displaying symptoms of stunting and severe upward leaf curling were collected in March 2002 in fields located near the city of La Paz, Baja California Sur (BCS). Total DNA was extracted and tested for the presence of geminiviral DNA using polymerase chain reaction (PCR) with begomovirus-specific degenerate primer pairs PALIv1978/PARIc494 and PALIc1978/PARIv494 (4). PCR products of the expected size (~1.16 and ~1.45 kb) were obtained, cloned into pGEM-T Easy (Promega, Madison, WI), and sequenced. Restriction fragment length polymorphism analysis of the PCR fragments was performed using EcoRI, HindIII, PstI, and XbaI. Restriction fragment patterns were the same for all amplicons and no evidence of mixed infection was obtained. In addition, experimental transmission by whiteflies and inoculations by biolistics consistently induced severe leaf epinasty and stunted growth on tomato seedlings. The complete (2,606 nt) DNA-A sequence of the infecting virus was determined (GenBank Accession No. AY339618) and compared with viral sequences available at GenBank-EMBL databases using BLASTN and the CLUSTAL program (MegAlign, DNASTAR, Madison, WI). The highest nucleotide identity was obtained with the recently described Tomato chino Baja California virus, ToChBCV (90.2%, GenBank Accession No. AY339619), isolated from tomato plantings in El Carrizal, BCS, 100 km from La Paz (3). The second and third best scores were obtained with Tomato severe leaf curl virus from Nicaragua (ToSLCV-NI, 79.6%, GenBank Accession No. AJ508784) and Guatemala (ToSLCV-GT94, 73.8%, GenBank Accession No. AF130415), respectively. Overall, sequence similarity with other New World begomoviruses was rather low (less than 70% identity). Careful analysis of differences between the La Paz isolate and its closest relative, ToChBCV from El Carrizal, revealed that they display different Ori-associated iterons (i.e., replication (Rep)-binding sites) having GGAGTA and GGGTCY core sequences, respectively (1). Moreover, sequence comparisons of the Rep-binding domain (aa 1-120) showed that these domains are only 71% identical. Current taxonomic criteria for begomoviruses establishes that a virus DNA-A sequence identity below 89% with its closest relative is indicative of a separate species (2). Since the La Paz and El Carrizal isolates share 90.2% nt identity, they should be considered strains of a same virus species, recently renamed Tomato chino La Paz virus, ToChLPV (2). Nevertheless, the remarkable differences in their putative replication specificity determinants suggest that ToChLPV and ToChLPV-[BCS] could be incompatible in replication, an interesting issue that should be experimentally addressed. References: (1) G. R. Arguello-Astorga et al. Virology 203:90, 1994. (2) C. Fauquet and J. Stanley. Arch. Virol. 150:2151, 2005. (3) R. J. Holguín-Peña et al. Plant Dis. 89:341, 2005. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

First Report of Tomato severe leaf curl virus in México.

San Luis Potosí and Morelos are states situated in the north-central and south-central regions of Mexico, respectively, where a considerable area of agricultural land is occupied by tomato crops. In the summer of 2005, stunting and leaf curling/crumpling symptoms were observed in several tomato (Lycopersicon esculentum L.) fields in Rioverde, San Luis Potosí (Rioverde-SLP). These symptoms and the existence of large populations of whiteflies (Bemisia tabaci Gennadius) in the affected fields suggested a viral etiology. Symptomatic tomato leaves collected during July and September of 2005 from several locations throughout the Rioverde area were assessed for begomovirus presence using polymerase chain reaction (PCR) with three sets of degenerate primers: PAL1v1978/PAR1c496 (3), pCP70for/pCP70rev (1), and two new primers that specifically amplify DNA from viruses of the Squash leaf curl virus (SLCV) lineage, prSL060-for (CGGCGTTRTRRTARACGTCGTC) and prSL150-rev (GCWGCC-AAAGACACCAAYGCCGT). These primers amplify overlapping DNA segments encompassing the complete begomovirus genome A. Amplicons were cloned into pGEM-T easy vector (Promega, Madison, WI) and sequenced. The complete sequence for component A of isolates from two different fields in the Rioverde Valley were assembled and compared with sequences available in the GenBank database using BlastN and the Clustal alignment method (MegAlign, DNASTAR, Madison, WI). The 2588-bp sequence of the Rioverde-SLP1 isolate (Accession No. DQ347946) and the 2594-bp sequence of Rioverde-SLP2 isolate (Accession No. DQ347947) were 97.2% identical. Both field isolates displayed the highest similarity (97.1 and 97.3% nt identity, respectively) with Tomato severe leaf curl virus from Guatemala (ToSLCV-GT96; Accession No. AF130415). Similarity of SLP isolates with Tomato severe leaf curl virus from Nicaragua (Accession Nos. AJ508784 and AJ508785) was significantly lower, 89.9 and 89.7%, respectively. A parallel survey of tomato fields in Xochitepec, Morelos, located 550 km southeast of Rioverde-SLP, was performed during September, 2005. Leaf samples from six plants displaying leaf curling/crumpling symptoms were collected and assessed for begomovirus presence using PCR with the degenerate primers, prC889 (4) and prSL060-for. The 1.4-kb PCR fragments obtained were subsequently analyzed by restriction fragment length polymorphism using MspI and HhaI. Restriction fragment patterns were the same for all amplicons. The 1435-bp DNA A sequence of one isolate from Morelos was determined (Accession No. DQ267157) and compared with sequences available for other begomoviruses using Clustal alignment method. The highest identity (98%) was with ToSLCV-SLP and ToSLCV-GT96 isolates. These data confirm that ToSLCV is infecting tomato in different horticultural regions of Mexico. The presence of this begomovirus has been previously reported in Honduras, Guatemala, and Nicaragua (2). To our knowledge, this is the first report of ToSLCV in Mexico. References: (1) R. De La Torre-Almaraz et al. Plant Dis. 90:378, 2006. (2) M. K. Nakhla et al. Acta Hort. (ISHS) 695:277. Proc. First Int. Symp. on Tomato Diseases. M. T. Momol et al., eds., 2005. (3) M. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

A Begomovirus Associated with Leaf Curling and Chlorosis of Soybean in Sinaloa, Mexico is Related to Pepper golden mosaic virus.

Since June 2001, symptoms of yellowing, leaf curling, crumpling, and stunted growth were observed on soybean (Glycine max Merr.) plants in Sinaloa, Mexico. These symptoms and the presence of whiteflies (Bemisia tabaci Gennadius) in the affected fields suggested a viral etiology. Samples from symptomatic plants were collected from commercial fields and analyzed for the presence of begomoviruses using DNA hybridization, and as a probe, the DNA A of Pepper huasteco virus at low stringency (2). Thirty-five positive samples were subsequently used for polymerase chain reaction (PCR) amplification with the degenerate primers RepMot and CPMot (1). These primers direct the amplification of a DNA A segment comprising the entire intergenic region (IR) and the first 210 bp of the coat protein (CP) gene, which is highly variable in size and nucleotide sequence among begomoviruses. PCR products were obtained for 25 of 35 samples and five of these were cloned into the pGEM-T easy vector (Promega, Madison, WI) and sequenced. The 571-bp DNA sequence (GenBank Accession No. AY905553) was compared with sequences of other begomoviruses in GenBank using the Clustal alignment method (MegAlign, DNASTAR software, London). The sequence was 74 and 70% identical to the Pepper golden mosaic virus (PepGMV; GenBank Accession No. U57457) and Cabbage leaf curl virus (CaLCuV; GenBank Accession No. U65529) sequences, respectively. Interestingly, the partial coat protein gene sequence (210 nt) of this soybean-infecting virus was 98% identical to the CP gene of Tobacco apical stunt virus (TbASV; GenBank Accession No. AF076855). Nonetheless, the known sequence of TbASV intergenic region (GenBank Accession No. AF077744) is very different from the homologous region of the soybean virus (34% of nucleotide identity). Analysis of the soybean virus intergenic region revealed that it harbors almost identical iterons (i.e., Rep-binding sites) to PepGMV, suggesting a close relationship between these two viruses. Soybean-infecting geminiviruses have been previously reported only from Asia; however, the partial sequence of a begomovirus isolated from soybean in Brazil was recently deposited in Genbank (Accession No. AY436328). Sequence comparisons between the Brazilian and Mexican isolates showed these viruses are less related with a nucleotide identity of 46%. Taken together, our data indicate that the virus identified in this study might be either a different strain of PepGMV adapted to leguminous plants or a new begomovirus species. To our knowledge, this is the first report of a begomovirus infecting soybean in Mexico. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (2) J. Méndez-Lozano et al. Phytopathology 93:270, 2003.

A New Begomovirus Inducing Yellow Mottle in Okra Crops in Mexico is Related to Sida yellow vein virus.

Okra (Abelmoschus esculentus L. Moench), an annual vegetable of African origin, has been cultivated in Mexico for 3 decades. Since 2000, the most important okra-producing areas in the states of Guerrero and Morelos have been affected by a disease causing yellow streak and severe distortion of fruits, a bright yellow mottle, and curling and distortion of leaves. These symptoms and the presence of whiteflies (Bemisia tabaci Gennadius) suggest a viral etiology. Samples of symptomatic plants from three localities, Iguala (Guerrero), Mazatepec, and Xochitepec (Morelos) were collected in November 2004 and tested for the presence of viruses. Single whitefly transmissions, grafting experiments, and experimental inoculation of healthy plants by biolistic delivery of DNA extracts from symptomatic plants consistently induced yellow mottle in okra plants and suggest the presence of a DNA virus. Total DNA extracts from symptomatic plants from field and greenhouse conditions were analyzed by Southern blot hybridization using the coat protein gene of Pepper yellow vein huasteco virus as a probe at low stringency. More than 20 positive samples were subsequently used as templates for polymerase chain reaction (PCR) amplification with the degenerate primers pRepMot and pCPMot (1). PCR products of approximately 600 bp were obtained and directly sequenced. Eight isolates from the three localities (GenBank Accession Nos. AY624016 to AY624023) shared 97 to 100% nucleotide identity but were significantly different from other known begomoviruses. The complete genome A sequence of one isolate from Mazatepec (Ok-M3) was determined using PCR amplification of viral DNA with the degenerate primers PAL1v1978 and PAL1c1960 (3) and four new universal primers, pRepQGR (5'-TCCCTGWATGTTYGGATGGAAATG-3'), pRepQGR-rev (5'-CATTTCCATCCRAACATWCAGGGA-3'), pCp70-MAC (5'-GTC TAGACCTTRCANGGNCCTTCACA-3'), and pCp70-MAC-rev (5'-GAA GGSCCNTGYAAGGTNCAGTC-3'). Partially overlapping PCR products of 0.9, 1.3, and 1.7 kb were cloned into pGEM-T easy vector (Promega, Madison, WI) and sequenced. The 2612-bp DNA-A sequence of Ok-M3 (GenBank Accession No. DQ022611) was compared with sequences available from GenBank using the Clustal alignment method (MegAlign, DNASTAR software, London). The highest sequence identity was obtained with Sida yellow vein virus (SiYVV; Accession No. Y11099), Sida golden mosaic Honduras virus (SiGMHV; Accession No. Y11097), and Chino del tomate virus (CdTV; Accession No. AF101478) that had 85.4, 85.4, and 84.4% nucleotide sequence identity with the Ok-M3 isolate, respectively. Comparative analysis of the intergenic region of the Ok-M3 isolate and its closest relatives revealed that these viruses display different putative Rep-binding sites (iterons): Ok-M3 (GGTACACA), SiYVV (GGAGTA), and SiGMHV (GGKGTA). Current taxonomic criteria for the classification of begomoviruses establishes that less than 89% DNA-A nucleotide sequence identity with the closest relative of a virus is indicative of a separate species (2). Our results indicate that the okra-infecting virus identified in this study is a new begomovirus species, and the provisional name of Okra yellow mottle Mexico virus is proposed. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (2) C. Fauquet et al. Arch. Virol. 148:405, 2003. (3) M. Rojas et al. Plant Dis. 77:340, 1993.

Tomato mottle Taino virus pseudorecombines with PYMV but not with ToMoV: implications for the delimitation of cis- and trans-acting replication specificity determinants.

Over the last decade, the tomato production in Cuba has been affected by new whitefly-associated diseases. In addition to the well-documented presence of Tomato yellow leaf curl virus (TYLCV) along the island, the occurrence of bipartite begomoviruses has also been reported. One of them, tentatively named Tomato mottle Taino virus (ToMoTV), has now been cloned and characterized at the molecular level. Its genomic organization is similar to other bipartite geminiviruses. Phylogenetic analyses placed ToMoTV in a subcluster with other geminiviruses isolated in the Caribbean Basin: Tomato mottle virus (ToMoV), Bean dwarf mosaic virus, Abutilon mosaic virus, Sida golden mosaic virus and Potato yellow mosaic virus (PYMV). Biolistic inoculation of tobacco and tomato plants with cloned viral DNA showed that ToMoTV pseudorecombines with PYMV-GP as predicted by the identity of their iterative elements, whereas it does not show the same ability with ToMoV, even when their replication-associated proteins (Rep and REn) show the highest percentage of similarity. A comparative analysis of Rep proteins from begomoviruses that are able to produce viable reassortants suggests that some key elements for virus replication specificity are located in the first ten amino acids of this protein.

Macroptilium yellow mosaic virus, a New Begomovirus Infecting Macroptilium lathyroides in Cuba.

Macroptilium lathyroides (L) is a weed that is widely distributed in Cuba. Frequently, leaves show bright yellow mosaic symptoms, which suggest the incidence of a viral disease. Since begomovirus occurrence in Macroptilium lathyroides has been previously reported in other islands of the Caribbean (1,3), symptomatic plants from three distant places in Cuba (Havana, Villa Clara, and Camaguey), were collected and tested for the presence of begomoviruses. Plant DNA extracts were analyzed by Southern blot hybridization and polymerase chain reaction with two sets of degenerate primers (2). The presence of a bipartite begomovirus was evident through strong hybridization signals obtained with the DNA-A and DNA-B of Taino tomato mottle virus as probes at low stringency. Furthermore, 1.4-kb and 1.2-kb PCR amplified fragments were obtained with DNA-A degenerate primers, PAL1v1978-PAR1c715 and PAL1c1960-PAR1v722, respectively. Both PCR fragments from the samples from the three locations were cloned, and restriction fragment length polymorphism analysis of the 1.4-kb fragments were performed using PstI, EcoRI, HincII, XbaI and BglII. Restriction fragment patterns were the same for the three clones. The DNA-A sequence (GenBank Accession No. AJ344452) of the isolate from Villa Clara was compared with sequences available for other geminiviruses using CLUSTAL program. For the coat protein (CP) gene, the comparisons had the highest percentage of identity with various strains of Bean golden yellow mosaic virus (BGYMV, GenBank Accession Nos. AF173555, M91604, and L01635) (85 to 87% and 93 to 94%, nucleotide and amino acid sequences, respectively). For Rep gene (1,044 nt), the best percentages of identities were with BGYMV (81 to 82% and 80 to 82% nucleotide and amino acid sequences, respectively), Tomato leaf crumple virus (GenBank Accession No. AF101476) (78 and 81%, nucleotide and amino acid sequences, respectively), and Sida golden mosaic virus from Florida (GenBank Accession No. AF049336) (78 and 79%, nucleotide and amino acid sequences, respectively). Finally, the comparative analysis of the intergenic region (i.e. the common region plus the CP gene promoter) had the highest identity with BGYMV (56 to 55%) and Tomato severe rugose virus (GenBank Accession No. AY029750) (49%). Interestingly, this virus has in this region the three G-box elements that are characteristic of BGYMV but it differs in the Rep protein-binding iterative motif that is GGTGA instead of GGAGA, for BGYMV. These data indicate that this virus is a new begomovirus and the name of Macroptilium yellow mosaic virus (MaYMV) is proposed. References: (1) A. M. Idris et al. Plant Dis. 83:1071, 1999. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993. (3) M. E. Roye et al. Plant Dis. 81:1251, 1997.

First Report of Rhynchosia golden mosaic virus (RhGMV) Infecting Tobacco in Chiapas, Mexico.

After a tobacco virus outbreak associated with whiteflies in Chiapas, Mexico, we conducted a survey to detect the presence of begomoviruses. Previously, two tobacco-infecting geminiviruses were reported in the same geographical area: Texas pepper virus-Chiapas and Tobacco apical stunt virus (TPV-CPS and TbASV, respectively) (2). DNA extracts from symptomatic tobacco plants (yellow mosaic, severe foliar distortion, and dwarfing) were used to biolistically inoculate tobacco plants (1). After symptom expression, the viruses were analyzed by polymerase chain reaction (PCR) and sequencing. For the first PCR procedure, the primers used (RepMot: 5'GAGTCTAGAGGATANGTRAGGAAATARTTCTT GGC3' and CPMot: 5'CGCGAATTCGACTGGACCTTACATGGNCCTT CAC3') were designed from conserved regions of the Rep and CP genes, and directed the amplification of a fragment that includes the intergenic region and varies in size from 600 (for New World begomoviruses) to 750 bp (Old World begomoviruses). Cloning of the PCR products (approximately 600 bp) was performed in the pCRII vector (Invitrogene, San Diego, CA), and viral inserts derived from different symptomatic plants were sequenced. Nucleotide sequence comparisons were performed using the Clustal method (MegAlign, DNAStar software, Madison, WI) with GenBank databases. Analysis of the PCR products allowed the identification of two types of viral sequences. The first virus identified was 98% identical to TPV-CPS, whereas the second virus was clearly related to Rhynchosia golden mosaic virus (RhGMV; 91% identity in the amplified region), and 65% identical to Pepper Huasteco virus (PHV). To disclose the identity of the second virus, another set of primers was used, p260 and p261 (4). These primers are located back-to-back in a conserved region of the CP gene, and direct the amplification of a full-length DNA-A from circular templates. The resulting PCR fragment (2.6 kb) was cloned in pCRII and fully sequenced (GenBank Accession No. AF408199). Analysis showed that this tobacco-infecting geminivirus is a strain of the recently described RhGMV from Honduras (3) (overall DNA A sequence identity, 94%; protein similarities: CP, 98.4%; AL1, 93.6%; AL2, 92.8%; and AL3, 91.7%). Comparative analysis of the intergenic regions of RhGMV-Tob, TPV-CPS, and TbASV showed that these viruses display different Ori-associated iterative motifs (iterons): RhGMV-Tob (GGTRT/G), TPV-CPS (GGAGTC), and TbASV (GGTAT). Since iterons are critical determinants of replication specificity, this observation indicates that those viruses are probably unable to form infectious pseudorecombinants in nature. To date, at least three different geminiviruses have been identified from symptomatic tobacco samples in Chiapas (2), showing how complex a geminiviral outbreak can be in a permissive environment. To our knowledge, this is the first time that the presence of RhGMV has been reported in Mexico and also the first time that this virus has been associated with an economically important crop. References: (1) J. Garzon-Tiznado et al. Phytopathology 83:514, 1993. (2) M. Paxidamis et al. Arch. Virol. 144:703, 1999. (3) J. L. Potter et al. Plant Dis. 84:1045, 2000. (4) I. Torres-Pacheco et al. Phytopathology 86:1186, 1996.

An iteron-related domain is associated to Motif 1 in the replication proteins of geminiviruses: identification of potential interacting amino acid-base pairs by a comparative approach.

Geminiviruses encode a replication initiator protein, Rep, which binds in a sequence-specific fashion to iterated DNA motifs (iterons) functioning as essential elements for virus-specific replication. By using the iterons of more than one hundred geminiviruses as heuristic devices, we have identified a Rep subdomain 8 to 10 residues in length, whose primary structure varies among viruses harboring different iterons, but which is similar among viruses with identical iterons, regardless of their differences in host range, insect vector, geographical origin or genome structure. Close analysis of this iteron-related domain (IRD) revealed consistent correlations between specific Rep residues and defined nucleotides of its cognate iteron, thus providing important insights about the molecular code which dictates the Rep preference for specific DNA sequences. A model of potential Rep-iteron contacts is proposed. The identified IRD is adjacent to a conserved motif characteristic of a superfamily of rolling-circle (RC) replication proteins, and secondary structure predictions suggest that those Rep subdomains form together the core of a novel DNA-binding domain possessing a beta-sheet as recognition subdomain, which is apparently conserved in the replication proteins of nanoviruses, circoviruses, microviruses, and a variety of ssDNA plasmids of eubacteria, archaebacteria and red algae. The evolutionary implications of these findings are discussed.

Identification of a sequence element involved in AC2-mediated transactivation of the pepper huasteco virus coat protein gene.

The geminivirus AC2 gene product transactivates the expression of the coat and movement protein (CP and BV1) genes, and this effect seems to be mediated by specific although hitherto unknown cis-acting elements. In this work we examined regions from the CP and BV1 gene promoters of pepper huasteco virus (PHV) to define the sequence elements involved in regulation by AC2. Results from transient gene expression and transgenic plant assays suggest that a truncated 115-nt CP promoter is still responsive to the viral transactivator. This promoter contains three elements similar to a sequence motif termed conserved late element (CLE), which is found in the regulatory regions of many geminiviruses and that was previously suggested, on a theoretical basis, to be a potential functional target for AC2 (Argüello-Astorga et al. (1994), Virology 203, 90-100). To confirm these results, an oligonucleotide containing two CLE motifs was synthesized and characterized in gain-of-function experiments. Transient expression assays showed that this 29-nt sequence is able to confer AC2 responsiveness to heterologous promoters. A smaller oligonucleotide (16 nt) containing a single CLE also conferred this activity. In addition, when the CLE motifs were mutated in their original context (truncated 115-nt promoter), this modified promoter lost its ability to be transactivated by AC2. All these results support the involvement, at least in the case of PHV, of CLE sequences in the process of transactivation.

First Report of Tomato Yellow Leaf Curl Geminivirus in Yucatán, México.

Geminiviruses are probably the most important viral pathogen affecting tomatoes and other crops in the Caribbean region. In addition to losses previously caused by native virus populations, the introduction of tomato yellow leaf curl virus (TYLCV) into the area has become a major concern for tomato growers (1). Since the detection of TYLCV in Cuba, and later in Florida (2,3), we have been monitoring the tomato- and pepper-growing areas of the Yucatán Peninsula, México, for TYLCV. We also have reanalyzed samples previously collected. Other geminiviruses (pepper huasteco virus [PHV], Texas pepper virus [TPV], and tomato mottle virus [ToMoV]) in the area can cause symptoms similar to those induced by TYLCV, which led us to refine our analysis of samples, using a polymerase chain reaction (PCR) procedure that can differentiate between monopartite and bipartite begomoviruses based on the size of the amplification product, 750 and 600 bp, respectively. One advantage of using this set of primers is that the PCR product, which includes the amino terminus of the Rep protein, intergenic region, precoat protein, and amino terminus of the coat protein, can be sequenced completely with only one sequencing reaction from each end. Using the primer set, we analyzed samples collected from tomato and pepper fields (as well as from weeds surrounding the fields) from December 1996 until March 1999. In most cases, samples were taken from plants that showed yellowing, curling, and stunting symptoms. Most of the samples that were positive for geminiviruses came from plants infected with PHV or TPV. However, three tomato samples collected during two seasons in Dzidzantun and Yobain counties (northeast of Mérida, Yucatan) produced the larger PCR amplification product (750 bp) expected for monopartite begomoviruses. PCR products were cloned and sequenced to confirm their identity. The sequence was deposited in the GenBank Database (Accession no. AF168709) and compared with all geminivirus sequences deposited in the database. Analysis showed that the amplified fragment from the TYLCV strain present in the Yucatán is 99% identical to the isolate reported in the Dominican Republic and later found in Cuba (2). As previously noted, the isolate is almost identical to TYLCV-Isr (2). In addition to the PCR product, a full-length TYLCV clone was obtained directly from DNA extracts of an infected tomato plant. Further characterization of the full-length clone is underway. The fact that TYLCV was detected in two counties and in samples collected during two seasons confirms the presence of TYLCV in the Yucatán. Interestingly, although the first positive sample for TYLCV was collected during the winter of 1996 and 1997, current incidence is rather low-only two other positive samples have been detected in more recently collected samples. Perhaps the characteristics of the agriculture system in the Yucatán (small, disperse plots) or the presence of other geminiviruses have contributed to a slow spread of the virus. More comprehensive surveys are required to confirm the actual distribution of the pathogen in the area. References: (1) J. E. Polston et al. Plant Dis. 81:1358, 1997. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) P. L. Ramos et al. Plant Dis. 80:1208, 1996.

Ancestral multipartite units in light-responsive plant promoters have structural features correlating with specific phototransduction pathways.

Regulation of plant gene transcription by light is mediated by multipartite cis-regulatory units. Previous attempts to identify structural features that are common to all light-responsive elements (LREs) have been unsuccessful. To address the question of what is needed to confer photoresponsiveness to a promoter, the upstream sequences from more than 110 light-regulated plant genes were analyzed by a new, phylogenetic-structural method. As a result, 30 distinct conserved DNA module arrays (CMAs) associated with light-responsive promoter regions were identified. Several of these CMAs have remained invariant throughout the evolutionary radiation of angiosperms and are conserved between homologous genes as well as between members of different gene families. The identified CMAs share a gene superfamily-specific core that correlates with the particular phytochrome-dependent transduction pathway that controls their expression, i.e. ACCTA(A/C)C(A/C) for the cGMP-dependent phenylpropanoid metabolism-associated genes, and GATA(A/T)GR for the Ca2+/calmodulin-dependent photosynthesis-associated nuclear genes. In addition to suggesting a general model for the functional and structural organization of LREs, the data obtained in this study indicate that angiosperm LREs probably evolved from complex cis-acting elements involved in regulatory processes other than photoregulation in gymnosperms.

Experimental and theoretical definition of geminivirus origin of replication.

Geminiviruses are plant pathogens that replicate by a rolling-circle mechanism, analogous to that used by several prokaryotic ssDNA replicons. Recent reports provide important progress in understanding the structure and functioning of replication origin from these viruses. We have used these data to propose models for the initiation of replication in dicot- and monocot-infecting geminiviruses.

Geminivirus replication origins have a group-specific organization of iterative elements: a model for replication.

A phylogenetic and structural analysis of the intergenic region of 22 dicot-infecting and 8 monocot-infecting geminiviruses was carried out. The analysis allowed the identification of iterative sequence motifs 8-12 nucleotides in length, whose organization (number, orientation, and spacing) is highly conserved within each of the three major lineages of dicot-geminiviruses, according to the phylogeny derived from the amino acid sequences of the replication-associated protein (AL1). The iterated elements differ in sequence even between closely related viruses, and are found in the vicinity of the putative TATA box of the AL1 gene in all dicot-infecting geminiviruses. Analogous elements were identified also in monocot-infecting geminiviruses, but the arrangement was different, since one of the iterative sequences is part of the conserved hairpin structure essential for replication of all the members of this viral family. We propose here that the iterated sequences are the specific binding sites of the geminiviral replication-associated proteins and show that the hypothesis is in agreement with the experimental data available to date. Additionally, a model of geminivirus replication that involves the participation of host transcription factors in the process is presented.